The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1693 -1699
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dyer, K. D.
Right arrow Articles by Rosenberg, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dyer, K. D.
Right arrow Articles by Rosenberg, H. F.

Eosinophils from Lineage-Ablated {Delta}dblGATA Bone Marrow Progenitors: The dblGATA Enhancer in the Promoter of GATA-1 Is Not Essential for Differentiation Ex Vivo1

Kimberly D. Dyer2,*, Meggan Czapiga{dagger}, Barbara Foster*, Paul S. Foster{ddagger}, Elizabeth M. Kang§, Courtney M. Lappas§, Jennifer M. Moser*, Nora Naumann§, Caroline M. Percopo*, Steven J. Siegel*, Jonathan M. Swartz*, SukSee Ting-De Ravin§ and Helene F. Rosenberg*

* Laboratory of Allergic Diseases, National Institute of Allergy and Infectious Diseases/National Institutes of Health (NIAID/NIH), Bethesda, MD 20892; {dagger} Research Technologies Branch, NIAID/NIH, Bethesda, MD 20892; {ddagger} School of Biomedical Sciences, University of Newcastle, Newcastle, New South Wales, Australia; and § Laboratory of Host Defenses, NIAID/NIH, Bethesda, MD 20892


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
A critical role for eosinophils in remodeling of allergic airways was observed in vivo upon disruption of the dblGATA enhancer that regulates expression of GATA-1, which resulted in an eosinophil-deficient phenotype in the {Delta}dblGATA mouse. We demonstrate here that bone marrow progenitors isolated from {Delta}dblGATA mice can differentiate into mature eosinophils when subjected to cytokine stimulation ex vivo. Cultured {Delta}dblGATA eosinophils contain cytoplasmic granules with immunoreactive major basic protein and they express surface Siglec F and transcripts encoding major basic protein, eosinophil peroxidase, and GATA-1, -2, and -3 to an extent indistinguishable from cultured wild-type eosinophils. Fibroblast coculture and bone marrow cross-transplant experiments indicate that the in vivo eosinophil deficit is an intrinsic progenitor defect, and remains unaffected by interactions with stromal cells. Interestingly, and in contrast to those from the wild type, a majority of the GATA-1 transcripts from cultured {Delta}dblGATA progenitors express a variant GATA-1 transcript that includes a first exon (1EB), located ~3700 bp downstream to the previously described first exon found in hemopoietic cells (1EA) and ~42 bp upstream to another variant first exon, 1EC. These data suggest that cultured progenitors are able to circumvent the effects of the {Delta}dblGATA ablation by using a second, more proximal, promoter and use this mechanism to generate quantities of GATA-1 that will support eosinophil growth and differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The generation of eosinophil lineage-deficient mouse models has permitted direct dissection of the role of this granulocyte in allergen-challenged mice and in response to infection with helminthic parasites (1, 2, 3). The {Delta}dblGATA eosinophil-ablation model was engineered by deletion of a palindromic GATA-binding site (dblGATA) in the hemopoietic promoter that is believed to mediate positive autoregulation of GATA-1 expression (4). The GATA-1 transcription factor directs immature myeloid progenitors to differentiate into erythroid cells, megakaryocytes, and eosinophils (5). Initial gene-targeting studies revealed that GATA-1 is essential for normal erythropoiesis, as hemizygous male GATA-1-null mice die in utero from severe anemia (5, 6). In contrast, the results of the {Delta}dblGATA ablation are less dramatic, resulting instead in selective loss of the eosinophil lineage observed at homeostasis (4) as well as in pathophysiologic settings (1).

In this study, we demonstrate that bone marrow progenitors from {Delta}dblGATA eosinophil-ablated mice develop into cells with eosinophil-specific characteristics when subjected to cytokine stimulation ex vivo. In an attempt to understand why {Delta}dblGATA bone marrow progenitors can develop into eosinophils ex vivo but minimally (7) if at all in vivo, we also investigated GATA-1 promoter usage and relative expression of transcripts encoding GATA-1, -2, and -3. Finally, we explored an ex vivo cross culture system and an in vivo bone marrow transplant model to determine whether the {Delta}dblGATA eosinophil lineage ablation is an intrinsic defect of progenitor cells or involves dysfunctional interactions with the environment.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Four male {Delta}dblGATA (CD90.2) mice were obtained from Drs. A. Humbles and C. Gerard (Harvard Medical School, Boston, MA) and crossed with wild-type BALB/c mice (CD90.2; Taconic Farms) to generate our colony. Two breeding pairs of BALB/c thy1.1/CD90.1 (used in the bone marrow transfer) were a gift from Dr. R. DiPaolo (National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH), Bethesda, MD). Experimental protocols were reviewed by the Animal Care and Use Committee, NIAID, NIH, protocol number LAD-7E.

Isolation of bone marrow cells

Mouse bone marrow was collected and cells were counted as described previously (8). Cytospin preparations were fixed and stained using a modified Giemsa-stain (Diff Quik; Dade Behring). Ex vivo culture of eosinophils and fibroblast monolayers. Bone marrow cells were cultured at 106/ml in basic medium containing IMDM (Invitrogen Life Technologies) with 20% FCS (Cambrex), 100 IU/ml penicillin and 10 µg/ml streptomycin (Cellgro), 2 mM glutamine (Invitrogen Life Technologies), and supplemented with 100 ng/ml SCF (PeproTech) and 100 ng/ml FLT3-L (PeproTech). On day 4, the cells were transferred into basic medium containing 20 ng/ml IL-3 (PeproTech), 10 ng/ml IL-5 (R&D Systems), and 10 ng/ml GM-CSF (PeproTech). On day 8, the cells were switched into basic medium containing 20 ng/ml IL-3 and 10 ng/ml IL-5 only. Fibroblast cultures (used in the ex vivo cross culture experiments) were derived by plating bone marrow cells in the absence of cytokines. After 24 h, the nonadherent cells were removed. The adherent cells were cultured for 4 wk in 10% mouse serum (Atlanta Biologicals) and 10% FCS (Cambrex), 100 IU/ml penicillin, and 10 µg/ml streptomycin (Cellgro), 2 mM glutamine (Invitrogen Life Technologies).

Bone marrow transfer experiments

In two separate experiments, a total of 14 {Delta}dblGATA mice (CD90.2) and 16 wild-type BALB/c mice (CD90.1) were irradiated (850 rad). These recipient mice were given water containing neomycin and transplanted 24–30 h later with bone marrow (3–6 x 106 cells/150 µl of HBSS) from either wild-type or {Delta}dblGATA mice. All surviving mice (15 BALB/c and 9 {Delta}dblGATA) exhibited normal peripheral blood cell values by week 4. By week 6, the wild-type CD90.1 recipient mice transplanted with {Delta}dblGATA (CD90.2) bone marrow exhibited 68 ± 11% CD90.2 cells (percentage of CD3+) and 21 ± 9% CD90.1 cells. The {Delta}dblGATA CD90.2 recipient mice transplanted with bone marrow from wild-type BALB/c (CD90.1) mice exhibited 78% CD90.1 cells (percentage of CD3+) and 2% CD90.2 cells. At week 6, both peripheral blood and bone marrow were collected and analyzed for Siglec F expression. Cytospin slides were prepared and stained by the modified Giemsa method (DiffQuik) for manual eosinophil counts.

Gene microarray analysis

Bone marrow RNA samples from uninfected and Schistosoma mansoni-infected BALB/c and {Delta}dblGATA mice (n = 2–4 mice/group, t = 9 wk) were pooled and subjected to gene microarray at the Microarray Core Facility (Rochester, NY) as described previously (9). Data were generated using the M430 mouse genome chip and analyzed with GeneSpring 7.0 software (Silicon Genetics) and analyses as previously described by Domachowske et al. (9). The data reported in Table I reflect normalized fluorescence for genes of interest in which the gene was present in at least one of the four conditions examined.


View this table:
[in this window]
[in a new window]

 
Table I. Differential expression of eosinophil-related transcriptsa

 
Quantitative RT-PCR

Cells were suspended in RNazol B (Teltest) at 1 ml/106 cells and extraction proceeded as per manufacturer’s instructions. Two micrograms of RNA were subjected to DNase I treatment (Invitrogen Life Technologies) and reverse transcribed using a First Strand cDNA Synthesis kit for RT-PCR (AMV; Roche Diagnostics). One microliter of cDNA was subjected to TaqMan (Q) PCR using custom FAM-labeled probe and primers to each indicated mouse gene. All primer probe sets were purchased from Applied Biosystems. All experiments included no reverse transcriptase and no template controls and mouse GAPDH (Applied Biosystems) was used as the endogenous control.

Flow cytometry

Cells were probed with either PE-conjugated rat anti-mouse Siglec F or PE-conjugated IgG2A6 isotype control (1 µg/106 cells; BD Pharmingen) for 30 min at 4°C or a combination of anti-mouse CD3e PE-Cy5 (BD Pharmingen), anti-rat/mouse Thy1.1 Alexa Fluor 488 (Ox-7; BioLegend), and anti-mouse Thy1.2 PE (BioLegend). After staining, the cells were fixed in 4% paraformaldehyde and analyzed by flow cytometry. Data were acquired with a FACSCalibur flow cytometer (BD Biosciences) and analyzed with FloJo software version 7.1 (Tree Star). Siglec F-positive cells were identified by comparison to the PE-conjugated IgG2A6 isotype control. Thy1.1 (CD90.1) and Thy1.2 (CD90.2) expression was examined within the CD3+ population.

5' RACE

cDNA was synthesized from 2 µg of RNA from freshly isolated bone marrow cells or from bone marrow cells that had been maintained in culture for 23 days with Moloney murine leukemia virus reverse transcriptase as per the manufacturer’s instructions (SMART RACE cDNA Amplification kit; BD Clontech). RACE ready cDNAs were templates for PCR using the following oligonucleotides specific for the mouse GATA-1 gene: primer 1826: CATCAGATTCCACAGGTTTCTTTTC; primer 1799: TTTGTGGATTCTGCCCTGGTGTC. One microliter of the primary PCR amplification products was used as template in a second or nested PCR. The amplified PCR fragments were gel purified (BIO 101) and subcloned into the pCR2.1 (Invitrogen Life Technologies) and multiple colonies were sequenced. The sequences were assembled with GenBank NM_008089 using Sequencher 4.1 (GeneCodes) to determine the gene structure.

Immunostaining and observation under confocal microscopy

One million cells were washed and then fixed in 4% paraformaldehyde followed by permeabilization in ice-cold methanol. Rabbit anti-major basic protein (MBP)3 (no. 509, a gift from Drs. N. A. Lee and J. J. Lee, Mayo Clinic, Scottsdale, AZ) was used at a 1/5000 dilution for 1 h at 4°C, the cells were washed and goat anti-rabbit IgG-Alexa 647 (Molecular Probes) was applied at a 1/100 dilution. After 1 h of incubation, the cells were washed and incubated with the nuclear stain, 4', 6-diamidino-2-phenylindole dihydrochloride (DAPI; Molecular Probes). Images were collected as previously described (10) and imaging fields were selected "blinded" in that the microscope was centered on the DAPI-stained nuclei and that field was imaged regardless of the presence or absence of myelin basic protein-Alexa Fluor 647-positive cells, as Alexa Fluor 647 is far red and not visible to the eye.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Detection of eosinophils in the bone marrow of wild-type and {Delta}dblGATA mice in response to prolonged Th2 stimulation

We (3) and others (1, 4) did not detect eosinophils in bone marrow of eosinophil-deficient {Delta}dblGATA mice at homeostasis or in response to prolonged stimulation with IL-5. Microarray analysis of bone marrow progenitors from uninfected and S. mansoni-infected wild-type and {Delta}dblGATA mice reveals differential expression of eosinophil-associated gene transcripts. The transcripts encoding two prototypical eosinophil markers, MBP and eosinophil peroxidase (EPO), exhibit 56- and 36-fold reduced expression, respectively, in uninfected {Delta}dblGATA compared with wild-type bone marrow; this increased to 74- and 209-fold differences when comparing S. mansoni-infected {Delta}dblGATA and wild-type mice. The results from the single gene microarray experiment were examined further by quantitative RT-PCR (Fig. 1). Expression of transcripts encoding EPO, MBP, and GATA-1 was significantly diminished in bone marrow of {Delta}dblGATA mice, as was the expression of IL-5R{alpha}. Interestingly, and consistent with previous findings (4), we observed no differential expression of CCR3, considered to a unique marker of mouse eosinophils (11).


Figure 1
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 1. Relative expression of eosinophil-associated transcripts in bone marrow from wild-type BALB/c and {Delta}dblGATA eosinophil-ablated mice. All cycle-threshold (Ct) values are normalized to GAPDH; transcription is expressed as fold increase over a selected transcript from {Delta}dblGATA bone marrow normalized to 1.0. Statistical significance was determined using the two-tailed t test assuming equal variance: *, p < 0.05; **, p < 0.005. Note log scale on the y-axis.

 
Generation and quantitative analysis of eosinophils in bone marrow culture

We used an ex vivo culture system providing cytokines that promote stem cell growth and eosinophil differentiation (see Materials and Methods). Confocal microscopic analysis of cultured {Delta}dblGATA bone marrow progenitors revealed immunoreactive MBP within cytoplasmic granules and rudimentary bilobed nuclei, indistinguishable from those detected in cultured wild-type progenitors (Fig. 2).


Figure 2
View larger version (93K):
[in this window]
[in a new window]

 
FIGURE 2. Eosinophils derived from ex vivo bone marrow culture. Bone marrow cells from wild-type BALB/c and {Delta}dblGATA mice were cultured for 14 days as described in the Materials and Methods and then analyzed by confocal microscopy for the presence of the eosinophil granule protein MBP. A, Secondary Ab, Alexa 647-conjugated goat anti-rabbit IgG only. B, Cultured bone marrow cells from wild-type BALB/c mice stained with rabbit anti-MBP and secondary Ab. C, Cultured bone marrow cells from {Delta}dblGATA mice stained with rabbit anti-MBP and secondary Ab. Blue pseudocoloring highlights nuclear staining with DAPI and the red pseudocolor denotes staining with anti-MBP and secondary Ab. D, Bone marrow cells from three wild-type BALB/c and three {Delta}dblGATA mice were evaluated by flow cytometry for the presence of Siglec F+ eosinophils both before culture (day 0) and on days 7 and 4 in culture as described in Materials and Methods. Statistical significance was determined by using the two-tailed t test assuming equal variance; *, p < 0.01; **, p < 0.001.

 
Eosinophils in culture were detected and enumerated by cell surface expression of Siglec F (12, 13). In a previous study, we found no Siglec F+ eosinophils in the bone marrow of {Delta}dblGATA mice when gating on the side scatter-high mature granulocyte population (8). Data presented in Fig. 2D are not gated and represent the percent Siglec F+ cells in comparison to the isotype control only. At the initiation of culture (day 0), there are more Siglec F+ cells in the wild-type than in the {Delta}dblGATA culture (6 ± 0.6% vs 0.8 ± 0.03%, p < 0.0001), reflecting at most a minimal number of eosinophil progenitors in bone marrow from {Delta}dblGATA mice. As the half-life of mature eosinophils in culture without cytokine support (IL-5, GM-CSF) is 24–48 h (14, 15), the original mature eosinophil population will be substantially diminished before addition of cytokines on day 4. This is seen at day 8, as the percentage of Siglec F+ cells in the wild-type culture is reduced to 1.8 ± 0.08%; this reduction was confirmed by direct observation of stained cytospin preparations. At day 14, the eosinophil population in the wild-type cultures expanded to 5 ± 1% Siglec F+ cells, and in the {Delta}dblGATA cultures, 7 ± 1% Siglec F+ cells (a 3- to 4-fold increase over that observed at day 8, p < 0.01). No significant difference in percentage of Siglec F+ cells was observed between the wild-type and {Delta}dblGATA cultures at day 14 (p = 0.18). Interestingly, we were unable to detect eosinophils in the {Delta}dblGATA cultures with the modified Wright-Giemsa stain.

Expression of eosinophil-associated transcripts in bone marrow culture

At day 0 (at isolation), we detect differential expression of eosinophil-associated transcripts MBP, EPO, and GATA-1, as anticipated from the characterized eosinophil ablation of the {Delta}dblGATA mouse strain (Fig. 3). Eosinophilopoietic cytokines are added to the cultures on day 4, and beginning on day 8, we observe no further differential expression of MBP, EPO, or GATA-1 until day 14. In contrast, maximum expression of formyl peptide receptor 1 (Fpr1), a neutrophil-associated transcript, is observed on day 0, with no differential expression detected at all throughout the course of the experiment. No differential transcription of GATA-2 or -3 was observed either at isolation (day 0) or in response to cytokine stimulation.


Figure 3
View larger version (32K):
[in this window]
[in a new window]

 
FIGURE 3. Differential expression of eosinophil-associated transcripts in wild-type and {Delta}dblGATA bone marrow cells before and during culture ex vivo. RNA was extracted from bone marrow progenitors from wild-type BALB/c and {Delta}dblGATA mice and subjected to quantitative RT-PCR to determine the relative expression of the transcripts indicated. {blacksquare}, Wild-type BALB/c; {square}, {Delta}dblGATA. A, MBP; B, EPO; C, Fpr1; D, GATA-1; E, GATA-2; F, GATA-3. All Ct values were normalized to GAPDH and transcription is expressed as fold increase over a selected transcript from {Delta}dblGATA bone marrow on day 4 which was normalized to 1.0. Cytokines present in culture are indicated by arrows along x-axis. Statistical significance was determined by using the two-tailed t test assuming equal variance; *, p < 0.05.

 
Sequence analysis of GATA-1 transcripts

Transcription of GATA-1 has been traditionally understood as driven by one of two promoters, with the distal promoter, the region 5' to exon 1T, primarily active in the testis (17) and the proximal promoter, 5' to exon 1EA (Fig. 4A), which includes the {Delta}dblGATA ablation, primarily active in hemopoietic cells (18, 19). Included in the schematic shown here is exon E1B, identified by Seshasayee et al. (20) in mouse bone marrow culture, and located ~3700 bp proximal to 1EA. Using the 5' RACE procedure, we amplified two transcript variants from testis tissue that included either exons 1T or 1EA, with no significant differences in distribution when comparing wild type to {Delta}dblGATA mice (data not shown). Two transcript variants were isolated from bone marrow progenitors. The predominant variant (representing 70–90% of the total transcripts amplified) included exon 1EA and a minor population contained the aforementioned exon 1EB. No significant differences in distribution were observed when comparing transcripts amplified from freshly isolated wild-type vs {Delta}dblGATA bone marrow (Fig. 4B).


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 4. Quantitative analysis of transcripts encoding GATA-1 in wild-type and {Delta}dblGATA cultured bone marrow progenitors. A, Schematic of the structure of the gene encoding GATA-1, modified from that proposed by Ito et al. (17 ). Exons 1 include IT, IEA, IEB (20 ) and the newly identified IEC. Also shown are the relative positions of the palindromic {Delta}dblGATA and tandem [GATA]7 consensus sites (20 ). B, Distribution of transcripts encoding GATA-1 identified in freshly isolated bone marrow and cultured bone marrow progenitors from wild-type BALB/c and {Delta}dblGATA mice. Values denote percentage of transcripts isolated that use the exon 1 variant (1EA, 1EB, or 1EC) as indicated. Statistical significance determined by Fisher’s exact test; *, p < 0.001 between groups as shown.

 
In contrast, three transcript variants were amplified from cultured bone marrow progenitors (Fig. 4B). Exon 1EA was included in 83% of the transcripts in wild-type culture, but in only 45% of the transcripts in the {Delta}dblGATA culture. Other variants included transcripts with exon 1EB (10% in wild type vs 52% in {Delta}dblGATA progenitor culture) and a novel minor transcript, which included a new exon 1EC, located only ~42 bp 3' to exon 1EB. The distribution of the transcripts in the wild-type vs {Delta}dblGATA cultures differed markedly from one another (Fisher’s exact test, p < 0.001), with pronounced differential transcription of variants containing exons 1EA and 1EB. Additionally, the distribution of transcript variants is significantly different in ex vivo-cultured {Delta}dblGATA than in freshly isolated bone marrow cells (p < 0.001) while the distribution of transcripts from BALB/c bone marrow is not altered significantly in response to culture conditions.

Cross-culture and bone marrow transfer experiments

Bone marrow coculture experiments were performed as described in the Materials and Methods. As shown in Fig. 5A, fibroblasts from {Delta}dblGATA mice had no detrimental effect on the development of eosinophils from wild-type progenitors when measured at either days 7 or 14 of growth in culture; likewise, wild-type BALB/c fibroblasts had no impact on the growth and differentiation of eosinophils from {Delta}dblGATA progenitors.


Figure 5
View larger version (26K):
[in this window]
[in a new window]

 
FIGURE 5. Quantitative assessment of progenitor-stromal interactions. A, Fibroblast coculture ex vivo. Data are shown as a ratio of percent of Siglec F+ cells detected in cross-culture divided by the percent Siglec F+ progenitors in the parallel control culture (in triplicate) at days 7 and 14 under eosinophil-promoting culture conditions (see Materials and Methods). B, In vivo bone marrow transplantation. Recipient wild-type BALB/c (CD90.1, WT) and {Delta}dblGATA (CD90.2) mice received myelosuppressive irradiation and were transplanted with matched or heterologous bone marrow progenitors. Data were collected from two independent experiments from recipient (recip.)/donor WT/WT (n = 7), WT/{Delta}dblGATA (n = 8), {Delta}dblGATA/WT (n = 4), and {Delta}dblGATA/{Delta}dblGATA (n = 5). Statistical significance was determined by using the two-tailed t test assuming equal variance; *, p < 0.03 comparing WT vs {Delta}dblGATA donors.

 
In Fig. 5B, we present the results of experiments in which eosinophil hemopoiesis was monitored in wild-type BALB/c (CD90.1) and {Delta}dblGATA (CD90.2) mice that received myelosuppressive irradiation and were then transplanted with matched or heterologous bone marrow progenitors. Similar to our findings with fibroblast cross-cultures, wild-type BALB/c bone marrow transplanted into irradiated {Delta}dblGATA-recipient mice (heterologous) develop into Siglec F+ eosinophils with equivalent efficiency to the those transplanted into irradiated wild-type mice (matched). Likewise, few (wild-type recipients) to no ({Delta}dblGATA recipients) Siglec F+ or Giemsa-stained eosinophils develop in mice receiving {Delta}dblGATA marrow progenitors.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Eosinophils are among the most enigmatic of cells, as the precise nature of their role in host defense against parasitic infection and/or in the pathogenesis of allergic disease remains a subject of profound controversy (21). Although several eosinophil-specific gene promoters have been characterized (22, 23, 24, 25), no one has succeeded in identifying transcription factors or events that are clearly unique to this lineage. The serendipitous finding of Yu et al. (4) that deletion of the palindromic dblGATA consensus binding site in the proximal promoter of the GATA-1 gene results in specific ablation of the eosinophil lineage could not be anticipated from previous studies (26, 27). This finding has been interpreted to mean that eosinophil differentiation depends on somewhat elevated levels of GATA-1 expression and that the {Delta}dblGATA ablation destroys a potential positive feedback loop (19). Interestingly, we show here for the first time that there is in fact diminished expression of GATA-1 in bone marrow progenitors isolated from {Delta}dblGATA mice (Figs. 1 and 3), with no compensatory increased expression of GATA-2 or GATA-3. The functional consequences of this finding remain to be explored.

Most intriguing is our observation that, when grown ex vivo in the presence of cytokines that promote eosinophil differentiation, the inhibitory effect of the {Delta}dblGATA deletion was virtually eliminated. Both wild-type and {Delta}dblGATA bone marrow progenitors differentiate into cells with condensed nuclei and large cytoplasmic granules that stain positively for MBP. The differentiated eosinophils from both wild-type and {Delta}dblGATA progenitors can also be detected by cell surface expression of Siglec F, and progenitor cultures demonstrate augmented expression of eosinophil transcripts EPO, MBP, and GATA-1. Given that the eosinophil ablation observed in vivo is related (directly or indirectly) to the disruption of a functional enhancer element in what is known as the proximal, or hemopoietic, promoter of GATA-1, we focused our attention on the nature and distribution of GATA-1 transcripts found in bone marrow and in progenitor cultures. Among our findings, we demonstrate that GATA-1 transcripts from wild-type BALB/c mice contain one of four distinct potential exons 1 (Fig. 4). The distal exon 1T was found only in transcripts amplified from testis tissue, although transcripts with the more proximal hemopoietic exon 1E (here, called 1EA) can also be detected in testis tissue. No transcripts with exon 1T were amplified from freshly isolated bone marrow; the majority of the transcripts from wild-type bone marrow contain exon 1EA. However, we also amplified transcripts that contain an even more proximal exon 1EB, located ~3700 bp from 1EA. Seshasayee et al. (20) have previously described the 1EB exon within a minor population of transcripts from cultured mouse bone marrow progenitors. In our bone marrow progenitor cultures, we detect three distinct transcripts, those including the aforementioned 1EA and 1EB, and also, a third population, including an even more proximal exon 1EC. In testis and freshly isolated bone marrow, we observe no significant differential exon usage when comparing transcript distribution in both wild-type and {Delta}dblGATA mouse strains. However, the distribution observed in the wild-type bone marrow progenitor cultures (83% 1EA, 10% 1EB, 7% 1EC) differs substantially from that detected in the {Delta}dblGATA (45% E1A, 52%E1B, 3% 1EC, p < 0.001 by Fisher’s exact test); specifically, we observe dramatically reduced usage of exon E1A and increased usage of exon E1B in the {Delta}dblGATA cultures as compared with the wild type. Of note, exon 1EB is immediately proximal to, and may be under more direct control of the tandem [GATA]7 enhancer, an active element of GATA-1 expression in erythroid cells and cell lines (20). Taken together, our findings indicate that the effects of the dblGATA deletion and eosinophil ablation can be overcome ex vivo by differential promoter usage. Likewise, our results demonstrate the plasticity of eosinophil differentiation and the existence of an important compensation mechanism supporting GATA-1 gene transcription in response to dblGATA deletion, and perhaps under other, as yet-to-be identified pathophysiologic states. As such, it would be interesting to explore the role of GATA-1 transcription and alternate promoter usage in the pathogenesis of idiopathic hypereosinophilic syndromes. It is also intriguing to consider the possibility that prolonged, ultra-high-level cytokine stimulation, such as that achieved pharmacologically, might direct differential expression of variant GATA-1 transcripts. Finally, we considered the possibility that development of eosinophils in the {Delta}dblGATA mice was in some way inhibited by progenitor-stromal interactions. This would be similar to observations made regarding Sl/Sld and tg/tg mast-cell deficient mice in which the progenitors do not differentiate due to the absence of appropriate signals from the environment (28, 29). In our two experiments, the cross-culture on bone marrow fibroblasts and the cross-bone marrow transplants, we demonstrated that the donor’s stromal contribution had no impact on the capacity of the wild-type or {Delta}dblGATA progenitors to generate eosinophils. We conclude that the ability (or not) to develop into eosinophils rests solely within the nature of the progenitor cells and that the {Delta}dblGATA mouse’s inability to generate eosinophils is due to an intrinsic defect of the progenitor cells.

In summary, the {Delta}dblGATA mouse strain, in prominent use for studies of allergy and asthma pathogenesis (1, 3), contains an ablation of a palindromic dblGATA-binding site in the hemopoietic promoter of GATA-1 and does not support normal differentiation of the eosinophil lineage in vivo. However, bone marrow progenitors from {Delta}dblGATA mice respond to ex vivo culture conditions by differentiating into eosinophils in a manner indistinguishable from the wild type. Expression of GATA-1 in wild-type cultured progenitors occurs via transcripts that contain one of three distinct hemopoietic exons 1 (1EA, 1EB, and a novel 1EC) in proportions that differ dramatically from those detected in {Delta}dblGATA progenitor cultures. Our data suggest that the {Delta}dblGATA progenitors may circumvent the {Delta}dblGATA ablation by overuse of a second, more proximal promoter that includes the [GATA]7 motif (20, 26), thereby generating quantities of GATA-1 sufficient to support eosinophilopoiesis. It remains to be seen what role is played by differential transcription of GATA-1 under pathophysiologic conditions.


    Acknowledgments
 
We thank Drs. Nancy A. Lee and James J. Lee, Mayo Clinic, Scottsdale, AZ, for their generous gift of the rabbit polyclonal anti-MBP Ab; Drs. Alison Humbles and Craig Gerard (Harvard Medical School, Boston, MA) for the {Delta}dblGATA mice and genotyping protocols; Dr. Richard DiPaolo (NIAID, NIH) for the CD90.1 BALB/c mice; and Dr. Tom Wynn (NIAID, NIH) for his ongoing assistance with the S. mansoni infection model.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institute of Allergy and Infectious Diseases Division of Intramural Research. Back

2 Address correspondence and reprint requests to Dr. Kimberly D. Dyer, Laboratory of Allergic Diseases, National Institute of Allergy and Infectious Diseases/National Institutes of Health, 10 Center Drive, Building 10 Room 11C216, Bethesda, MD 20892-1883. E-mail address: kdyer{at}niaid.nih.gov Back

3 Abbreviations used in this paper: MBP, major basic protein; DAPI, 4', 6-diamidino-2-phenylindole dihydrochloride; EPO, eosinophil peroxidase; Fpr1, formyl peptide receptor 1. Back

Received for publication February 16, 2007. Accepted for publication May 14, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Humbles, A. A., C. M. Lloyd, S. J. McMillan, D. S. Friend, G. Xanthou, E. E. McKenna, S. Ghiran, N. P. Gerard, C. Yu, S. H. Orkin, C. Gerard. 2004. A critical role for eosinophils in allergic airways remodeling. Science 305: 1776-1779. [Abstract/Free Full Text]
  2. Lee, J. J., D. Dimina, M. P. Macias, S. I. Ochkur, M. P. McGarry, K. R. O’Neill, C. Protheroe, R. Pero, T. Nguyen, S. A. Cormier, et al 2004. Defining a link with asthma in mice congenitally deficient in eosinophils. Science 305: 1773-1776. [Abstract/Free Full Text]
  3. Swartz, J. M., K. D. Dyer, A. W. Cheever, T. Ramalingam, L. Pesnicak, J. B. Domachowske, J. J. Lee, N. A. Lee, P. S. Foster, T. A. Wynn, H. F. Rosenberg. 2006. Schistosoma mansoni infection in eosinophil lineage-ablated mice. Blood 108: 2420-2427. [Abstract/Free Full Text]
  4. Yu, C., A. B. Cantor, H. Yang, C. Browne, R. A. Wells, Y. Fujiwara, S. H. Orkin. 2002. Targeted deletion of a high-affinity GATA-binding site in the GATA-1 promoter leads to selective loss of the eosinophil lineage in vivo. J. Exp. Med. 195: 1387-1395. [Abstract/Free Full Text]
  5. Fujiwara, Y., C. P. Browne, K. Cunniff, S. C. Goff, S. H. Orkin. 1996. Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc. Natl. Acad. Sci. USA 93: 12355-12358. [Abstract/Free Full Text]
  6. Pevny, L., M. C. Simon, E. Robertson, W. H. Klein, S. F. Tsai, V. D’Agati, S. H. Orkin, F. Costantini. 1991. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349: 257-260. [Medline]
  7. Fulkerson, P. C., C. A. Fischetti, M. L. McBride, L. M. Hassman, S. P. Hogan, M. E. Rothenberg. 2006. A central regulatory role for eosinophils and the eotaxin/CCR3 axis in chronic experimental allergic airway inflammation. Proc. Natl. Acad. Sci. USA 103: 16418-16423. [Abstract/Free Full Text]
  8. Bystrom, J., K. D. Dyer, S. S. Ting-De Ravin, N. Naumann, D. A. Stephany, P. S. Foster, T. A. Wynn, H. F. Rosenberg. 2006. Interleukin-5 does not influence differential transcription of transmembrane and soluble isoforms of IL-5R {alpha} in vivo. Eur. J. Haematol. 77: 181-190. [Medline]
  9. Domachowske, J. B., C. A. Bonville, A. J. Easton, H. F. Rosenberg. 2002. Differential expression of proinflammatory cytokine genes in vivo in response to pathogenic and nonpathogenic pneumovirus infections. J. Infect. Dis. 186: 8-14. [Medline]
  10. Nitto, T., K. D. Dyer, M. Czapiga, H. F. Rosenberg. 2006. Evolution and function of leukocyte RNase A ribonucleases of the avian species, Gallus gallus. J. Biol. Chem. 281: 25622-25634. [Abstract/Free Full Text]
  11. Grimaldi, J. C., N. X. Yu, G. Grunig, B. W. Seymour, F. Cottrez, D. S. Robinson, N. Hosken, W. G. Ferlin, X. Wu, H. Soto, et al 1999. Depletion of eosinophils in mice through the use of antibodies specific for C-C chemokine receptor 3 (CCR3). J. Leukocyte Biol. 65: 846-853. [Abstract]
  12. Tateno, H., P. R. Crocker, J. C. Paulson. 2005. Mouse Siglec-F and human Siglec-8 are functionally convergent paralogs that are selectively expressed on eosinophils and recognize 6'-sulfo-sialyl Lewis X as a preferred glycan ligand. Glycobiology 15: 1125-1135. [Abstract/Free Full Text]
  13. Zhang, J. Q., B. Biedermann, L. Nitschke, P. R. Crocker. 2004. The murine inhibitory receptor mSiglec-E is expressed broadly on cells of the innate immune system whereas mSiglec-F is restricted to eosinophils. Eur. J. Immunol. 34: 1175-1184. [Medline]
  14. Her, E., J. Frazer, K. F. Austen, W. F. Owen, Jr. 1991. Eosinophil hematopoietins antagonize the programmed cell death of eosinophils: cytokine and glucocorticoid effects on eosinophils maintained by endothelial cell-conditioned medium. J. Clin. Invest. 88: 1982-1987. [Medline]
  15. Stern, M., L. Meagher, J. Savill, C. Haslett. 1992. Apoptosis in human eosinophils: programmed cell death in the eosinophil leads to phagocytosis by macrophages and is modulated by IL-5. J. Immunol. 148: 3543-3549. [Abstract]
  16. Yamaguchi, Y., T. Suda, S. Ohta, K. Tominaga, Y. Miura, T. Kasahara. 1991. Analysis of the survival of mature human eosinophils: interleukin-5 prevents apoptosis in mature human eosinophils. Blood 78: 2542-2547. [Abstract/Free Full Text]
  17. Ito, E., T. Toki, H. Ishihara, H. Ohtani, L. Gu, M. Yokoyama, J. D. Engel, M. Yamamoto. 1993. Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature 362: 466-468. [Medline]
  18. Nicolis, S., C. Bertini, A. Ronchi, S. Crotta, L. Lanfranco, E. Moroni, B. Giglioni, S. Ottolenghi. 1991. An erythroid specific enhancer upstream to the gene encoding the cell-type specific transcription factor GATA-1. Nucleic Acids Res. 19: 5285-5291. [Abstract/Free Full Text]
  19. Tsai, S. F., E. Strauss, S. H. Orkin. 1991. Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter. Genes Dev. 5: 919-931. [Abstract/Free Full Text]
  20. Seshasayee, D., J. N. Geiger, P. Gaines, D. M. Wojchowski. 2000. Intron 1 elements promote erythroid-specific GATA-1 gene expression. J. Biol. Chem. 275: 22969-22977. [Abstract/Free Full Text]
  21. Rothenberg, M. E., S. P. Hogan. 2006. The eosinophil. Annu. Rev. Immunol. 24: 147-174. [Medline]
  22. Dyer, K. D., H. F. Rosenberg. 2000. Shared features of transcription: mutational analysis of the eosinophil/basophil Charcot-Leyden crystal protein gene promoter. J. Leukocyte Biol. 67: 691-698. [Abstract]
  23. Gombart, A. F., S. H. Kwok, K. L. Anderson, Y. Yamaguchi, B. E. Torbett, H. P. Koeffler. 2003. Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBP {epsilon} and PU. 1. Blood 101: 3265-3273. [Abstract/Free Full Text]
  24. Handen, J. S., H. F. Rosenberg. 1997. Intronic enhancer activity of the eosinophil-derived neurotoxin (RNS2) and eosinophil cationic protein (RNS3) genes is mediated by an NFAT-1 consensus binding sequence. J. Biol. Chem. 272: 1665-1669. [Abstract/Free Full Text]
  25. Yamaguchi, Y., S. J. Ackerman, N. Minegishi, M. Takiguchi, M. Yamamoto, T. Suda. 1998. Mechanisms of transcription in eosinophils: GATA-1, but not GATA-2, transactivates the promoter of the eosinophil granule major basic protein gene. Blood 91: 3447-3458. [Abstract/Free Full Text]
  26. Ohneda, K., R. Shimizu, S. Nishimura, Y. Muraosa, S. Takahashi, J. D. Engel, M. Yamamoto. 2002. A minigene containing four discrete cis elements recapitulates GATA-1 gene expression in vivo. Genes Cells 7: 1243-1254. [Abstract]
  27. Trainor, C. D., J. G. Omichinski, T. L. Vandergon, A. M. Gronenborn, G. M. Clore, G. Felsenfeld. 1996. A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction. Mol. Cell Biol. 16: 2238-2247. [Abstract]
  28. Kitamura, Y., S. Go. 1979. Decreased production of mast cells in S1/S1d anemic mice. Blood 53: 492-497. [Free Full Text]
  29. Morii, E., K. Oboki, K. Ishihara, T. Jippo, T. Hirano, Y. Kitamura. 2004. Roles of MITF for development of mast cells in mice: effects on both precursors and tissue environments. Blood 104: 1656-1661. [Abstract/Free Full Text]
  30. Swartz, J. M., J. Bystrom, K. D. Dyer, T. Nitto, T. A. Wynn, H. F. Rosenberg. 2004. Plasminogen activator inhibitor-2 (PAI-2) in eosinophilic leukocytes. J. Leukocyte Biol. 76: 812-819. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Z. Qiu, K. D. Dyer, Z. Xie, M. Radinger, and H. F. Rosenberg
GATA Transcription Factors Regulate the Expression of the Human Eosinophil-derived Neurotoxin (RNase 2) Gene
J. Biol. Chem., May 8, 2009; 284(19): 13099 - 13109.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. D. Dyer, J. M. Moser, M. Czapiga, S. J. Siegel, C. M. Percopo, and H. F. Rosenberg
Functionally Competent Eosinophils Differentiated Ex Vivo in High Purity from Normal Mouse Bone Marrow
J. Immunol., September 15, 2008; 181(6): 4004 - 4009.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dyer, K. D.
Right arrow Articles by Rosenberg, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dyer, K. D.
Right arrow Articles by Rosenberg, H. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS