|
|
||||||||
Division of Thoracic Surgery, Department of Surgery Brigham and Womens Hospital, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Studies using murine BMT models have demonstrated that these limitations can potentially be overcome with the use of purified cell populations. Facilitating cells (FC), isolated as CD8 positive (CD8
+) and 


TCR negative (


TCR–) are bone marrow (BM)-derived cells that reliably promote purified allogeneic stem cell (SC) reconstitution with resulting transplantation tolerance across complete MHC barriers without clinical or histological evidence of GVHD (3, 4, 5, 6). Therefore, FC permit the reconstitution of the donor immune system within allogeneic recipients. However, the mechanisms associated with donor FC function in SC engraftment and induction of tolerance, are not yet clear. Previous reports have demonstrated that FC transplantation result in increased gene expression of regulatory T cell-associated factors forkhead/winged helix transcription factor (FoxP3), GITR, and CTLA4. The increased gene expression was detected within the spleen of recipients and suggested the induction of a regulatory response (4). The mechanisms by which such a regulatory network could arise after SC plus FC transplantation have not yet been characterized.
The FC population contains a subset that expresses markers consistent with a plasmacytoid dendritic cell (DC) phenotype (5). In an inactivated state, immature pDC are called plasmacytoid precursor DC (p-preDC) (7). Upon activation, p-preDC differentiate and are capable of activating naive CD4+25– T cell differentiation. To date, pDC have been characterized as the principal inducers of CD4+25– T cell differentiation into regulatory CD4+25+ and T regulatory 1 (Tr1) cells capable of suppressing effector T cell proliferation (7, 8, 9, 10, 11, 12, 13, 14). In vitro studies have demonstrated that activation of TLR-9 on p-preDC induces their differentiation and ability to prime naive CD4+25– T cells and induce development into regulatory CD4+25+ or Tr1 regulatory T cells (15, 16, 17, 18). We hypothesize that the donor FC population may have a similar function following transplantation. Although similarities between BM-derived FC and p-preDC have been described, recent findings have identified markers on the FC population that are not present on p-preDC (5, 19, 20). These findings showed that FC are distinct from p-preDC in that the FC population expresses TCR
and CD3
and p-preDC do not. These receptors are also required for FC function in vivo. The TCR
-chain expression is unique to the FC, in that instead of expressing the conventional 
TCR heterodimer, FC express a unique heterodimer composed of the TCR
-chain disulfide linked to a 33kDa protein named FCp33 (19). Furthermore, in a fully allogeneic murine model of SC plus p-preDC or SC plus FC transplantation, p-preDC are much less efficient at facilitating SC engraftment than the FC population (5). These findings demonstrate that there are functional characteristics unique to the FC population. However, FC and p-preDC may share the ability to induce regulatory T cells.
Numerous reports have documented CD4+25+ regulatory T cell involvement in the promotion of hemopoietic cell reconstitution (21), GVHD suppression (22, 23, 24), and the establishment of self-tolerance (25, 26, 27, 28). Specifically, CD4+25+ regulatory T cell transplantation resulted in allogeneic hemopoietic cell engraftment with increased long-term multilineage donor chimerism in sublethally irradiated murine recipients (21). These findings demonstrate a role for CD4+25+ regulatory T cells in allogeneic hemopoietic cell reconstitution across fully mismatched MHC barriers. Although the mechanisms of regulatory T cell function are not completely clear, the development and activation of CD4+25+ regulatory T cells have been linked to interactions with pDC.
The present study investigates the development of regulatory T cells following allogeneic SC plus FC transplantation in vivo and assesses the ability of FC to directly induce naive CD4+25– T cell differentiation into CD4+25+ regulatory T cells in vitro. We report that 1) FoxP3+CD4+25+ regulatory T cells are induced within the spleen of SC plus FC recipients postarrival of FC to the spleen, 2) activated FC induce CD4+25– T cell differentiation into FoxP3+CD4+25+ regulatory T cells in vitro, and 3) direct cell-cell contact between FC and CD4+25– T cells is required for FC-mediated regulatory T cell development in vitro. These findings provide the first mechanistic evidence that FC can induce the generation of FoxP3+CD4+25+ regulatory T cells and may have a role in the subsequent development of transplantation tolerance in vivo.
| Materials and Methods |
|---|
|
|
|---|
Six- to 8-wk-old female C57BL/6 (B6) and B10.BR mice were purchased from The Jackson Laboratory. All animals were housed in a specific pathogen and viral-free facility at the Dana-Farber Cancer Institutes under the guidelines of the National Institutes of Health for care and use of laboratory animals.
BM cell preparation
BM preparation was performed as previously described (19, 20). In brief, BM was isolated from the long bones of mice by flushing with cold HBSS (Invitrogen Life Technologies). After washing with HBSS, BM cells were resuspended in sterile cell sort medium (Invitrogen Life Technologies; cell sort media (CSM): HBSS without phenol red, 2% FBS, 2 µg/ml HEPES buffer, and 30 µg/ml gentamicin).
Monoclonal Abs
The following mAbs were used to sort CD8+TCR– FC: anti-CD8
(53-6.7) PE, anti-TCR
-chain (H57–597) FITC, and anti-TCR
chain (GL3) FITC. To sort spleen CD4+25– or CD4+25+ cells, the following were used: anti-CD4 (GK1.5) FITC and anti-CD25 (PC61) allophycocyanin. To sort B220+CD11b–CD11c+ p-preDC, the following were used: anti-CD45R/B220 (RA3-6B2) allophycocyanin, anti-CD11b (M1/70) FITC, and anti-CD11c biotin, with streptavidin PE-Cy5. To sort Sca-1+/c-kit+/Lin– stem cells, Lin– were all FITC conjugated as follows: B220, CD8
, Gr-1, MAC-1, 
TCR, and 
TCR. Purified anti-mouse CD3
(145-2C11) and CD28 (37.51) were used in the proliferation assays. FITC-conjugated anti-mouse H-2Kb (AF6–88.5) and H-2Kk (36-7-5) were used for donor chimerism analysis. CD86 (GL1) PE-Cy5 and FoxP3 (FJK-16s) PE with isotype control Rat-IgG were purchased from eBiosciences, San Diego, CA. All other sort mAbs were purchased from BD Biosciences, San Jose, CA.
Purified p-preDC and T cell isolation
p-preDC from BM and CD4+25– or CD4+25+ T cells from spleen were sorted as previously described (5, 20). In brief, cells were incubated for 30 min at 4°C with mAbs. After incubation, the cells were washed twice with CSM and resuspended to a final concentration of 2 x 108 cells/ml in CSM before multiparameter sterile live cell sorting within the conventional lymphoid gate on a MoFlo flow cytometric cell sorter (DakoCytomation). Postsort purity was determined with respect to forward and side scatter parameters and the designated cell surface markers. Postsort purity for p-preDC was 90–95% and spleen T cells was >95%.
Purified SC and FC isolation and transplantation
SC, FC, and BM T cells (TBM) were isolated from donor BM as described previously (3, 4, 19, 20). SC were sorted on a MoFlo cell sorter as Sca-1+/c-kit+/Lin– (Lin: B220, CD8
, Gr-1, MAC-1, 
TCR, and 
TCR) cells within the lymphoid cell gate. FC and TBM were also sorted within the lymphoid gate as CD8+/


TCR– and CD8+/


TCR+ populations, respectively. The range for postsort purity was 88–98%. Lethally irradiated (950cGy) B10.BR recipients were reconstituted with 10,000 B6-derived SC alone, or together with 50,000 B6-derived FC (SC plus FC) or TBM (SC plus TBM). Ablated B6 mice transplanted with 2,000 B6-derived SC served as syngeneic controls. Allogeneic SC reconstitution was determined by PBL typing of donor (H-2b) MHC Ag expression 28 days following BMT and expressed as percentage of donor chimerism.
RNA isolation and reverse transcription
Total RNA was isolated from sorted cell populations or whole spleen using the RNeasy System, (Qiagen) and converted to cDNA, (Ambion), as recommended by the manufacturers instructions.
Conventional PCR
The primer sequences for IL2 (internal constitutive control): (sense, CTAGGCCACAGATTGAAAGATCT and anti-sense, GTAGGTGGAAATTCTAGCATCATCC) and GFP (sense, AAGTTCATCTGCACCACCG and anti-sense, TCCTTGAAGAAGATGGTGCG) were used for analysis of gene transcripts. Conventional PCR was performed for 40 cycles for 1 min at 94°C, followed by 1-min incubations of 60°C and 72°C, with a final 10-min extension at 72°C. Products were visualized on a 1.5% agarose gel stained with ethidium bromide.
Real-time quantitative PCR
Real-time PCR was performed using 3–10 µl cDNA mixed with diethyl pyrocarbonate-treated water, PCR master mix (Applied Biosystems), and the primer pairs. The gene-specific, real-time PCR products were measured for 40 cycles using the Gene Amp 5700 Sequence Detection System. Nontemplate controls and dissociation curves were used to detect nonspecific amplification and the formation of primer-dimers. All experiments were run in duplicate and gene expression was normalized to the expression of the housekeeping gene, GAPDH.
CpG-oligodeoxynucleotide (ODN) and FC stimulation assay
Phosphorothioate-modified CpG-B ODN 2006: 5' TCGTCGTTTTGTCGTTTTGTCGTT 3' (18) was obtained from Invitrogen Life Technologies (modified nucleotides are underlined). FC were cultured in presence or absence of CpG-ODN at 10 µg/ml. Cultures were harvested for analysis of gene expression or cytokine production by ELISA and flow cytometry.
ELISA
Cell-free supernatants of 48-h cultures of FC in the presence or absence of CpG-ODN were collected. The amount of cytokines produced was determined by ELISA multiplex for IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12p70, IL13, MIP1
, MIP2, IFN-
, and TNF-
. Supernatants from two independent experiments were analyzed using Pierce Diagnostic Services.
Flow cytometry
Cell suspensions were incubated at 4°C with fluorophore- or biotin-conjugated primary mAbs directed against designated surface markers. Biotinylated mAbs were detected with streptavidin-PE-Cy5 secondary mAbs. For analysis of extracellular expression of CD86, FC cells were sorted as previously described, stimulated with CpG-ODN and harvested in FACS buffer (HBSS with 0.05% BSA and 0.05% sodium azide). Cell suspensions of CpG-stimulated and unstimulated FC were incubated with the mAb for CD86 (anti-CD86 PE-Cy5) or isotype control (Rat-IgG PE-Cy5) for 30 min at 4°C. The cells were washed twice with FACS buffer and then fixed with 2% paraformaldehyde in PBS. For analysis of FoxP3 protein, intracellular labeling was used. Cells were first labeled for extracellular CD4 and CD25 receptors, followed by fixation of cells in cells 2% paraformaldehyde, permeabilization using 0.05% Triton X-100 in PBS, and then labeled for intracellular FoxP3 with anti-FoxP3 mAb. The isotype control was Rat-IgG. For all studies, fluorescence of 10,000 cells within the lymphoid gate was assessed on a FACSCalibur flow cytometer (BD Biosciences).
T cell functional assays
CD4+CD25+ and CD4+CD25– cells were purified from splenocytes via cell sorting. CD90+ depleted cells were recovered from naive spleens by magnetic depletion (Miltenyi Biotec), irradiated at 3000cGy and used as accessory cells. Cells were cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS, penicillin (100 U/ml), streptomycin (100 mg/ml), 2 mM L-glutamine, (all from Invitrogen Life Technologies) and 50 µM 2-ME (Sigma-Aldrich). Purified cell populations were tested for proliferative potential in presence of anti-CD3 mAb, anti-CD28 mAb, and rIL-2 (PeproTech) as described previously (29). CD4+CD25+ regulatory T cell suppressive function was tested by coculturing CD4+CD25– T cells with increasing ratios of CD4+CD25+ cells (1:0, 1:0.1:0.25 and 1:1) in the presence of anti-CD3 mAb and accessory cells in flat-bottom 96-well plates. Cultures were maintained in a humidified incubator at 37°C, 5% CO2, for 72 h and labeled with [3H] (8-h pulse) to ascertain the level of proliferation. Data are expressed as mean ± SEM cpm.
In vitro stimulation of naive CD4+25– T cells
Spleen CD4+25– T cells were incubated with FC or p-preDC at a 10:1 ratio in 96-well plates with or without CpG-ODN in medium (RPMI 1640 supplemented with 10% FBS, and 2 mM L-glutamine) for up to 6 days. As negative controls, naive CD4+25– T cells were cultured alone, with FC, or with CpG. The cocultures were harvested and the generated CD4+25+ T cells were sorted and analyzed for FoxP3 and cytokine gene transcripts using real-time PCR.
CD86 blockade assay
In vitro stimulation of CD4+25– T cells was performed as previously described in the absence or presence of anti-CD86 Ab at 1 µg/ml. As negative controls, naive CD4+25– cells alone or with FC were cultured with anti-CD86 Ab. The cells were cocultured up to 6 days, harvested, and the generated CD4+25+ T cells were sorted and analyzed for FoxP3 gene expression.
Statistical analysis
Survival fractions were determined using Kaplan-Meier analysis. Means and variances for real-time PCR data were estimated using JMP statistical software (SAS Institute). Significant differences (p
0.05) were ascertained via Students t test.
| Results |
|---|
|
|
|---|
It is well established that FC promote purified allogeneic SC engraftment and subsequent transplantation tolerance across complete MHC barriers without clinical or histological evidence of GVHD (3, 4, 5, 6). However, the mechanisms associated with FC function are not yet clear. Given that donor SC engraftment and tolerance following SC plus FC transplantation parallel the outcome of CD4+CD25+ regulatory T cell-mediated engraftment of allogeneic hemopoietic cells and subsequent tolerance, we hypothesized that FC function may result in an induction of CD4+CD25+ regulatory T cells. The current studies first investigated CD4+25+ T cell development following SC plus FC transplantation. CD8+TCR– FC vs BM-derived CD8+TCR+ TBM were used in a fully allogeneic (C57BL/6
irradiation conditioned B10.BR) mouse model. TBM recipients develop GVHD and fail to survive beyond 7 wk. Splenocytes and BM from recipients were assessed for CD4 and CD25 coexpression using flow cytometric analysis. As reflected in the representative panel in Fig. 1A, a significantly higher frequency of CD4+CD25+ T cells was present in the lymphoid populations of whole spleens (2.03 ± 0.28%) and BM (1.03 ± 0.29%) in SC plus FC recipients (n = 12, p = 0.01) compared with spleens (1.07 ± 0.29%) and BM (0.35 ± 0.1%) of surviving SC plus TBM recipients (n = 7). This represents a nearly 2- and 3-fold increase in CD4+CD25+ frequency in the spleens and BM of SC plus FC recipients, respectively. Given that an increased incidence of recruited or proliferating non-T cell types could also decrease the frequency of CD4+CD25+ T cells in SC plus TBM, CD4+CD25+ T cells were also assessed as a fraction of the total CD4+ cell pool. CD4+CD25+ T cells accounted for 11.3 ± 1.3% and 5.7 ± 0.9% of the total splenic CD4+ cell pool in SC+FC and SC+TBM recipients respectively, reflecting a 2-fold increase in the number of CD4+CD25+ splenic cells in SC plus FC recipients. Therefore, in contrast to TBM recipients that develop GVHD, FC recipients show a significant induction of CD4+25+ cells within the spleen.
|
CD4+25+ T cells derived from SC plus FC recipients are anergic and suppress the activity of CD4+25– T cells in vitro
We next investigated the functional regulatory activity of CD4+CD25+ T cells sorted from the spleen of SC plus FC recipients. CD4+CD25+ and CD4+CD25– cells isolated from SC plus FC spleens were incubated with purified anti-CD3 mAb alone, or in combination with IL2 or anti-CD28 mAb. As shown in Fig. 1C, the CD4+CD25– T cells are not anergic; rather, these cells are functional and capable of proliferation in the presence of CD3 mAb alone. Furthermore, the functional capability is enhanced by the addition of IL2 or anti-CD28 mAb. In contrast, the CD4+CD25+ T cells are anergic, exhibiting a decreased proliferative response to anti-CD3 mAb, even in the presence of IL2. Importantly, these CD4+CD25+ cells are potent functional regulatory T cells, as evident by their ability to exhibit a nearly 100-fold inhibition of CD4+CD25– T cell proliferation during coculture at a 1:1 ratio (Fig. 1D).
Donor FC are present in the spleen of recipients before FoxP3+CD4+25+ regulatory T cell induction
Given the current demonstration that regulatory T cells are induced within the spleen of SC plus FC recipients, we investigated whether FC were also present in recipient spleens following transplantation. To identify donor FC within an in vivo model of allogeneic transplantation, B6-derived GFP+ FC were transplanted with GFP– SC into irradiation-conditioned B10.BR recipients. Splenocytes were harvested from SC plus GFP+ FC recipients 2 and 4 wk following transplantation. GFP transcript was detected by conventional PCR. Amplification of the IL2 transcript was used as an internal control for PCR conditions. As demonstrated in Fig. 2A, GFP+ donor FC are readily detected in recipient spleens as early as 2 wk posttransplantation. Importantly, concurrent analysis of FoxP3 gene expression in these samples by real-time PCR revealed that the induction of FoxP3 gene expression did not occur until 4 wk following FC transplantation (Fig. 2B). The current findings demonstrate that FoxP3+CD4+25+ regulatory T cell induction and/or recruitment follows the arrival of donor FC within the recipient spleen.
|
Given that the identification of FC within the spleen of SC plus FC recipients is followed by an induction of regulatory T cells of donor origin, we addressed the possibility that FC directly induce the development of CD4+25+ regulatory T cells. The basis is formulated from the demonstration that the FC population contains a subset of cells that is B220+CD11c+, a phenotype that is characteristic of p-preDC. In vitro studies have demonstrated that activation of TLR9 on p-preDC result in their differentiation and ability to induce naive CD4+25– T cell differentiation into regulatory CD4+25+ or Tr1 regulatory T cells (15, 16, 17, 18). We have chosen to use a similar assay to test the FC ability to induce CD4+25+ regulatory T cells in vitro as a possible mechanism for the observed induction of CD4+25+ regulatory T cells following SC plus FC transplantation. As demonstrated in the current studies, the majority of splenic CD4+25+ T cells of SC plus FC recipients are of donor origin. Therefore, we have analyzed the interactions between donor cell types and our subsequent in vitro studies used a syngeneic in vitro model for analysis of FC-mediated induction of CD4+25+ regulatory T cells. For these studies, FC and CD4+25– T cells were isolated from the bone marrow and spleen of C57BL/6 mice. It is our hypothesis that similar to p-preDC the in vitro activation of TLR9 on FC in coculture with CD4+25– T cells results in T cell differentiation into CD4+25+ regulatory T cells. We began our investigation by contrasting TLR9 gene expression within the FC population to p-preDC, mature DC, NK, and T cells. In this study, we demonstrate that purified FC and p-preDC have similar TLR9 gene expression levels (Fig. 3) and, as expected, the gene expression within these populations is greater than expression levels within mature DC and NK cells that are other potential immune-modulating cell populations (5). Therefore, in subsequent studies, FC were stimulated with the TLR9 ligand CpG-ODN 2006, a B-type ODN previously shown to stimulate p-preDC in coculture with CD4+25– T cells (18, 30, 31, 32, 33). CD4+25– T cells from the spleen of B6 mice were cocultured with FC alone, CpG alone, or FC and CpG in medium for up to 6 days. The T cells cultured with FC alone generated few CD4+25+ cells as represented by 0.4 ± 0.2% of total CD4+ T cells recovered (Fig. 4A). In contrast, CpG-stimulated FC T cell cocultures resulted in increased T cell differentiation into CD4+25+ T cells as represented by 1.82 ± 0.10% of total CD4+ T cells recovered (p = 0.001). Therefore, the current findings demonstrate a nearly 5-fold difference in the number of generated CD4+25+ T cells. Because FoxP3 is preferentially expressed in CD4+25+ regulatory T cells and is associated with both the development and suppressive function of these cells (34), FoxP3 gene and protein expression were evaluated within CD4+25+ T cells generated from cocultures using real-time PCR and flow cytometric analysis, respectively (Fig. 4, B and C). The real-time PCR analysis revealed that the CD4+25+ T cells generated from CpG-stimulated FC in CD4+25– T cell cocultures expressed the FoxP3 transcript at similar levels to T cell cocultures with CpG-stimulated p-preDC. The T cell cocultures with p-preDC and CpG were used as positive controls for the assay. In contrast, the CD4+25+ T cells generated from the coculture of CD4+25– T cells with FC alone expressed very little to no FoxP3 transcript. The gene expression data were supported with analysis of FoxP3 protein expression. As demonstrated in Fig. 4C, of the total CD4+25+ T cells generated from CpG-stimulated FC-T cell cocultures, 20 ± 3% expressed the FoxP3 protein. In contrast, 3.3 ± 1% of the CD4+25+ T cells generated from FC T cell cocultures without CpG-expressed FoxP3 protein. These findings demonstrated that CpG-stimulated FC induced the generation of FoxP3+CD4+25+ T cells. The FC-generated FoxP3+CD4+25+ T cells were further analyzed for gene expression of cytokines associated with the regulatory T cell phenotype. Interestingly, real-time PCR analysis of cytokine transcripts within the FC generated CD4+25+ T cells revealed a significantly higher level of IL4 transcript in contrast to expression within freshly isolated native CD4+25+ T cells or p-preDC induced CD4+25+ T cells (Fig. 4D). These findings support previous reports demonstrating that the CD4+25+ T cells generated from the induction of naive CD4+25– T cell differentiation in the spleen express higher levels of IL4 when compared with native CD4+25+ T cells (35, 36). Importantly, although FC have previously been characterized as having a p-preDC like subset (5), FC-generated CD4+25+ T cells express a significantly higher level of IL4 transcript compared with p-preDC generated CD4+25+ T cells (p = 0.047). Taken together, these finding demonstrate that CpG-stimulated FC are capable of inducing the differentiation of naive CD4+25– T cells into CD4+25+ T cells that express FoxP3. Furthermore, the FC-generated regulatory T cells display a cytokine gene expression profile consistent with the induction of CD4+25+ regulatory T cells within the spleen.
|
|
We have demonstrated that the in vitro stimulation of FC in coculture with CD4+25– T cells results in T cell differentiation into FoxP3+CD4+25+ regulatory T cells. We next investigated the mechanism of this FC-mediated induction by assessing whether CpG-stimulated FC express cytokines that are associated with the induction of regulatory T cells as similarly demonstrated with p-preDC. Supernatants from CpG-stimulated and unstimulated FC were collected and assayed via ELISA for the presence of cytokines. Fig. 5, A and B, show an induction of TNF-
and IL6 protein secretion and no increase in the production of IL12p70. IL10 along with IFN-
are increased within stimulated FC (Fig. 5C). However, IL2 and IL4 were not detected following stimulation of the FC population. In addition, FC produced high levels of MIP1
but did not produce IL1, IL5, and IL13 (data not shown). Prior studies have demonstrated that CpG-stimulated p-preDC secrete inflammatory cytokines such as IL6, TNF-
, and IL12 mostly for autocrine function. Our observation that CpG-stimulated FC also secrete these inflammatory cytokines suggest a requirement not only for FC differentiation but also for subsequent FC-mediated induction of CD4+25+ regulatory T cells. The observed production of cytokines supports the induction of a cytokine milieu previously implicated in the differentiation of p-preDC and p-preDC-mediated induction of regulatory T cells.
|
To assess whether FoxP3+CD4+25+ regulatory T cell induction was merely due to cytokine production via CpG-stimulated FC or if direct cell-cell interaction between FC and CD4+25– T cells was required, CD4+25– T cells were cocultured with FC plus CpG or separated from FC plus CpG by transwell membranes. As shown in Fig. 6A, in FC-T cell cocultures 2.26 ± 0.44% of total CD4+ T cells recovered were CD4+25+ T cells. In contrast, only 0.84 ± 0.11% of total CD4+ T cells recovered from the separated culture were CD4+25+ T cells, demonstrating that the separation of FC and CD4+25– T cells in culture by transwell resulted in a nearly 3-fold decrease in the number of generated CD4+25+ T cells (p = 0.008). Of note, the total numbers of CD4+ T cells recovered were similar for both cocultures and separated cultures. Importantly, the CD4+25+ T cells generated from separated cultures did not express the FoxP3 transcript (Fig. 6B), suggesting that cell-cell contact is required for the development of FoxP3 expressing CD4+25+ regulatory T cells. These findings demonstrate that the cytokines produced from stimulated FC are sufficient to induce the generation of some CD4+25+ T cells albeit at reduced numbers, whereas direct contact between FC and CD4+25– T cells is required for the sustained development of FoxP3+CD4+25+ regulatory T cells.
|
Given the current demonstration that FC and CD4+25– T cell direct interaction is required for the development of FoxP3+CD4+25+ regulatory T cells in vitro, we hypothesized that the B7 receptor, CD86, would be required for FC function. Therefore, we evaluated the expression of CD86 on the CpG-stimulated and unstimulated FC population. As demonstrated in Fig. 7A, flow cytometric analysis revealed that the expression of CD86 was increased within CpG-stimulated FC. Furthermore, the protein expression data were supported with real-time PCR analysis of CD86 transcript. An increase in the gene expression of CD86 was detected following CpG-stimulation (Fig. 7B).
|
| Discussion |
|---|
|
|
|---|
Recent emphasis has been placed on the characterization of cells that permit transplantation tolerance in mouse models with the intention of developing markers for the clinical induction of tolerance and molecular targets for immune-modulating therapies. CD4+25+ regulatory T cells have a critical role in maintaining immune tolerance and have been described as having a protective role in GVHD by inhibiting the proliferation and cytokine secretion of CD4+ and CD8+ effector T cells (22, 24, 37, 38, 39, 40). In allogeneic transplantation, only donor CD4+25+ regulatory T cells and not host can provide protection against GVHD (22). Therefore, it is important to explore the mechanisms associated with CD4+25+ regulatory T cell function following allogeneic hemopoietic cell transplantation. Given that FC transplantation results in increased donor SC engraftment and induction of tolerance without GVHD similar to that described for CD4+25+ regulatory T cell transplantation (22), we hypothesized that the transplantation of FC may result in the induction of CD4+25+ regulatory T cells. In line with these studies using a fully allogeneic (C57BL/6
irradiation-conditioned B10.BR) mouse model of SC plus FC transplantation we have shown that donor CD4+25+ T cells are increased in recipients following SC plus FC transplantation when compared with recipients of SC plus TBM that fail to exhibit long-term donor SC engraftment and also suffer from GVHD. Of note, the current studies demonstrated that over half of the CD4+CD25+ T cells that were detected in the spleen of SC plus FC recipients expressed FoxP3 protein, thus providing evidence of a regulatory phenotype following FC transplantation (Fig. 2A). Moreover, we have demonstrated that the CD4+25+ T cells isolated from the spleen of SC plus FC recipients dramatically inhibit T cell proliferation in vitro (Fig. 2B). These findings suggest that FC transplantation results in the activation of a regulatory immune response through the induction of CD4+25+ regulatory T cells.
One way that the immune system can achieve tolerance is through the induction of peripheral CD4+25+ regulatory T cells (41, 42). The induction of Tr1 and CD4+25+ regulatory T cells, within peripheral tissue such as the spleen, mediated by activated p-preDC has been reported (15, 16, 17, 18, 43). Although nearly 60% of the FC population expresses the B220 and CD11c markers that are also present on p-preDC (5, 20), previous reports have shown that FC are distinct from p-preDC. These findings demonstrated that although FC express CD3
and the TCR
-chain, the BM-derived p-preDC population does not (19, 20).
Given that the spleen represents a primary site for plasmacytoid DC-mediated peripheral regulatory T cell induction, we hypothesized that if the FC population is directly involved in CD4+25+ regulatory T cell induction in situ, donor FC should be present within the spleen of SC plus FC recipients. The current studies have demonstrated that the induction of peripheral CD4+25+ regulatory T cells is preceded by the presence of the donor FC within the recipient spleen as early as 2 wk post-transplantation (Fig. 3).
Importantly, the majority of splenic CD4+25+ T cells of SC plus FC recipients are of donor origin and the overall donor chimerism of each recipient was greater than 95%. Therefore, the interactions between donor cell types are important during immune responses and our subsequent in vitro studies used a syngeneic in vitro model for analysis of FC-mediated induction of CD4+25+ regulatory T cells using FC and CD4+25– T cells from C57BL/6 mice. Given that following transplantation, donor FC are present within the spleen during CD4+25+ regulatory T cell induction, we investigated the possible direct role of FC in the differentiation of naive CD4+25– T cells into CD4+25+ T cells. The establishment of a cell population that is distinct from p-preDC yet capable of inducing the development of regulatory T cells will be important to understanding the role of various cell populations in the activation of immune response following transplantation. We now have evidence to support a direct role of FC in the generation of CD4+25+ regulatory T cells, a function previously described as a characteristic of p-preDC.
The function of p-preDC cells is largely dependent upon the signals that induce their activation and differentiation (7). Activation and maturation signals for p-preDC are cytokines such as IL6, TNF-
and IL12, or TLR activators that include bacterial and viral product such as LPS and nucleic acids. In the current model of SC plus FC transplantation, it is likely that TLR9 activation on FC occurs as a result of recipient irradiation-conditioning that makes nucleic acid products available, such as nonmethylated DNA, for association with the TLR9 receptor. Therefore, similar to p-preDC, cytokines and TLR receptor stimulation are important for FC activation and function. As demonstrated in Fig. 4, CpG-stimulated FC in coculture with CD4+25– T cells result in the generation of CD4+25+ T cells that express FoxP3. Further analysis of the FC-generated CD4+25+ T cells revealed a cytokine gene expression profile that is consistent with reports that showed CD4+25+ regulatory T cells generated from naive CD4+25– T cells in the periphery expressed higher levels of IL4 when compared with native CD4+25+ regulatory T cells (35, 36). Similarly, IL4 gene expression is higher in FC-generated CD4+25+ T cells than p-preDC generated T cells. Thus, arguing that FC are not merely p-preDC but in fact BM-derived FC and p-preDC populations are distinct.
We next examined the production of cytokines by CpG-stimulated FC. An increase in the production of TNF-
and a markedly high production of IL6 was observed (Fig. 5, A and B). Therefore, similar to p-preDC that produce TNF-
and IL6 for autocrine function, FC may differentiate in the presence of TNF-
and IL6. There was no increase in IL12p70 protein, which consists of the p35 and p40 subunits (Fig. 5A). This may be due to the high production of IL6, as studies have demonstrated that high IL6 expression inhibits IL12p70 production in DC (44, 45, 46). Secondly, FC may be similar to thymic-derived plasmacytoid DC that do not up-regulate IL12p70 expression upon CpG stimulation (47). In fact, not only are FC present in the spleen, FC have been noted to migrate to the thymus where they have been thought to play a role in self-nonself discrimination (48). IL10 is an important immunoregulatory cytokine with a role in the down-regulation of immune responses. IL10 produced by DC can be used for autocrine function in the alteration of DC maturation for the development of tolerogenic DC or for the induction of regulatory T cells (49, 50, 51). Results from the present study indicate an increase in production of IL10 by FC following CpG stimulation.
Evidence from similar studies demonstrated that TGF-
converts naive CD4+24– T cells to CD4+25+ regulatory T cells as demonstrated by the induction of FoxP3 expression (42). We have observed that TGF-
gene expression is increased in CpG-stimulated FC when compared with unstimulated cells (data not shown). The findings of the current study demonstrate that activated FC produce cytokines required for the subsequent generation of CD4+25+ regulatory T cells.
We next examined whether the FC-mediated induction of FoxP3+CD4+25+ regulatory T cells requires direct cell contact or if it is merely the production of cytokines by activated FC. Using transwell cocultures, we established that CpG-stimulated FC produce a cytokine environment that facilitates naive CD4+25– T cell differentiation into CD4+25+ T cells. However, without FC-T cell contact, fewer of these cells were generated and none expressed the FoxP3 transcript. Thus, demonstrating that direct FC-CD4+25– T cell interaction is required for the generation of FoxP3+CD4+25+ T cells.
The B7 receptors, CD80 and CD86, are required for maintenance or development of a stable population of CD4+25+ regulatory T cells as studies have demonstrated that B7-deficient mice have marked reduction in the number of CD4+25+ regulatory T cells (25, 52). It is interesting that the regulatory T cell induction function of the FC is dependent on the direct FC-CD4+25– T cell contact and suggests a possible costimulatory requirement. Therefore, the requirement for CD86 was explored. We have demonstrated that CD86 expression on FC is increased following CpG-stimulation. Furthermore, CD86 expression is required for FC-mediated generation of FoxP3+CD4+25+ regulatory T cells. The current in vitro findings have established that the FC population can differentiate into an active phenotype and is capable of providing the cytokine milieu and the increased CD86 expression as required for naive CD4+25– T cell differentiation into FoxP3+CD4+25+ regulatory T cells. Therefore, a mechanism of FC-mediated peripheral FoxP3+CD4+25+ regulatory T cell induction during SC plus FC reconstitution is suggested. For the first time, we have linked the function of FC previously described as a promoter of purified allogeneic SC engraftment in vivo, to the direct induction of FoxP3+CD4+25+ regulatory T cells. These findings suggest that the transplantation of FC result in immune responses that are associated with the induction of splenic FoxP3+CD4+25+ regulatory T cells. Although we have demonstrated that FC directly induce the generation of FoxP3+CD4+25+ regulatory T cells in vitro, the induction of these cells following SC plus FC transplantation may not solely be due to FC, as there are other immune responses and cell-cell interactions that may parallel FC function and result in the induction or maintenance of regulatory T cells. Furthermore, other regulatory cells such as Tr1 have been described as having a role in transplantation tolerance and may be induced following FC transplantation.
In summary, the current studies demonstrate that purified FC are capable of inducing the generation of FoxP3+CD4+25+ regulatory T cells from naive CD4+25– T cells. Thus, suggesting that the induction of transplantation tolerance in SC plus FC recipients may be linked to an induction of FoxP3+CD4+25+ regulatory T cells. Therefore, a mechanism for the role of FC in the induction of transplantation tolerance following SC plus FC transplantation has been suggested. Although the direct transplantation of donor CD4+25+ regulatory T cells offers great promise, a large number of unmanipulated fresh donor regulatory T cells and/or ex vivo manipulation are required before transplantation (22, 24, 53), thus potentially limiting the use of this therapy. Therefore, the transplantation of limited numbers of donor FC to facilitate allogeneic SC engraftment and induce FoxP3+CD4+25+ regulatory T cells in vivo can potentially offer a useful and clinically feasible approach to induce transplantation tolerance and avoid GVHD while achieving SC engraftment across major histocompatible barriers.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This research was supported by the National Institutes of Health Grant R01 HLO74150 (to Y.L.C.). ![]()
2 K.N.T. conceptualized, designed, and performed research, and wrote the manuscript; V.R.S. designed and performed research; E.C. performed research and compiled data; and Y.L.C. is the corresponding author and performed the conception and execution of research and manuscript editing. ![]()
3 Address correspondence and reprint requests to Dr. Yolonda L. Colson, Division of Thoracic Surgery, Department of Surgery, Brigham and Womens Hospital, 75 Francis Street, Boston, MA 02115. E-mail address: ylcolson{at}bics.bwh.harvard.edu ![]()
4 Abbreviations used in this paper: BMT, bone marrow transplantation; MHC, multiple major histocompatability; GVHD, graft-vs-host disease; FC, facilitating cells; BM, bone marrow; SC, stem cell; FoxP3, forkhead/winged helix transcription factor; DC, dendritic cell; p-preDC, plasmacytoid precursor DC; Tr1, T regulatory 1; TBM, BM T cells; ODN, oligodeoxynucleotide; CSM, cell sort media. ![]()
Received for publication April 3, 2007. Accepted for publication May 31, 2007.
| References |
|---|
|
|
|---|
/
in plasmacytoid dendritic cells. Eur. J. Immunol. 31: 2154-2163. [Medline]
-chain heterodimer expressed on a CD8+ bone marrow subpopulation that promotes allogeneic stem cell engraftment. Nat. Med. 6: 904-909. [Medline]
and the TCR
-chain-FCp33 complex. J. Immunol. 177: 1444-1450.
-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155: 1151-1164. [Abstract]
production by alloantigen-reactive regulatory T cells is important for their regulatory function in vivo. J. Exp. Med. 201: 1925-1935.
induction of transcription factor Foxp3. J. Exp. Med. 198: 1875-1886.
stimulate allogeneic CD4+ T-cell proliferation: modulation by autocrine IL-10, enhanced T-cell apoptosis and T regulatory type 1 cells. Int. Immunol. 16: 1037-1052. Related articles in The JI:
This article has been cited by other articles:
![]() |
Y. Huang, I. J. Fugier-Vivier, T. Miller, M. J. Elliott, H. Xu, L. D. Bozulic, P. M. Chilton, and S. T. Ildstad Plasmacytoid Precursor Dendritic Cells From NOD Mice Exhibit Impaired Function: Are They a Component of Diabetes Pathogenesis? Diabetes, September 1, 2008; 57(9): 2360 - 2370. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |