The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1776-1783
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, R.
Right arrow Articles by Ahmed, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, R.
Right arrow Articles by Ahmed, S. A.

Despite Inhibition of Nuclear Localization of NF-{kappa}B p65, c-Rel, and RelB, 17-beta Estradiol Up-Regulates NF-{kappa}B Signaling in Mouse Splenocytes: The Potential Role of Bcl-31

Rujuan Dai, Rebecca A. Phillips and S. Ansar Ahmed2

Department of Biomedical Sciences and Pathology, Center for Molecular Medicine and Infectious Diseases,Virginia-Maryland Regional College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NF-{kappa}B plays a major role in regulating the immune system. Therefore, alterations in NF-{kappa}B activity have profound effects on many immunopathologies, including inflammation, autoimmunity, and lymphoid neoplasia. We investigated the effects of estrogen (17beta-estradiol) on NF-{kappa}B in C57BL/6 mice since estrogen is a natural immunomodulator and we have recently reported that estrogen up-regulates several NF-{kappa}B-regulated proteins (inducible NO synthase, IFN-{gamma}, and MCP-1). We found that in vivo estrogen treatment had differential effects on NF-{kappa}B family members. Estrogen profoundly blocked the nuclear translocation of p65, c-Rel, and Rel-B, partially blocked p52, but permitted translocation of p50. Despite blockade of both the classical (p65/p50) and alternative (RelB/p52) NF-{kappa}B activation pathways, estrogen induced constitutive NF-{kappa}B activity and increased the levels of cytokines regulated by NF-{kappa}B (IL-1{alpha}, IL-1beta, IL-10, and IFN-{gamma}). Studies involving a NF-{kappa}B inhibitor confirmed a positive regulatory role of NF-{kappa}B on these cytokines. Remarkably, estrogen selectively induced B cell lymphoma 3 (Bcl-3), which is known to associate with p50 to confer transactivation capabilities, thereby providing a potential link between observed p50 DNA-binding activity and estrogen up-regulation of NF-{kappa}B transcriptional activity. Chromatin immunoprecipitation assays confirmed that Bcl-3 bound to the promoter of the NF-{kappa}B-regulated inducible NO synthase gene in cells from estrogen-treated mice. Estrogen appeared to act at the posttranscriptional level to up-regulate Bcl-3 because mRNA levels in splenocytes from placebo- and estrogen-treated mice were comparable. The novel findings of differential regulation of NF-{kappa}B proteins by estrogen provide fresh insight into potential mechanisms by which estrogen can regulate NF-{kappa}B-dependent immunological events.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The interactions of the immune system with the endocrine system (especially reproductive sex hormones) are noteworthy because estrogens can markedly influence the immune system (1, 2). It is believed that estrogen plays significant beneficial and harmful roles in gender differences in immune capability as well as in susceptibility to trauma, sepsis, and inflammatory and autoimmune diseases such as atherosclerosis, multiple sclerosis, systemic lupus erythematosus, and rheumatoid arthritis (3, 4, 5, 6, 7, 8, 9). Although the anti-inflammatory functions of estrogen have been exhibited by down-regulation of inflammatory genes (10, 11), we, and others, have reported that estrogen treatment up-regulates the proinflammatory cytokine IFN-{gamma}, as well as IFN-{gamma}-mediated generation of inducible NO synthase (iNOS),3 cyclooxygenase 2, and chemokines (MCP-1 and MCP-5) by activated mouse splenic lymphoid cells (12, 13, 14, 15, 16). However, the underlying molecular mechanisms by which estrogen modulates these proteins need to be elucidated.

Given that early inflammatory processes and immune responses are regulated by a key inducible transcription factor, NF-{kappa}B, the present studies address whether NF-{kappa}B activity is altered in splenocytes from estrogen-treated mice. The NF-{kappa}B family includes five members, p65 (Rel-A), c-Rel, Rel-B, NF-{kappa}B1 (p50 and its precursor p105), and NF-{kappa}B2 (p52 and its precursor p100). In the inactive state, NF-{kappa}B proteins are sequestered in the cytoplasm by I{kappa}B proteins (I{kappa}B{alpha}, I{kappa}Bbeta, I{kappa}B{epsilon}, and I{kappa}B{gamma}). Following stimulation, I{kappa}B kinase complexes are activated to phosphorylate I{kappa}B proteins, which leads to proteasome-mediated degradation of I{kappa}B proteins (17, 18, 19). The released NF-{kappa}B proteins translocate into the nucleus where they bind to {kappa}B sequences in the promoters of target genes to initiate transcription. In general, activated NF-{kappa}B dimers containing p65, c-Rel, or Rel-B can transactivate NF-{kappa}B-dependent genes. In contrast, NF-{kappa}B homodimers, p50/p50 and p52/p52, which lack transactivation domains, function primarily to inhibit NF-{kappa}B-responsive genes (20, 21). However, binding of p50/p50 or p52/p52 homodimers to B cell lymphoma 3 (Bcl-3), a transcriptional coactivator, confers the ability of these homodimers to induce NF-{kappa}B responsive genes (20, 21, 22). Bcl-3 belongs to the I{kappa}B family and can interact with NF-{kappa}B proteins through its ankyrin repeats. Unlike other I{kappa}B proteins, which are expressed in the cytoplasm and function as repressors of NF-{kappa}B, Bcl-3 is predominately expressed in the nucleus and functions as an activator through interactions with p50 and p52 homodimers (20, 21, 22, 23).

Cross-talk between estrogen receptors (ER) and NF-{kappa}B family members has been extensively reviewed (24, 25). Both ER{alpha} and ERbeta have been shown to inhibit NF-{kappa}B activity in various nonlymphocytic cell lines such as HeLa (26), HepG2 (27), and MCF-7 (28). Although the studies in nonlymphoid cell lines document the inhibitory effects of estrogen on NF-{kappa}B activity, there is a paucity of data on this aspect in cells of the lymphoid system. Moreover, previous studies have focused on the in vitro effects of estrogen and there are no comprehensive data on the in vivo effects of estrogen on NF-{kappa}B family members in lymphocytes. This is the first study to document that in vivo estrogen treatment has differential effects on NF-{kappa}B family members in murine lymphoid cells. These studies add new knowledge with regard to estrogen regulation of NF-{kappa}B activity and may have profound implications for estrogen-mediated immune disorders.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

Weanling C57BL/6C male mice (Charles River Laboratories) were housed in the animal facility at the Center for Molecular Medicine and Infectious Diseases. All procedures were approved by the Animal Care Committee at Virginia Polytechnic Institute and State University. To avoid the effect of endogenous estrogens and androgens in gonadal intact mice, we used orchiectomized male mice in this study. At 4–5 wk of age, mice were orchiectomized and surgically implanted with silastic capsules containing 3–5 mg of 17beta-estradiol (estrogen; Sigma-Aldrich) or empty (placebo) silastic implants by standard procedures that have been extensively described previously (12, 13, 14, 29, 30). After a brief period of establishment of the implants, 17beta-estradiol release was continuous and sustained. Serum levels of 17beta-estradiol were measured at 3–4 wk (mean ± SD, placebo: 1.97 ± 5.58 pg/ml; estrogen: 149.5 ± 57.17 pg/ml, p < 0.0001) and 7 wk (placebo: 13.08 ± 9.83 pg/ml; estrogen: 222.67 ± 41.9 pg/ml, p < 0.01) after surgery using an active estradiol enzyme immunoassay kit from Diagnostic Systems Laboratories. The serum 17beta-estradiol levels were similar to those in our previous report (14). Mice were fed a commercial pellet diet devoid of estrogenic hormones (7013 NIH-31 Modified 6% Mouse/Rat Sterilizable Diet; Harlan-Teklad).

Splenocyte isolation and culture

Seven to 8 wk after estrogen or placebo implant treatment, splenic lymphocytes were isolated and cultured using procedures that have been described in detail before (12, 14, 29). For cell stimulation, equal volumes of either 10 µg/ml Con A (Sigma-Aldrich) or 20 ng/ml TNF-{alpha} (eBioscience) medium solution were added to seeded cells (5 x 106 cells/ml) to achieve a final concentration at 5 µg/ml Con A or 10 ng/ml TNF-{alpha}, respectively. For medium control, equal volumes of complete medium were added. For NF-{kappa}B inhibitor studies, the plated splenocytes were pretreated with vehicle (DMSO) or 10 µM A77 1726 (a selective NF-{kappa}B inhibitor; Axxora) for 1 h before stimulation with 5 µg/ml Con A (Sigma-Aldrich) for 48 h in the presence of the inhibitor or vehicle.

EMSA

EMSAs were performed to analyze the binding activity of NF-{kappa}B proteins. Nuclear extracts were prepared using NE-PER nuclear and cytoplasmic extraction reagents (Pierce). 5' biotin-labeled, single-stranded oligonucleotides containing a NF-{kappa}B-binding motif (forward, GATCGAGGGGACTTTCCCTAGC and reverse complementary, GCTAGGGAAAGTCCCCTCGATC) were synthesized (Integrated DNA Technologies) and annealed. A mutant NF-{kappa}B-binding oligonucleotide (AGTTGAGGCGTTCCCAGGC), which does not bind to NF-{kappa}B, was purchased from Santa Cruz Biotechnology. For the binding reaction, 5 µg of nuclear proteins (2–3 µl) was incubated with 20 fmol of biotin-labeled dsDNA probe at room temperature for 25 min in 20 µl of binding reaction mixture (12 mM HEPES (pH 7.5), 80 mM NaCl, 5 mM DTT, 5 mM MgCl2, 0.5 mM EDTA, 1 µg poly(dI:dC), and 5% glycerol). The binding samples were separated using a 5% Tris-borate-EDTA polyacrylamide gel (Bio-Rad) and transferred to a positively charged nylon membrane (Pierce). The biotin-labeled DNA on the membrane was detected using a Chemiluminescent Nucleic Acid Detection Module (Pierce). For supershift assays, 1 µl of Ab against p65 or p50 (Chemicon International) was included in the binding reaction.

Western blotting

Western blots were used to analyze protein expression in whole cell, nuclear, and cytoplasmic extracts according to our previously reported procedures (30). The blot images were captured and the signal intensities were analyzed using a Kodak Image Station 440. The vendors for Abs were as follows: NF-{kappa}B p65 (c-20), p50 (NLS), c-Rel (N-466), and Bcl-3 (150-3.5; Santa Cruz Biotechnology), NF-{kappa}B RelB and p100/p52 (Cell Signaling Technology), and beta-actin (loading control; Abcam).

SearchLight cytokine array

A SearchLight Custom Mouse 9-plex Array Kit (Pierce) was used to quantitatively and simultaneously measure the levels of several cytokines (IFN-{gamma}, IL-1{alpha}, IL-1beta, IL-10, and IL-4) in culture supernatants according to the manufacturer’s instructions. The lower limit of sensitivity for the SearchLight cytokine array was 0.4 pg/ml for IL-1{alpha} and IL-4 and 0.2 pg/ml for IL-1beta, IL-10, and IFN-{gamma}. The SearchLight image was obtained with a cooled charge-coupled device camera and analyzed using Arrayvision 8.0 software.

Quantitative real-time PCR

Total RNA was isolated from 2.5 x 106 freshly prepared, unstimulated (medium only) or Con A-stimulated splenocytes to analyze the expression level of Bcl-3 mRNA. Real-time PCR was performed using an iCycler and an iScript one-step RT-PCR kit with SYBR green (Bio-Rad). Quantitect 10 x PCR primer mixes for mouse Bcl-3 and beta-actin were purchased from Qiagen. Bcl-3 mRNA levels were normalized to beta-actin mRNA levels using the 2{Delta}{Delta}Ct (Livak) method based on the threshold cycle (Ct) value.

Chromatin immunoprecipitation (ChIP) assays

A ChIP assay kit (Upstate Biotechnology) was used to assay in vivo DNA binding of NF-{kappa}B p65, p50, and Bcl-3. In brief, after 3 h of Con A stimulation, splenocytes from placebo- and estrogen-treated mice were fixed with 1% formaldehyde at 37°C for 10 min and lysed in SDS lysis buffer (5 x 107 cell/ml). The samples were sonicated five times for 10 s each time at 50% output using a Fisher model 500 sonicator. After centrifuging, the supernatants were diluted 10-fold with ChIP dilution buffer and precleared with salmon sperm DNA/protein agarose at 4°C for 1 h. The chromatin-DNA complex was immunoprecipitated with anti-NF-{kappa}B p65 (1.5 µg), anti-NF-{kappa}B p50 (1.5 µg), anti-Bcl-3 (H-146) Ab (3 µg), or a nonimmune rabbit IgG (2 µg; Santa Cruz Biotechnology) at 4°C overnight and then collected with salmon sperm DNA/protein A-agarose at 4°C for 1 h. After washing, the chromatin-DNA complex was eluted with elution buffer (1% SDS in 0.1 M NaHCO3) and histone-DNA cross-links were reversed by incubating at 65°C for 5 h in 0.2 M NaCl. The DNA was recovered and analyzed by PCR using specific primers which amplify the NF-{kappa}B binding site located on the promoter of the mouse iNOS gene (5' primer: –498 CTGCCCAAGCTGACTTACTAC –478, 3' primer –1 GACCCTGGCA GCAGCCATCAG –21) (31).

Luciferase reporter assay

To measure NF-{kappa}B transcriptional activity in vivo, 4 µg of pNF-{kappa}B-Luc reporter plasmid (Stratagene) was cotransfected with 1 µg of pRL-TK plasmid (internal control plasmid from Promega) to 1.5 x 107 freshly isolated mouse splenocytes. A Nucleofector device and Mouse Macrophage Nucleofector kit (Amaxa) were used for transfection. Firefly luciferase activity was measured with a dual luciferase reporter assay system (Promega) on a Veritas Microplate Luminometer (Turner BioSystems) and normalized to Renilla luciferase activity (the internal transfection control).

Statistical analysis

All values are given as mean ± SD. One-way ANOVA and Tukey-Kramer multiple comparison tests were used to assess the statistical significance of estrogen-induced changes in cytokine levels, Bcl-3 mRNA levels, and the subcellular distribution of NF-{kappa}B proteins. Paired t tests were used to assess the statistical significance of the effect of the NF-{kappa}B inhibitor on cytokine expression levels. The tests were performed using GraphPad InStat version 3.0a for Macintosh (GraphPad Software).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Estrogen inhibits the activation of NF-{kappa}B p65/p50 heterodimers

We first investigated whether in vivo estrogen exposure alters NF-{kappa}B DNA-binding activity in splenocytes using an EMSA. Basal NF-{kappa}B DNA-binding activity was detected in freshly isolated splenocytes from both placebo- and estrogen-treated mice (Fig. 1A). NF-{kappa}B DNA-binding activity was greatly increased following Con A stimulation (Fig. 1A). The competition binding assay using unlabeled NF-{kappa}B DNA-binding oligonucleotides and mutant NF-{kappa}B DNA-binding oligonucleotides indicated that the binding complexes were specific for NF-{kappa}B binding sites (Fig. 1A). Interestingly, the NF-{kappa}B DNA-binding complexes in estrogen-treated splenocytes (complexes c and d, Fig. 1) were consistently smaller compared with those observed in placebo-treated splenocytes (complexes a and b, Fig. 1).


Figure 1
View larger version (63K):
[in this window]
[in a new window]

 
FIGURE 1. Analysis of NF-{kappa}B protein DNA-binding activity in splenocytes from placebo- and estrogen-treated mice. A, Con A stimulation increases NF-{kappa}B DNA-binding activity in splenocytes from both placebo- and estrogen-treated mice. Nuclear extracts were prepared from freshly isolated (t = 0) splenocytes as well as splenocytes stimulated with Con A for 3 h and 6 h and those left unstimulated (medium only) for 3 and 6 h. For the binding competition assay, a 100-fold excess of unlabeled NF-{kappa}B DNA probe or a 100-fold excess of unlabeled mutant NF-{kappa}B DNA probe was included in the binding reaction. a–d, The different binding complexes observed in splenocytes from placebo- and estrogen-treated mice. B, Supershift analysis. Anti-p65 and anti-p50 Abs were used to shift the binding complexes observed in splenocytes from placebo- and estrogen-treated mice stimulated with Con A for 6 h. A control without addition of Ab was included to show the position of the normal binding complex. The shifted complexes are indicated with brackets. C, TNF-{alpha} cannot stimulate NF-{kappa}B DNA-binding activity in splenocytes from estrogen-treated mice. EMSAs were performed with 5 µg of nuclear extract from splenocytes from placebo- and estrogen-treated mice stimulated with Con A (5 µg/ml) for 30 min, as well as 3 and 6 h or TNF-{alpha} (10 ng/ml) for 30 min and 6 h. The data shown represent at least three independent experiments.

 
Next, supershift assays were performed to identify the NF-{kappa}B members in the binding complexes (Fig. 1B). In Con A-activated splenocytes from placebo-treated mice, the anti-p50 Ab was able to shift both complexes a and b. The anti-p65 Ab, however, was only able to shift binding complex a. The supershift data suggest that complexes a and b represent p65/p50 and p50/p50 dimers, respectively. Remarkably, in splenocytes from estrogen-treated mice, only the anti-p50 Ab was capable of shifting the binding complexes. This demonstrates that in vivo estrogen exposure selectively inhibits the DNA-binding activity of p65. We speculated that complex c mostly represents a p50/p50 homodimer and d represents a p50-containing complex in splenocytes from estrogen-treated mice because the bands were shifted by the anti-p50 Ab and because Western blot analysis (see Fig. 3) of nuclear extracts showed that the size of nuclear p50 was smaller in samples from estrogen-treated mice. We next used a known p65/p50 activator, TNF-{alpha}, to stimulate splenocytes. Although TNF-{alpha} stimulation for 30 min increased the NF-{kappa}B p65/p50 DNA-binding signal in placebo-treated splenocytes, it did not stimulate NF-{kappa}B DNA binding in estrogen-treated splenocytes (Fig. 1C). Compared with the binding signal following 3 h of stimulation, the binding signal following 6 h of Con A stimulation was increased in splenocytes from placebo-, but not estrogen-treated mice.


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
FIGURE 3. Estrogen does not block nuclear translocation of NF-{kappa}B p50. A and D, The same samples analyzed in Fig. 2 were used to evaluate the expression of NF-{kappa}B p50 and p52 in nuclear and cytoplasmic compartments. beta-Actin was detected as a loading control. (B, C, E, and F) Quantification analysis of Western blot results in A and D. Densitometry was normalized to beta-actin and graphed as the mean ± SD (n ≥ 6). Single and double asterisks indicate p < 0.05 and p < 0.01, respectively.

 
Taken together, the EMSA results shown here indicate that estrogen inhibits the activation of the canonical NF-{kappa}B p65/p50 heterodimer, but increases the binding activity of the NF-{kappa}B p50/p50 homodimer.

Estrogen treatment blocks nuclear translocation of not only NF-{kappa}B p65 but also c-Rel and RelB proteins

We next examined the subcellular distribution of NF-{kappa}B family members by Western blot analysis of nuclear and cytoplasmic extracts prepared from splenocytes cultured for 6 h with Con A or medium only. For placebo-treated mice, nuclear p65 was detected even in unstimulated cells. Furthermore, Con A stimulation of splenocytes from placebo-treated mice dramatically increased the translocation of p65 to the nucleus (Fig. 2, A and B). Consistent with the EMSA results, we observed a marked decrease of p65 in the nucleus of both unstimulated and Con A-stimulated splenocytes from estrogen-treated mice. Impressively, c-Rel and RelB, the other two Rel proteins that contain transactivation domains, were also not detected in either unstimulated or Con A-stimulated splenocytes from estrogen-treated mice (Fig. 2A). Similar to the results noted for p65, nuclear c-Rel and RelB were significantly increased in splenocytes from placebo-treated mice after 6 h of Con A stimulation (Fig. 2, A, C, and D).


Figure 2
View larger version (46K):
[in this window]
[in a new window]

 
FIGURE 2. Estrogen inhibits nuclear translocation of NF-{kappa}B p65, c-Rel, and RelB proteins. A and E, Expression analysis of NF-{kappa}B p65, c-Rel, and RelB proteins in nuclear and cytoplasmic extracts. Twenty-five micrograms of nuclear extracts and 30 µg of cytoplasmic extracts from splenocytes from placebo- and estrogen-treated mice cultured for 6 h with Con A or medium only were used for Western blot analysis. beta-Actin was used as a loading control. B–D and F–H, Quantification analysis of Western blot results in A and E. Densitometry was normalized to beta-actin and graphed as the mean ± SD (n ≥ 6). Single, double, and triple asterisks indicate p < 0.05, p < 0.01, and p < 0.001, respectively.

 
Quantification analysis of the Western blot results for cytoplasmic extracts indicated that p65 and RelB levels in the cytoplasm of estrogen-treated splenocytes were comparable to levels observed in splenocytes from placebo-treated mice (Fig. 2, E, F, and H). NF-{kappa}B c-Rel protein levels in estrogen-treated splenocytes were significantly lower compared with splenocytes from placebo-treated mice (Fig. 2, E and G). Taken together, the data show that estrogen exposure blocks nuclear translocation of NF-{kappa}B p65, c-Rel, and RelB proteins in splenocytes.

Estrogen does not block nuclear translocation of NF-{kappa}B p50

Next, we performed Western blot analysis to further investigate whether estrogen selectively allows nuclear translocation of p50 and another related NF-{kappa}B family member, p52. NF-{kappa}B p50 was present in the nucleus of splenocytes from both placebo- and estrogen-treated mice. After 6 h of Con A stimulation, NF-{kappa}B p50 expression was increased in splenocytes of both placebo- and estrogen-treated mice compared with unstimulated cells (Fig. 3, A and B). This increase was significant for splenocytes from placebo-treated mice but not for splenocytes from estrogen-treated mice. In addition, there was not a significant difference in nuclear p50 levels between splenocytes from placebo- and estrogen-treated mice after 6 h of Con A stimulation (Fig. 3, A and D). Con A stimulation also significantly increased p52 expression in the nucleus of splenocytes from placebo-treated mice, but not estrogen-treated mice (Fig. 3, A and C). In contrast to NF-{kappa}B p50, nuclear p52 levels in splenocytes from estrogen-treated mice were significantly lower compared to samples from placebo-treated mice (Fig. 3, A and D). Western blots of cytoplasmic extracts indicated that p50 and p52 levels in the cytoplasm of splenocytes from placebo- and estrogen-treated mice are not significantly different (Fig. 3, E and F). Interestingly, the size of the p50 and p52 bands in the nucleus of splenocytes from estrogen-treated mice was consistently smaller than that in the nucleus of splenocytes from placebo-treated mice. The Western blot results above indicate that estrogen treatment does not affect the nuclear translocation of p50, but it partially inhibits the nuclear accumulation of p52.

Estrogen-induced differential regulation of NF-{kappa}B proteins occurred during in vivo treatment

To ascertain whether estrogen blockage of nuclear translocation of NF-{kappa}B proteins occurred during in vitro culture or during in vivo estrogen treatment, we analyzed freshly isolated splenocytes. As shown in Fig. 4A, all of the NF-{kappa}B family members were expressed in the nucleus of freshly isolated splenocytes from placebo-treated mice, but only p50 and p52 were found in the nucleus of freshly isolated splenocytes from estrogen-treated mice. The nuclear p50 levels in freshly isolated splenocytes from estrogen-treated mice were comparable to the levels detected in splenocytes from placebo-treated mice (Fig. 4A). There was no significant difference in expression of any NF-{kappa}B family members between freshly isolated cells and those stimulated with Con A for 30 min. Expression profiles detected at 24 h of in vitro culture with or without Con-A stimulation (Fig. 4B) were similar to those observed at 6 h of in vitro culture. Taken together, the results demonstrate that the selective inhibitory effect of estrogen on nuclear localization of NF-{kappa}B p65, c-Rel, and RelB occurred during in vivo estrogen treatment and that this effect persisted during in vitro cell culture.


Figure 4
View larger version (82K):
[in this window]
[in a new window]

 
FIGURE 4. Estrogen inhibits nuclear accumulation of NF-{kappa}B p65, c-Rel, and RelB in freshly isolated splenocytes. A and B, Expression analysis of NF-{kappa}B members in the nucleus of freshly isolated splenocytes and splenocytes cultured for 24 h. Nuclear extracts were prepared from freshly isolated (t = 0) splenocytes from placebo- and estrogen-treated mice, as well as those cultured with Con A for 30 min and 24 h. Twenty-five micrograms of protein from each sample was used for Western blot analysis. beta-Actin was used as a loading control.

 
Expression of selected NF-{kappa}B target proteins was up-regulated in splenocytes from estrogen-treated mice

We have reported that the NF-{kappa}B target genes, iNOS, IFN-{gamma}, and MCP-1 were up-regulated in splenocytes from estrogen-treated mice (12, 13, 14, 32). In this study, we extended our studies to determine whether estrogen treatment would also alter the concentration of other NF-{kappa}B-regulated cytokines including IL-10 (33), IL-1{alpha} (34), and IL-1beta (35). We found that the mean concentrations of these cytokines were significantly increased in supernatants from splenocytes from estrogen-treated mice cultured with Con A for 24 h when compared with splenocytes from placebo-treated mice (Fig. 5, A–C). The concentration of IFN-{gamma} was measured at the same time as a positive control (Fig. 5D). The pretreatment of cells with the selective NF-{kappa}B inhibitor A77 1726 dramatically decreased the expression levels of IFN-{gamma}, IL-10, IL-1{alpha}, and IL-1beta in both splenocytes from placebo- and estrogen-treated mice following Con A stimulation (Fig. 5, F–I). Our previous report showed that there was no difference in the IL-4 mRNA expression level between placebo- and estrogen-treated mice (30). Consistent with this observation, the concentration of IL-4 was similar between placebo- and estrogen-treated mice (Fig. 5E). Furthermore, IL-4 was not significantly changed between vehicle- and A77 1726-treated splenocytes from estrogen-treated mice (Fig. 5J). This indicated that the inhibitory effect of A77 1726 for selected NF-{kappa}B target genes was specific. Overall, our data indicated that NF-{kappa}B played an important regulatory role in NF-{kappa}B-regulated protein expression in splenocytes from estrogen-treated mice even though the activation of p65, RelB, and c-Rel was inhibited.


Figure 5
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 5. NF-{kappa}B transcriptional activity is involved in NF-{kappa}B target gene expression in splenocytes from estrogen-treated mice. A–E, Estrogen augments the concentrations of NF-{kappa}B-regulated cytokines, including IL-1{alpha}, IL-1beta, IL-10, and IFN-{gamma}, in mouse splenocytes. IL-4 was measured as a control. Splenocytes were stimulated with Con A or left unstimulated (medium only) for 24 h, and the concentration of the indicated cytokines in culture medium was determined with a SearchLight mouse cytokine array. The mean concentrations (mean ± SD; picograms per milliliter) of IL-1{alpha}, IL-1beta, IL-10, and IFN-{gamma} in splenocytes from placebo-treated mice were 3.358 ± 1.29, 0.8 ± 0.8, 18.3 ± 2.9, and 1,490.14 ± 143.48, respectively. In Con A-stimulated splenocytes from estrogen-treated mice, the mean concentrations of IL-1{alpha}, IL-1beta, IL-10, and IFN-{gamma} were increased to 11.969 ± 4.3, 2.63 ± 1.15, 65.2 ± 9.4, and 2,409.76 ± 935.26, respectively. The mean concentrations of IL-4 were 173.4 ± 35.6 pg/ml and 174.5 ± 40.2 pg/ml, respectively, in splenocytes from placebo- and estrogen-treated mice. F–J, Inhibition of NF-{kappa}B activity decreases the expression of NF-{kappa}B-regulated cytokines. For evaluation of the changes caused by the inhibitor, the cytokine levels in Con A plus vehicle-stimulated cells were regarded as 100% and the cytokine level in paired Con A plus NF-{kappa}B inhibitor-treated cells are shown as the percentage of the level in Con A plus vehicle-stimulated cells. All of the graphs show the means ± SD (n ≥ 5). Single, double, and triple asterisks indicate p < 0.05, p < 0.01, and p < 0.001, respectively.

 
In vivo estrogen treatment induces Bcl-3 protein expression in splenocytes

Next, we investigated whether estrogen modifies NF-{kappa}B signaling in splenocytes from estrogen-treated mice by up-regulating the expression of Bcl-3, which binds to p50 homodimers to induce transcription of NF-{kappa}B target genes. Consistent with other reports (20, 36), our real-time PCR data indicated that Bcl-3 mRNA was highly expressed in mouse splenocytes (Fig. 6, A and B). However, there was no significant difference in the level of Bcl-3 mRNA among freshly isolated, unstimulated or Con A -stimulated splenocytes from placebo- and estrogen-treated mice. To our surprise, although Bcl-3 mRNA was highly expressed, we could not detect Bcl-3 protein in unstimulated or Con A-stimulated splenocytes from placebo-treated mice. In sharp contrast, Bcl-3 protein was detected in splenocytes from estrogen-treated mice regardless of whether cells were left unstimulated or stimulated with Con A (Fig. 6C). Bcl-3 was predominantly expressed in the nucleus and was only weakly detected in the cytoplasm (Fig. 6C).


Figure 6
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 6. In vivo estrogen treatment highly induces the expression of Bcl-3 protein. A, Relative expression level of Bcl-3 mRNA in splenocytes from placebo- and estrogen-treated mice. Total RNA was prepared from freshly isolated (t = 0) splenocytes from placebo- and estrogen-treated mice as well as cells cultured with Con A or medium for 6 h and then subjected to real-time PCR analysis of the expression of Bcl-3 mRNA. Bcl-3 mRNA levels were normalized to beta-actin mRNA levels. The mean ± SDs are shown (n = 5 each). B, Representative electrophoresis gel analysis of real-time PCR products. C, Expression analysis of Bcl-3 protein in splenocytes. Twenty-five micrograms of nuclear extract and 30 µg of cytoplasmic extract of protein prepared from splenocytes cultured with Con A or medium for 6 h were used for Western blot analysis. D, Bcl-3 binds to the iNOS promoter in vivo in splenocytes from estrogen-treated mice. ChIP assays were performed with 3-h Con A-stimulated splenocytes from placebo- and estrogen-treated mice. A nonimmune normal rabbit IgG was used as a nonspecific binding control. A PCR control with no template was included when performing the PCR. The representative results from experiments with three pairs of placebo- and estrogen-treated mice are shown.

 
We next examined whether estrogen-induced Bcl-3 proteins have regulatory functions on gene expression by ChIP assays to determine whether Bcl-3 binds to the promoter of a well-known NF-{kappa}B target gene, iNOS. We have reported that iNOS mRNA and protein expression levels were highly augmented in splenocytes from estrogen-treated mice (13). In addition, pretreatment with the selective NF-{kappa}B inhibitor A77 1726 resulted in a significant reduction of NO production by splenocytes from estrogen-treated mice (data not shown). As shown in Fig. 6D, after 3 h of Con A stimulation, in splenocytes from placebo-treated mice, NF-{kappa}B p65 and p50 bound to the iNOS promoter while the binding activity of Bcl-3 was hardly detected. In contrast, Bcl-3 and p50 binding to the iNOS promoter was clearly observed in Con A-stimulated splenocytes from estrogen-treated mice. As expected, the binding activity of p65 was almost completely inhibited in splenocytes from estrogen-treated mice. These data suggest that in vivo estrogen exposure induces Bcl-3 protein expression and that this induced Bcl-3 protein has the ability to bind to the promoter of NF-{kappa}B target genes along with p50.

In vivo estrogen treatment increases basal NF-{kappa}B activity

To further investigate the effect of in vivo estrogen treatment on NF-{kappa}B transcriptional activity in vivo, we transfected freshly isolated splenocytes from placebo- and estrogen-treated mice with a NF-{kappa}B luciferase reporter construct. We found significantly higher NF-{kappa}B transcriptional activity in unstimulated estrogen-treated splenocytes compared with splenocytes from placebo-treated mice (Fig. 7). Considering that only p50, p52, and Bcl-3 are present in the nucleus of unstimulated splenocytes from estrogen-treated mice, we speculated that Bcl-3 and p50 contributed to this observed constitutive NF-{kappa}B transcriptional activity. These data indicated that in vivo estrogen treatment induces constitutive NF-{kappa}B transcriptional activity in mouse splenocytes.


Figure 7
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 7. Estrogen induces constitutive activity of NF-{kappa}B. A luciferase reporter driven by a pentameric NF-{kappa}B binding site was cotransfected with a pRL-TK control plasmid into freshly isolated splenocytes from placebo- and estrogen-treated mice. Thirty-six hours after transfection, luciferase reporter activity (firefly luciferase) was measured and normalized to an internal control (Renilla luciferase activity). The graph shows the means ± SD (n = 7 each), *, p < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NF-{kappa}B plays a central role in immune regulation and in many inflammatory diseases, as evidenced by the finding that dysregulation of NF-{kappa}B activity has been linked to the development of cancer and numerous inflammatory disorders (37, 38, 39). In this report, we investigated whether in vivo exposure of mice to estrogen, a known immunomodulator, regulates NF-{kappa}B signaling in splenic lymphocytes. Our findings show that in vivo estrogen treatment markedly blocks the nuclear accumulation of NF-{kappa}B p65 and c-Rel proteins and then abolishes the DNA-binding activity of p65 in splenocytes that were stimulated with Con A or TNF-{alpha}. These observations are consistent with several in vitro studies that demonstrate estrogen-mediated inhibition of p65 and c-Rel in different nonlymphoid cell types (10, 40, 41). Our studies also show that estrogen inhibits the nuclear localization of RelB in splenic cells, an aspect not yet reported. The potential consequence of estrogen-induced inhibition of nuclear translocation of RelB is not known. However, other studies have shown the importance of RelB in splenic cellular architecture. RelB-deficient mice lack follicular dendritic cells, marginal zone macrophages, and marginal zone CD21/CD35high CD23neg B cells (42, 43). An in vitro study has shown that estrogen inhibition of LPS-induced p65 nuclear translocation is dependent on ER{alpha} and LPS induced-activation of PI3K (10). Whether in vivo estrogen treatment inhibits the nuclear translocation of p65, c-Rel, and RelB by the same or different mechanisms is not yet known. Because we found that estrogen blocks nuclear p65, c-Rel, and RelB during in vivo treatment without in vitro stimulation (Fig. 4), we suspect that there are different mechanisms involved.

In contrast to estrogen-mediated blockage of nuclear translocation of p65, c-Rel, and RelB, estrogen allowed the nuclear translocation of p50 and to a lesser extent p52. The size of nuclear p50 and p52 in splenocytes from estrogen-treated mice was slightly, but consistently, smaller than that observed in splenocytes from placebo-treated mice. This suggests that nuclear p50 and p52 are subjected to posttranslational modification in splenocytes from estrogen-treated mice. It is well known that the activity of transcription factors is commonly regulated by posttranslational modifications, such as phosphorylation and acetylation. Precisely what kind of modification causes the decreased size of p50 and p52 in cells from estrogen-treated mice is not presently known. One possibility is deacetylation. Our preliminary data show that the NF-{kappa}B coactivator p300, which is a histone acetyltransferase, was inhibited in the nuclei of splenocytes from estrogen-treated mice (data not shown). p300 has been shown to acetylate NF-{kappa}B p50, thereby increasing its DNA-binding activity and stimulating the expression of iNOS in the RAW 264.7 macrophage cell line (31). Although it is generally believed that deacetylation is correlated with inhibition of transcriptional activity, a recent study has shown that histone deacetylase could interact with p65 and increase NF-{kappa}B promoter activity (47).

Our novel observation is that in vivo estrogen treatment induced Bcl-3 protein expression. Other studies have shown that the binding of p50/p50 homodimers to Bcl-3 endows transcriptional activity to p50/p50 homodimers that lack transactivation domains (20, 21, 22). The binding of Bcl-3 and p50 to the promoter of the iNOS gene in Con A-stimulated splenocytes from estrogen-treated mice indicates that Bcl-3 plays a role in regulating this NF-{kappa}B target gene. Our data suggest a potential mechanism of estrogen-induced immune disorders via overactivation of NF-{kappa}B p50 homodimer-Bcl-3 complexes. Overactivation of p50/p50 homodimer/Bcl-3 complexes has been shown to be involved in the pathogenesis of breast cancer, nasopharyngeal carcinoma, disuse muscle atrophy, classical Hodgkin’s, as well as anaplastic large cell and other peripheral T cell lymphomas (48, 49, 50, 51).

The presence of Bcl-3 was detected only in splenocytes from estrogen-treated mice. Interestingly, although Bcl-3 mRNA is expressed at a similar level in both placebo- and estrogen-treated mice, Bcl-3 protein was not evident in any of the samples from placebo-treated mice with our Western blotting conditions. This suggests that in estrogen-treated mice Bcl-3 is regulated at the posttranscriptional level. We are currently exploring whether microRNAs, newly identified noncoding small RNAs (52, 53), play a role in this posttranscriptional regulation of Bcl-3 protein. Recent reports show that Bcl-3 plays an important role in controlling death of activated T cells and is required for maximal secondary Ag-stimulated IFN-{gamma} production in CD8+ T cells (54, 55). Whether the induction of Bcl-3 by estrogen plays a role in survival of B lymphocytes (56), up-regulation of IFN-{gamma} (12, 15), and autoimmune responses in estrogen-treated mice is an intriguing possibility that merits further investigation.

Despite nuclear inhibition of p65, c-Rel, and RelB by estrogen, we found that the expression of selected NF-{kappa}B-regulated cytokines was up-regulated by in vivo estrogen treatment (Fig. 5). This implies that in vivo estrogen treatment may regulate NF-{kappa}B signaling in a way that differs from the simple inhibitory effects observed with in vitro estrogen treatment in other studies. As evidence for this, we observed constitutive NF-{kappa}B transcriptional activity in splenocytes from estrogen-treated mice (Fig. 7), but not in splenocytes from placebo-treated mice.

In summary, our data suggest that in vivo exposure to estrogen inhibits canonical NF-{kappa}B activation of p65/p50 heterodimers but up-regulates NF-{kappa}B signaling via activation of NF-{kappa}B p50 homodimers and induction of Bcl-3 protein (Fig. 8). Our studies may have marked implications for many estrogen-influenced conditions including physiological immunoregulation, autoimmune diseases, inflammation, and lymphoid neoplasias. These data provide new insight into regulation of NF-{kappa}B proteins by estrogen and the knowledge derived may be useful in customizing immune interventions.


Figure 8
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 8. A schematic model of the effects of in vivo estrogen treatment on the NF-{kappa}B signaling pathway. Based on our data, in vivo estrogen exposure inhibits the classical and alternative NF-{kappa}B activation pathways by inhibiting nuclear localization of NF-{kappa}B p65, c-Rel, and RelB proteins. Despite this, estrogen induces higher constitutive NF-{kappa}B transcriptional activity by inducing Bcl-3 protein, activating p50/p50 homodimers, and stimulating NF-{kappa}B responsive gene expression.

 

    Acknowledgments
 
We thank Dr. Ebru Karpuzoglu, Tyson Brummer, and Deena Khan for collecting samples, preparation of implants, and assistance with surgeries. We also thank. Lynn Heffron, Dustin Lucas, and the animal care staff.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the National Institutes of Health (1 R01 AI051880-04A1). Back

2 Address correspondence and reprint requests to Dr. S. Ansar Ahmed, Center for Molecular Medicine and Infectious Diseases, 1410 Prices Fork Road, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Tech, Blacksburg, VA 24061. E-mail address: ansrahmd{at}vt.edu Back

3 Abbreviations used in this paper; iNOS, inducible NO synthase; Bcl-3, B cell lymphoma 3; ER, estrogen receptor; ChIP, chromatin immunoprecipitation. Back

Received for publication December 21, 2006. Accepted for publication May 14, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Ansar Ahmed, S., N. Talal. 1990. Sex hormones and the immune system: part 2, animal data. Baillieres Clin. Rheumatol. 4: 13-31. [Medline]
  2. Lahita, R. G.. 2000. Gender and the immune system. J. Gend. Specif. Med. 3: 19-22. [Medline]
  3. Ansar Ahmed, S., B. D. Hissong, D. Verthelyi, K. Donner, K. Becker, E. Karpuzoglu-Sahin. 1999. Gender and risk of autoimmune diseases: possible role of estrogenic compounds. Environ. Health Perspect. 107: (Suppl. 5):681-686. [Medline]
  4. Cohen-Solal, J. F., V. Jeganathan, C. M. Grimaldi, E. Peeva, B. Diamond. 2006. Sex hormones and SLE: influencing the fate of autoreactive B cells. Curr. Top. Microbiol. Immunol. 305: 67-88. [Medline]
  5. Czlonkowska, A., A. Ciesielska, G. Gromadzka, I. Kurkowska-Jastrzebska. 2005. Estrogen and cytokines production: the possible cause of gender differences in neurological diseases. Curr. Pharm. Des. 11: 1017-1030. [Medline]
  6. Latham, K. A., A. Zamora, H. Drought, S. Subramanian, A. Matejuk, H. Offner, E. F. Rosloniec. 2003. Estradiol treatment redirects the isotype of the autoantibody response and prevents the development of autoimmune arthritis. J. Immunol. 171: 5820-5827. [Abstract/Free Full Text]
  7. Dubal, D. B., H. Zhu, J. Yu, S. W. Rau, P. J. Shughrue, I. Merchenthaler, M. S. Kindy, P. M. Wise. 2001. Estrogen receptor {alpha}, not beta, is a critical link in estradiol-mediated protection against brain injury. Proc. Natl. Acad. Sci. USA 98: 1952-1957. [Abstract/Free Full Text]
  8. Choudhry, M. A., K. I. Bland, I. H. Chaudry. 2006. Gender and susceptibility to sepsis following trauma. Endocr. Metab. Immune Disord. Drug Targets 6: 127-135. [Medline]
  9. Hildebrand, F., W. J. Hubbard, M. A. Choudhry, B. M. Thobe, H. C. Pape, I. H. Chaudry. 2006. Are the protective effects of 17beta-estradiol on splenic macrophages and splenocytes after trauma-hemorrhage mediated via estrogen-receptor (ER)-{alpha} or ER-beta?. J. Leukocyte Biol. 79: 1173-1180. [Abstract/Free Full Text]
  10. Ghisletti, S., C. Meda, A. Maggi, E. Vegeto. 2005. 17beta-estradiol inhibits inflammatory gene expression by controlling NF-{kappa}B intracellular localization. Mol. Cell. Biol. 25: 2957-2968. [Abstract/Free Full Text]
  11. Bruce-Keller, A. J., S. W. Barger, N. I. Moss, J. T. Pham, J. N. Keller, A. Nath. 2001. Pro-inflammatory and pro-oxidant properties of the HIV protein Tat in a microglial cell line: attenuation by 17 beta-estradiol. J. Neurochem. 78: 1315-1324. [Medline]
  12. Karpuzoglu-Sahin, E., B. D. Hissong, S. Ansar Ahmed. 2001. Interferon-{gamma} levels are upregulated by 17-beta-estradiol and diethylstilbestrol. J. Reprod. Immunol. 52: 113-127. [Medline]
  13. Karpuzoglu, E., J. B. Fenaux, R. A. Phillips, A. J. Lengi, F. Elvinger, S. Ansar Ahmed. 2006. Estrogen up-regulates inducible nitric oxide synthase, nitric oxide, and cyclooxygenase-2 in splenocytes activated with T cell stimulants: role of interferon-{gamma}. Endocrinology 147: 662-671. [Abstract/Free Full Text]
  14. Lengi, A. J., R. A. Phillips, E. Karpuzoglu, S. Ansar Ahmed. 2006. Estrogen selectively regulates chemokines in murine splenocytes. J. Leukocyte Biol. 81: 1065-1074. [Medline]
  15. Gourdy, P., L. M. Araujo, R. Zhu, B. Garmy-Susini, S. Diem, H. Laurell, M. Leite-de-Moraes, M. Dy, J. F. Arnal, F. Bayard, A. Herbelin. 2005. Relevance of sexual dimorphism to regulatory T cells: estradiol promotes IFN-{gamma} production by invariant natural killer T cells. Blood 105: 2415-2420. [Abstract/Free Full Text]
  16. Nakaya, M., H. Tachibana, K. Yamada. 2006. Effect of estrogens on the interferon-{gamma} producing cell population of mouse splenocytes. Biosci. Biotechnol. Biochem. 70: 47-53. [Medline]
  17. Bonizzi, G., M. Karin. 2004. The two NF-{kappa}B activation pathways and their role in innate and adaptive immunity. Trends Immunol. 25: 280-288. [Medline]
  18. Yamamoto, Y., R. B. Gaynor. 2004. I{kappa}B kinases: key regulators of the NF-{kappa}B pathway. Trends Biochem. Sci. 29: 72-79. [Medline]
  19. Ghosh, S., M. Karin. 2002. Missing pieces in the NF-{kappa}B puzzle. Cell 109: (Suppl.):S81-S96. [Medline]
  20. Fujita, T., G. P. Nolan, H. C. Liou, M. L. Scott, D. Baltimore. 1993. The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-{kappa}B p50 homodimers. Genes Dev. 7: 1354-1363. [Abstract/Free Full Text]
  21. Franzoso, G., V. Bours, S. Park, M. Tomita-Yamaguchi, K. Kelly, U. Siebenlist. 1992. The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-{kappa}B-mediated inhibition. Nature 359: 339-342. [Medline]
  22. Bours, V., G. Franzoso, V. Azarenko, S. Park, T. Kanno, K. Brown, U. Siebenlist. 1993. The oncoprotein Bcl-3 directly transactivates through {kappa}B motifs via association with DNA-binding p50B homodimers. Cell 72: 729-739. [Medline]
  23. Nolan, G. P., T. Fujita, K. Bhatia, C. Huppi, H. C. Liou, M. L. Scott, D. Baltimore. 1993. The bcl-3 proto-oncogene encodes a nuclear I {kappa}B-like molecule that preferentially interacts with NF-{kappa}B p50 and p52 in a phosphorylation-dependent manner. Mol. Cell. Biol. 13: 3557-3566. [Abstract/Free Full Text]
  24. De Bosscher, K., W. Vanden Berghe, G. Haegeman. 2006. Cross-talk between nuclear receptors and nuclear factor {kappa}B. Oncogene 25: 6868-6886. [Medline]
  25. Kalaitzidis, D., T. D. Gilmore. 2005. Transcription factor cross-talk: the estrogen receptor and NF-{kappa}B. Trends Endocrinol. Metab. 16: 46-52. [Medline]
  26. Cerillo, G., A. Rees, N. Manchanda, C. Reilly, I. Brogan, A. White, M. Needham. 1998. The oestrogen receptor regulates NF{kappa}B and AP-1 activity in a cell-specific manner. J. Steroid Biochem. Mol. Biol. 67: 79-88. [Medline]
  27. Harnish, D. C., M. S. Scicchitano, S. J. Adelman, C. R. Lyttle, S. K. Karathanasis. 2000. The role of CBP in estrogen receptor cross-talk with nuclear factor-{kappa}B in HepG2 cells. Endocrinology 141: 3403-3411. [Abstract/Free Full Text]
  28. Hsu, S. M., Y. C. Chen, M. C. Jiang. 2000. 17beta-estradiol inhibits tumor necrosis factor-{alpha}-induced nuclear factor-{kappa}B activation by increasing nuclear factor-{kappa}B p105 level in MCF-7 breast cancer cells. Biochem. Biophys. Res. Commun. 279: 47-52. [Medline]
  29. Ansar Ahmed, S., D. Verthelyi. 1993. Antibodies to cardiolipin in normal C57BL/6J mice: induction by estrogen but not dihydrotestosterone. J. Autoimmun. 6: 265-279. [Medline]
  30. Karpuzoglu-Sahin, E., Y. Zhi-Jun, A. Lengi, N. Sriranganathan, S. Ansar Ahmed. 2001. Effects of long-term estrogen treatment on IFN-{gamma}, IL-2 and IL-4 gene expression and protein synthesis in spleen and thymus of normal C57BL/6 mice. Cytokine 14: 208-217. [Medline]
  31. Deng, W. G., K. K. Wu. 2003. Regulation of inducible nitric oxide synthase expression by p300 and p50 acetylation. J. Immunol. 171: 6581-6588. [Abstract/Free Full Text]
  32. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 272: 30412-30420. [Abstract/Free Full Text]
  33. Cao, S., X. Zhang, J. P. Edwards, D. M. Mosser. 2006. NF-{kappa}B1 (p50) homodimers differentially regulate pro- and anti-inflammatory cytokines in macrophages. J. Biol. Chem. 281: 26041-26050. [Abstract/Free Full Text]
  34. Mori, N., D. Prager. 1996. Transactivation of the interleukin-1{alpha} promoter by human T-cell leukemia virus type I and type II Tax proteins. Blood 87: 3410-3417. [Abstract/Free Full Text]
  35. Hiscott, J., J. Marois, J. Garoufalis, M. D’Addario, A. Roulston, I. Kwan, N. Pepin, J. Lacoste, H. Nguyen, G. Bensi, et al 1993. Characterization of a functional NF-{kappa}B site in the human interleukin 1beta promoter: evidence for a positive autoregulatory loop. Mol. Cell. Biol. 13: 6231-6240. [Abstract/Free Full Text]
  36. Bhatia, K., K. Huppi, T. McKeithan, D. Siwarski, J. F. Mushinski, I. Magrath. 1991. Mouse bcl-3: cDNA structure, mapping and stage-dependent expression in B lymphocytes. Oncogene 6: 1569-1573. [Medline]
  37. Yamamoto, Y., R. B. Gaynor. 2001. Role of the NF-{kappa}B pathway in the pathogenesis of human disease states. Curr. Mol. Med. 1: 287-296. [Medline]
  38. Karin, M., F. R. Greten. 2005. NF-{kappa}B: linking inflammation and immunity to cancer development and progression. Nat. Rev. Immunol. 5: 749-759. [Medline]
  39. Yamamoto, Y., R. B. Gaynor. 2001. Therapeutic potential of inhibition of the NF-{kappa}B pathway in the treatment of inflammation and cancer. J. Clin. Invest. 107: 135-142. [Medline]
  40. Bethea, C. L., A. P. Reddy, L. J. Smith. 2006. Nuclear factor {kappa}B in the dorsal raphe of macaques: an anatomical link for steroids, cytokines and serotonin. J. Psychiatry Neurosci. 31: 105-114. [Medline]
  41. Yang, L., Y. Hu, Y. Hou. 2006. Effects of 17beta-estradiol on the maturation, nuclear factor {kappa}B p65 and functions of murine spleen CD11c-positive dendritic cells. Mol. Immunol. 43: 357-366. [Medline]
  42. Weih, D. S., Z. B. Yilmaz, F. Weih. 2001. Essential role of RelB in germinal center and marginal zone formation and proper expression of homing chemokines. J. Immunol. 167: 1909-1919. [Abstract/Free Full Text]
  43. Weih, F., J. Caamano. 2003. Regulation of secondary lymphoid organ development by the nuclear factor-{kappa}B signal transduction pathway. Immunol. Rev. 195: 91-105. [Medline]
  44. Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, D. Lo. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373: 531-536. [Medline]
  45. Grimaldi, C. M., D. J. Michael, B. Diamond. 2001. Cutting edge: expansion and activation of a population of autoreactive marginal zone B cells in a model of estrogen-induced lupus. J. Immunol. 167: 1886-1890. [Abstract/Free Full Text]
  46. Zoller, A. L., G. J. Kersh. 2006. Estrogen induces thymic atrophy by eliminating early thymic progenitors and inhibiting proliferation of beta-selected thymocytes. J. Immunol. 176: 7371-7378. [Abstract/Free Full Text]
  47. Yu, Z., W. Zhang, B. C. Kone. 2002. Histone deacetylases augment cytokine induction of the iNOS gene. J. Am. Soc. Nephrol. 13: 2009-2017. [Abstract/Free Full Text]
  48. Hunter, R. B., S. C. Kandarian. 2004. Disruption of either the Nfkb1 or the Bcl3 gene inhibits skeletal muscle atrophy. J. Clin. Invest. 114: 1504-1511. [Medline]
  49. Thornburg, N. J., R. Pathmanathan, N. Raab-Traub. 2003. Activation of nuclear factor-{kappa}B p50 homodimer/Bcl-3 complexes in nasopharyngeal carcinoma. Cancer Res. 63: 8293-8301. [Abstract/Free Full Text]
  50. Mathas, S., K. Johrens, S. Joos, A. Lietz, F. Hummel, M. Janz, F. Jundt, I. Anagnostopoulos, K. Bommert, P. Lichter, et al 2005. Elevated NF-{kappa}B p50 complex formation and Bcl-3 expression in classical Hodgkin, anaplastic large-cell, and other peripheral T-cell lymphomas. Blood 106: 4287-4293. [Abstract/Free Full Text]
  51. Cogswell, P. C., D. C. Guttridge, W. K. Funkhouser, A. S. Baldwin, Jr. 2000. Selective activation of NF-{kappa}B subunits in human breast cancer: potential roles for NF-{kappa}B2/p52 and for Bcl-3. Oncogene 19: 1123-1131. [Medline]
  52. Engels, B. M., G. Hutvagner. 2006. Principles and effects of microRNA-mediated post-transcriptional gene regulation. Oncogene 25: 6163-6169. [Medline]
  53. Hossain, A., M. T. Kuo, G. F. Saunders. 2006. Mir-17–5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA. Mol. Cell. Biol. 26: 8191-8201. [Abstract/Free Full Text]
  54. Chilton, P. M., T. C. Mitchell. 2006. CD8 T cells require Bcl-3 for maximal {gamma} interferon production upon secondary exposure to antigen. Infect. Immun. 74: 4180-4189. [Abstract/Free Full Text]
  55. Bauer, A., A. Villunger, V. Labi, S. F. Fischer, A. Strasser, H. Wagner, R. M. Schmid, G. Hacker. 2006. The NF-{kappa}B regulator Bcl-3 and the BH3-only proteins Bim and Puma control the death of activated T cells. Proc. Natl. Acad. Sci. USA 103: 10979-10984. [Abstract/Free Full Text]
  56. Verthelyi, D. I.. 1996. Effects of estrogen on the B cell functions of normal mice. Doctoral dissertation Virginia Polytechnic Institute and State University, Blacksburg, VA.



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. A. Khan, A. Coaquette, C. Davrinche, and G. Herbein
Bcl-3-Regulated Transcription from Major Immediate-Early Promoter of Human Cytomegalovirus in Monocyte-Derived Macrophages
J. Immunol., June 15, 2009; 182(12): 7784 - 7794.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Dai, R. A. Phillips, Y. Zhang, D. Khan, O. Crasta, and S. A. Ahmed
Suppression of LPS-induced Interferon-{gamma} and nitric oxide in splenic lymphocytes by select estrogen-regulated microRNAs: a novel mechanism of immune modulation
Blood, December 1, 2008; 112(12): 4591 - 4597.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M.-C. Huang, J.-J. Liao, S. Bonasera, D. L. Longo, and E. J. Goetzl
Nuclear factor-{kappa}B-dependent reversal of aging-induced alterations in T cell cytokines
FASEB J, July 1, 2008; 22(7): 2142 - 2150.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, R.
Right arrow Articles by Ahmed, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, R.
Right arrow Articles by Ahmed, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS