The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1659-1668
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Geraldes, P.
Right arrow Articles by Cascalho, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Geraldes, P.
Right arrow Articles by Cascalho, M.

Ig Heavy Chain Promotes Mature B Cell Survival in the Absence of Light Chain1

Pedro Geraldes*, Michelle Rebrovich*, Kai Herrmann, Jamie Wong||, Hans-Martin Jäck, Matthias Wabl|| and Marilia Cascalho2,*,{dagger},{ddagger}

* Transplantation Biology Program and Department of {dagger} Immunology, {ddagger} Deparment of Surgery, and § Department of Pediatrics, Mayo Clinic College of Medicine, Rochester, MN 55905; Division of Molecular Immunology, Nikolaus-Fiebiger Center, Friedrich-Alexander-University Erlangen-Nürnberg, Erlangen, Germany; and || Department of Microbiology and Immunology, University of California, San Francisco 94143


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Survival of mature B cells is thought to depend on the BCR signaling (BCR) because ablation of either H chain (HC) expression or BCR signaling causes B cells to rapidly disappear. Whether a complete BCR is required for survival of mature B cells is not known. To address this question, we generated a mouse in which we can repress the expression of a transgenic Ig L chain (IgL) by doxycycline (IgL-repressible mouse). Repression of IgL abrogated expression. Surprisingly, however, IgL-negative B cells survived longer than 14 wk, expressed signal-competent HC on the cell’s surface, and active unfolded protein response factors. Like postgerminal center B cells, IgL-negative B cells were small lymphocytes, not dividing and expressed Bcl-6. Our results indicate that expression of unpaired HC, as it may occur as a consequence of Ag ligation, somatic hypermutation, or receptor editing, facilitates the survival of cells either by inducing receptor signaling or by inducing unfolded protein response and/or the expression of survival genes such as Bcl-6.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The development and survival of mature B cells is thought to require stable expression of surface Ig (1) and expression of functional Ig{alpha}beta dimer (2). Lam et al. (1) and Kraus et al. (2) showed that repression of H chain (HC)3 and consequently of surface Ig expression causes death of mature B cells and inferred that survival depends on BCR signaling through the Ig{alpha}beta dimer, much as the TCR is required for T cell survival (3). Whether instead the HC itself might promote survival independently of the BCR was not formally considered. We sought to test this question.

Expression of membrane-bound HC drives early B cell differentiation even in the absence of a complete surrogate light (SL) chain and conventional L chains. This idea is supported by the studies of Schuh et al. (4), who found that a transgenic µHC reaches the cell surface in the absence of the SL chain component {lambda}5 and conventional L chains induce IL-7-dependent cell growth and promote in vivo differentiation of pro-B cells. Similarly, Galler et al. (5) showed that µHC signals terminate the expression of terminal deoxynucleotidyltransferase and down-regulate the expression of the RAG 1 and 2 in the absence of SL and L chains.

B cells of camels, sharks, and ratfish produce HCs that cannot pair with L chains (LCs) (6). In these species (6) and when expressed in mice (7), unpaired HCs appear to drive B cell development and contribute to HC-only Abs which make up to 75% of the serum Ig (6). Synthesis of HC-only Abs may depend on some HC unique features including VH FR2 domain adaptations and lack of a CH1 domain. These features antagonize binding to L chains and possibly to the chaperone Ig HC-binding protein (BiP) that retains unpaired HCs in the ER (6), thus enabling trafficking from the ER to the cell surface in the absence of LC. Synthesis of H chain-only Abs suggests that unpaired H chains may sustain B cell development and mature B cell survival.

In light of these properties of HC, we questioned whether murine HC expressed without L chain might sustain mature B cell survival. To test this concept, we generated a novel experimental system in mice: the IgL-repressible mouse. In the IgL-repressible mouse, expression of LC and surface BCR can be abrogated by feeding the mice doxycycline (DOX). Expression of HC remains unaffected in these mice. From the phenotype of the IgL-repressible mouse, we report here that, contrary to expectations, mature B cells survive repression of LC and that continued expression of HC alone drives long-term survival of B cells. We also report that HC is expressed on the surface of cells and can associate with Ig{alpha}beta dimers to yield a functional complex that promotes survival. In contrast to studies by Corcos et al. (8, 9) showing that truncated H chains that lack the VH exon are expressed unpaired on the surface of B cells, B cells of the IgL-repressible mouse express the full-length protein. Although truncated H chains do not sustain survival of B cells (9), our studies indicate that expression of full-length HC does. These findings may explain how some cells of B lineage (e.g., plasma cells or neoplastic B cells) survive with little or no surface Ig.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

The IgL-repressible mouse has monoclonal B and T cell compartments. Because the mice are on a RAG-1-negative background (RAG1–/–), no endogenous B or T cell Ag receptors are produced. Instead, T cells express the transgenic DO.11.10 beta{alpha}TCR (10, 11, 12), while B cell Ig is encoded by a combination of the knock-in µHC gene (VH17.2.25) (13) and a {lambda}LC transgene (14). The transgenic TCR is specific for an OVA peptide (OVA aa 323–339) and the combined transgenic knock-in BCR is specific for the hapten 4-hydroxy-3-nitrophenyl) acetyl and its derivatives (13). Expression of {lambda}LC is regulated by the availability of DOX. In the absence of DOX, a transactivator binds the minimal promoter and drives {lambda}LC expression (see Fig. 1A).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 1. {lambda}LC repression by DOX. A, Proposed model of {lambda}LC repression in IgL-repressible mice. Briefly: in the absence of DOX, the constitutively expressed transactivator (tTA) binds the tet promoter and drives expression of {lambda}LC; when DOX is present it binds the transactivator (tTA) and prevents it from binding to the tet promoter effectively abrogating {lambda}LC expression. The µHC continues to be expressed following DOX treatment and reaches the surface with Ig{alpha}beta. B, Western blot analysis of {lambda}LC expression. Splenocyte cell lysates were obtained from B6 or pooled IgL-repressible mice not fed or fed DOX, as indicated. Lysates were immunoprecipitated with goat anti-mouse {lambda}LC Ab and revealed with the same Ab on Western blots. Equal amounts of protein were loaded in each well (0.5 mg). C, RT-PCR analysis of {lambda}1LC and µHC mRNA obtained from total splenocytes of IgL-repressible mice fed or not fed DOX or from QM mice, as indicated. Shown is the absence of detectable {lambda}LC mRNA in DOX-treated mice. µHC and beta-actin were used to control the quantity and integrity of cDNA. cDNA obtained from 1 µg of RNA was PCR amplified from serial dilutions (1/1, 1/5, and 1/25) for 35 cycles. D, Flow cytometry analysis of Ca2+ influx measured in isolated B cells obtained from spleens of IgL-repressible mice treated or not treated with DOX, or from QM mice (as indicated). Histograms represent ratio of fluorescence intensities of Indo-1AM bound to Ca2+/free Indo-1 AM over time (s). Arrows, Time the stimulus was added. Ca2+ influx curves obtained following {lambda}LC cross-linking with goat anti-mouse {lambda}LC Ab are depicted in blue; curves obtained following addition or goat IgG control are depicted in red. LC-repressed B cells failed to generate Ca2+ influx following LC cross-linking (bottom diagram).

 
The LC gene was engineered using the tetracycline-inhibitable transactivator system (15). This system consists of a transactivator and a target {lambda}LC transgene. The transactivator or tTA (HSV VP16 fusion protein) is under the control of the mouse mammary tumor virus long terminal repeat promoter (MMTV-tTA) and is constitutively expressed. The MMTV-long terminal repeat targets the expression of tTA to lymphocytes and epithelial cells of the secretory organs (16, 17).

The transactivator (tTA) in the absence of tetracycline (or its derivate DOX) acts upon the {lambda}LC transgene minimal promoter (Pmin) promoting transcription. DOX binds the tTA, preventing it from binding Pmin (16, 17) and effectively repressing {lambda}LC expression.

Tetracycline-responsive {lambda}1 transgene

The repressible {lambda} construct puts the {lambda}LC gene under the control of a tetracycline and transactivator-responsive promoter (TetO). The {lambda} gene was obtained by the EcoR1 digest of the C2 plasmid (a gift from Dr. F. Young, University of Rochester, Rochester, NY; Ref. 14). This fragment contains the {lambda} endogenous promoter and the V{lambda}J{lambda} rearrangement linked to C{lambda} in a genomic configuration. The promoter region was subsequently excised by further digestion with SexA1, which cuts 15 bp upstream of the start codon ATG. The 5.8-kb fragment was then blunted and cloned at the PvuII site of the pBI-EGFP plasmid (catalog no. 6154-1; Clontech Laboratories). The final plasmid puts the {lambda} gene under the control of a TetO regulatory element linked to the hCMV minimal promoter. Because the {lambda} gene lacks an intronic enhancer and there is no 3' {lambda} enhancer in this construct, transcription depends on the binding of a transactivator to the TetO element. Enhanced GFP expression, which in the pBI-EGFP plasmid is under the control of a TetO regulatory element, was lost upon breeding the founder mice.

Generation of the IgL-repressible mouse by breeding

The {lambda}-repressible founders were mated to the MMTV-tTA mouse and to mice of the following genotype: RAG1–/–, VH T/VH T, and DO11 TCR, H-2d/d. The repressible Ig mice, obtained from the previous crossings, have the following phenotype: RAG1–/–, VH T/JH+, {lambda} ind, tTA, and DO11-TCR, H-2b/b. The studies discussed here were performed with mice derived from two independent founders.

Animal care and DOX treatment

All mice were between 1 and 3 mo of age and were kept in a specific pathogen-free facility at the Mayo Clinic. All animal experiments were conducted in accordance with protocols approved by the Mayo Clinic Institutional Animal Care and Use Committee. IgL-repressible mice were fed a DOX diet (grain based) (200 mg/kg (S3888; (Bio-Serv).

Genotyping

DNA was extracted from mouse tails according to standard protocols (13). Genotyping was done by PCR amplification of tail DNA with thermoprime plus DNA polymerase (ABgene) and 12 pmol of each primer for 40 cycles using an Icycler (Bio-Rad) thermocycler. H chain knock-in (VH17.2.25 DJH4) forward-5'AAGTTCAGCTGCAGCAGTCTGG 3'; reverse-5'GGGACAAATATCCAAGATTAGTC 3', 450 bp, melting temperature (Tm) 51°C; {lambda}1LC forward-5' GCCTTTCTACACTGCAGTGGGTATGCAACAAT 3'; reverse-5' AGCCACTYACCTAGGACAGTSASYTTGGTTCC 3', 500 bp, Tm 60°C; tetracycline transactivator (tTA) forward-5' AGAGAATGCATTATATGCACTCAGCG 3'; reverse-5' AGACCCGTAATTGTTTTTCGTACGCG 3', 280 bp, Tm 55°C; TCR Forward-5' CAGGAGGGATCCAGTGCCAGC 3'; reverse-5'TGGCTCTACAGTGAGTTTGGT, 300 bp, Tm 52°C; I-Ab forward-5' CATAGCCCCAAATGTCTGACCTCTGGAGAG 3'; reverse- 5' AGTCTTCCCAGCCTTCACACTCAGAGGTAC 3', 200 bp, Tm 60°C; and I-Ad forward-5' CATAGCCCCAAATGTCTGACCTCTGGAGAG 3', reverse-5' CATGGGCATAGAAAGGGCAGTCTTTGAACT 3', 200 bp, Tm 60°C.

Cell lines and culture conditions

Ag8.H cells were grown in complete RPMI (RPMI 1640 medium supplemented with 50 U/ml penicillin, 50 µg/ml streptomycin, 5% FCS, 1 mM sodium pyruvate, and 2 mM L-glutamine. Ag8.H-Ig{alpha} transfectants were selected in complete RPMI supplemented with 1 mg/ml G418 (PAA), whereas Ag8.H-Ig{alpha} expressing µHC was cultured in complete RPMI with 1 mg/ml G418, 1.25 µg/ml mycophenolic acid, 250 µg/ml xanthine, 100 µM hypoxanthine, and 16 µM thymidine. All cell lines were maintained at 37°C and 5% CO2 in a humidified incubator.

The Ag8.H-Ig{alpha} cell line was generated to analyze the cell surface transport of BCR complexes by transfection of Ag8.H, a subclone of the murine Ig-negative plasmacytoma cell line Ag8.653 (18). Murine Ig{alpha}, required for surface transport of BCR complexes (19), was amplified by PCR from cDNA of the murine lymphoma B cell line CH27 with an appropriate forward (TTGGATCCACGATGCCAGGGGGTCTAGA, containing a BamHI restriction site) and backward primer (TTGAATTCCAGTCATG GCTTTTCCAGCT, containing an EcoRI restriction site). The Ig{alpha} fragment was cloned into the BamHI and EcoRI site of the mammalian expression vector pEF1/myc-His (Invitrogen Life Technologies) and was transfected by electroporation (250 V, 960 µF; (20)). Subsequently, pµ.gpt encoding an IgL-pairing and functional µHC with the same VH17.2.25DJH4 variable exon of the HC expressed in the repressible Ig mouse (21) were transfected in Ag8.H-Ig{alpha} by electroporation. Stable cell clones were established by limiting dilution and analyzed by flow cytometry.

Flow cytometry

Organ cell suspensions were prepared by pushing the organ through 0.70-µm mesh (spleens and lymph nodes) or by passing the tissue repeatedly through a 27-gauge needle (bone marrow). White blood cells were isolated using a Ficoll-Plaque (GE Healthcare) gradient and cells were counted with a Coulter counter (Beckman Coulter). Surface staining of splenocytes was done as described previously (13); for intracytoplasmic staining, splenocytes were fixed in PBS supplemented with 2% paraformaldehyde at 4°C for 1 h and permeabilized in 1 ml of 0.2% Tween 20 in PBS and in 1 ml of 0.1% NaN3 with 2% FCS. For membrane staining of cultured cells, 5 x 105 cells were incubated for 30 min on ice in PBS supplemented with 2% FCS and 0.1% NaN3 with the appropriate amount of Abs. For cytoplasmic staining of cultured cells, 5 x 105 cells were fixed in 4% paraformaldehyde in PBS at room temperature (RT) for 10 min, permeabilized with 0.1% Tween20 at 37°C for 15 min, and stained at RT for 15 min with the appropriate amount of Abs. Data analyses were performed using a FACSCalibur (BD Biosciences) and CellQuest software (version 4.0.2).

Antibodies

Abs used were biotin-labeled, goat IgG directed against the murine IgM (H + L), purchased from Southern Biotechnology Associates and from BD Biosciences, allophycocyanin-labeled anti-mouse CD19 (1D3), biotin-labeled anti-mouse Ig, {lambda}, {lambda}2, and {lambda}3 LC (R26-46), R-PE-conjugated rat anti-mouse CD23 (Fc{epsilon}RII; B3B4) mAb, FITC-conjugated rat anti-mouse CD21/CD35 (CR2/CR1 and CD21a/CD21b) (7G6) mAb, FITC-conjugated rat anti-mouse CD24 (heat-stable Ag) (M1/69) mAb, biotin-conjugated mouse anti-mouse IgDa (Igh-5a, Igh-5.4; AMS 9.1) biotin-conjugated mouse anti-mouse IgDb (Igh-5b; 217-170) for B6 mice, and FITC-conjugated rat anti-mouse CD45R/B220 (RA3-6B2) mAb. Biotin-labeled Abs were detected with streptavidin-PE-Cy5 (BD Biosciences Pharmingen). Ki67 was detected with rat anti-mouse Ki67 (TEC-3; DakoCytomation) Ab in tissue sections.

Unconjugated affinity-purified goat Abs against mouse IgM (H + L) (Southern Biotechnology Associates) were labeled with the a Cy5-labeling kit from Amersham Biosciences. The monoclonal mouse IgG1, {kappa} Ab 24C2.5 against the intracellular tail of mouse Ig{alpha} was previously described (22).

TUNEL assay

The TUNEL assay was done with an apoptosis detection kit, ApopTag Red in Situ, according to the manufacturer’s instructions (Chemicon International).

Ca2+ influx

Ca2+ influx studies were performed by incubating splenocytes with 5 µM Indo-1 AM (Invitrogen Life Technologies) for 30 min at RT and then labeled with anti-CD19 and anti-B220 Abs for 30 min at 4°C. Cells were kept at 37°C for 2 min before adding unlabeled stimulus: polyclonal unlabeled goat anti-mouse IgM (H + L; 100 µg/ml), polyclonal unlabeled goat anti-mouse {lambda} ({lambda}-chain specific; 100 µg/ml), polyclonal unlabeled total goat anti-mouse IgG (100 µg/ml), all purchased from Southern Biotechnology Associates. Ionomycin was obtained from Calbiochem and Merck. Data were collected and analyzed on a cytometer (LSR II; BD Biosciences) with FlowJo software (Tree Star). The results are shown in an indo1-violet:indo1-blue ratio.

RT-PCR

RNA was extracted using a Qiagen RNeasy Kit (catalog no. 74104) according to the manufacturer’s instructions. The RNA yield was measured with the Nanodrop-no-1000 spectrophotometer (V3.0.1; Nanodrop Techologies). Reverse transcription was performed using an Invitrogen Life Technologies ThermoScript RT-PCR System (catalog no. 11146-016) according to the manufacturer’s instructions. The cDNA was amplified using the following primers: Pax-5 forward CTACAGGCTCCGTGACGCAG and Pax-5 reverse TCTCGGCCTGTGACAATAGG (annealing 65°C, 439 bp); VpreB forward GTCTGAATTCCTCCAGAGCCTAAGATCCC and VpreB reverse CAGGTCTAGAGCCATGGCCTGGACGTCTG (annealing 60°C, 400bp); {lambda}5 forward GGGTCTAGTGGATGGTGTCC and {lambda}5 reverse CAAAACTGGGGCTTAGATGG (annealing 60°C, 205 bp); VH forward GGGATATCCACACCAAACATC and VH reverse CATACACAGAGCAACTGGACA (annealing 50°C, 1785 bp); VH17.2.25 AGGTTCAGCTGCAGCAGTCTGG and VH1 Cmu GGTTCTGATACCCTGGATGACTTCAG (annealing 55 C, 500 bp); myc forward CAGCTCTGGAGTGAGAGGGGCTTT and myc reverse GTAAGTTCCAGTGAGAAGTGTCTG (annealing 59°C, 150bp); Ire1 forward AGAAGCTACCTGTTGGCCGTTGTA and Ire1 reverse CATCCTGGAAGAACTGGAGCTCCT (annealing 59°C, 150 bp); mChopRT3 TGCAGGGTCACATGCTTGGC and mChopRT2 GCCTGACCAGGGAGGTGGAG (annealing 54°C, 150 bp); Edem1 forward ATCCGAGTTCCAGAAGGCAGT and Edem1 reverse GCTTCCCAGAACCCTTATCGT (annealing 53°C, 150 bp); mBiPRT1 GATTCCAAGGAA CACTGTGGTA and mBiPRT3 CCAGTCAGATCAAATGTACCC (annealing 52°C, 150 bp); V{lambda}1 CTGCACTCACCACACCTGG and C{lambda}1 TACCTTCCAGTCCACTGTCACC (annealing 50°C, 437 bp); AID3 ATCTCAGACTGGGACCTGGAC and AID5 CCTTGCGGTCTTCACAGAAGT (annealing 53°C, 174 bp); Xbp1u forward AGCACTCAGACTATGTGCACCTCT and Xbp1s reverse GGACATTTGAAAAACATGACAGGG (annealing 58°C, 163 bp); Xbp1s forward TGCTGAGTCCGCAGCAGGTGCA and Xbp1s reverse GGACATTTGAAAAACATGACAGGG (annealing 58°C, 150 bp); BLIMP1 forward TGACTTTGTGGACAGAGGCCGAGT and BLIMP1 reverse CTGTTGTTGGCAGCATACTTGAAA (annealing 58°C, 150 bp); Bcl6 forward TGCAGGAAGTTCATCAAGGCCAGT and Bcl6 reverse TTCTCAGTGGCATATTGTTCTCCA (annealing 58°C, 150 bp); and beta-actin forward CCTAAGGCCAACCGTGAAAAG and beta-actin reverse TCTTCATGGTGCTAGGAGCCA (annealing 54°C, 600 bp).

Immunohistochemistry

The immunohistochemistry was performed essentially as described in João et al. (23). The primary Abs used were: unlabeled goat anti-mouse {lambda}LC and FITC-conjugated goat F(ab')2 anti-mouse IgM (H + L) were purchased from Southern Biotechnology Associates, alkaline phosphatase was purchased from Cappel, rat anti-mouse CD19 (1D3) was purchased from BD Biosciences Pharmingen, and rat anti-mouse CD180 (RP105; RP/14) was purchased from Serotec. The secondary/tertiary Abs used were: rhodamine-conjugated donkey F(ab') 2 anti-rat IgG (H + L) from Jackson ImmunoResearch Laboratories, FITC-conjugated rabbit F(ab') 2 anti-goat IgG from ICN Pharmaceuticals/Cappel, and FITC-conjugated goat F(ab') 2 anti-rabbit IgG from ICN Pharmaceuticals/Cappel. Slides were examined on a Leica DMRD fluorescence microscope. Digital images were obtained using a high-resolution charge-coupled device digital camera (SPOT II; Diagnostic Instruments) mounted to the microscope and SPOT II software.

Immunoprecipitation and Western blot analysis of splenocytes

Spleens were harvested and cell suspensions were prepared by pushing homogenates through a 70-µm nylon mesh. RBC where depleted using Ficoll-Paque (GE Healthcare). B cells were isolated using the MACS column (Miltenyi Biotec) and the B cell isolation kit (Miltenyi Biotec), yielding 3–10 x 106 cells/preparation. Protein concentration was determined using a BCA Protein Assay Kit (Pierce) as per the manufacturer’s instructions. When surface biotinylation was performed, 10 x 107 cells in 250 µl of PBS were incubated with 4 mg of Sulfo-NHS-LC-Biotin (Pierce) for 30 min at RT. Cells were washed with PBS supplemented with 100 mM glycine to quench and remove excess biotin. Cells were lysed in BEACH buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM EGTA, 15 mM MgCl, 60 mM beta-glycerophosphate, 1 mM DTT, 0.1 mM sodium vanadate, 0.1 mM NaF, 15 mM p-nitrophenyl phosphate, 1% Triton X-100, and 1 proteinase inhibitor tablet from Roche) for 30–45 min on ice. Cell lysate corresponding to 3–10 x 106 cells was centrifuged at 14,000 rpm at 4°C for 20 min and the supernatant was collected for analysis.

For immunoprecipitation, 35 µl of beads was coated with 1–5 µg of the appropriate Ab for 2 h at 4°C with agitation. Coated beads were incubated with the cell lysate obtained from 3 to10 x 106 cells, for 2 h at 4°C with agitation and after washing, extracted with 35 µl of 2x sample buffer at 100°C for 5 min. Samples were analyzed on a 10% SDS-PAGE and blotted onto a 0.45-µm Immobilon-P polyvinylidene difluoride membrane (Millipore). The membrane was blocked with 5% nonfat milk in PBS with Tween 20 for 45 min at RT. Blotted proteins were revealed with a primary Ab, incubated overnight at 4°C, followed by washing and a secondary Ab incubated for 45 min at RT. After washing with PBS, blots were developed using Lumiglo reagent purchased from Cell Signaling.

The primary Abs were HRP- or biotin-conjugated, affinity-purified goat anti-mouse IgM, human-absorbed (Southern Biotechnology Associates), rabbit IgG anti-mouse {lambda}LC (ICN0029) and goat anti-mouse IgG ({gamma}-chain specific; Southern Biotechnology Associates). The secondary reagents were HRP-conjugated protein A (Amersham Biosciences), HRP-conjugated anti-mouse Ig (H + L), and HRP-conjugated anti-goat Ig (Cell Signaling). Beads for immunoprecipitation were streptavidin immobilized on 4% beaded agarose (Sigma-Aldrich), protein A-agarose (Sigma-Aldrich), and protein G (Pharmacia).

Western blot analysis of cultured cells

One x 106 cells were washed in 2x PBS and lysed on ice for 30 min with NET buffer (150 mM NaCl, 1 mM sodium vanadate, 50 mM NaF, 0.5% Nonidet P-40, 1 mM PMSF, 5 mM EDTA, and 25 mM Tris-HCl (pH 7.4)). Solubilized cells were centrifuged (10.000 x g for 10 min at 4°C) and supernatants were analyzed by SDS-Page according to Laemmli et al. (24). Broad Range Marker (Bio-Rad) was used as molecular weight standard. Separated proteins were transferred overnight to nitrocellulose membranes (Schleicher & Schüll Microscience) in 25 mM Tris, 192 mM glycine, and 20% methanol at 4°C. Membranes were blocked with 5% nonfat milk in TBST (25 mM Tris-HCl, 150 mM NaCl, and 0.1% Tween20, pH 7.5) for 1 h. The blots were incubated with HRP-conjugated goat anti-mouse IgM (H + L) (Southern Biotechnology Associates) diluted 1/6000 for 1 h. Blots were washed four times for 10 min in TBST and developed with the ECL method.

ELISA

Spleens were harvested and cell suspensions were prepared by pushing homogenates through a 70-µm nylon mesh. RBC where depleted using Ficoll-Paque (GE Healthcare). B cells were isolated using the MACS column (Miltenyi Biotec) and the B cell isolation kit (Miltenyi Biotec). Briefly, 0.25 million B cells where lysed using Beach buffer. Serial dilutions of lysates were incubated overnight at 4°C in 96-well flat-bottom microtiter plates (Nunc-Immuno 96 Micro well, MaxiSorp; eBioscience) coated with 2 µg/ml unlabeled goat anti-mouse {lambda} (Southern Biotechnology Associates) and blocked with PBS supplemented with 0.1% gelatin and 0.1% Tween 20. {lambda}LC was revealed with HRP-conjugated goat anti-mouse {lambda} (Southern Biotechnology Associates) and developed with ABTS. Plates were read at 405 nm at 5, 10, and 20 min on a microplater reader (Power Wave X; Bio-Tek Instruments) and analyzed using the software KC4-Kineticalc for Windows.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The IgL-repressible mouse

The IgL-repressible mouse is bred onto a RAG1-negative background (RAG1–/–). B cells in this mouse express a monoclonal BCR consisting of a constitutively expressed knock-in µHC (VH17.2.25) (13) and of a DOX-repressible {lambda}LC transgene (14). Expression of the {lambda}1LC transgene is driven by the binding of a tetracycline-controllable transcription factor (tTA) to the minimal Tet promoter (Pmin) (15, 16, 17). The activity of the tTA can be abolished by the addition of tetracycline or its derivative DOX (Fig. 1A). Because the tTA gene is under the control of the mouse mammary tumor virus long terminal repeat promoter (mouse mammary tumor virus promoter-driven-tTA (MMTV-tTA)), the expression of tTA is constitutive and targeted to lymphocytes and epithelial cells of the secretory organs (16, 17). The transgenic BCR is specific for the hapten 4-hydroxy-3-nitrophenyl acetyl and its derivatives (13). T cells in the IgL-repressible mouse are also monoclonal and express the DO.11 10 {alpha}beta TCR (11).

DOX treatment represses LC production

We first determined whether administration of DOX to the IgL-repressible mouse inhibits expression of {lambda}LC. {lambda}LC protein could not be detected by Western blot analysis of splenocytes isolated from mice that were fed DOX for 4 wk (Fig. 1B, lane 3). ELISA of homogenates (including cytoplasmic and membrane-bound protein) obtained from purified B cells confirmed the absence of {lambda}LC in DOX-treated IgL-repressible mice. ELISA limit of detection of {lambda}LC was 2 ng/ml. When all B cells expressed {lambda}LC (in the QM mice), we measured 64.6 ng/ml or 23 ng/million B cells. We detected only 5.5 ng {lambda}LC/ml in control B6 B cells, corresponding to 8.5% of the QM values, which is in line with the fact that only 5–10% of B cells in B6 mice express {lambda}LC.

Repressible Ig mouse B cells can only express {lambda}LC. In the absence of DOX, we detected 19.0 ng {lambda}LC/ml or 1.5 ng {lambda}LC/million B cells, indicating that B cells in the repressible Ig mouse produce 15-fold less {lambda}LC than QM B cells. The assay could not detect {lambda}LC above background in as many as 0.5 x 105 B cells obtained from a repressible Ig mouse following DOX treatment. This result indicated that DOX-treated repressible Ig B cells produced at least 32-fold less {lambda}LC as QM B cells and had at least 3-fold less {lambda}LC than non-DOX-treated repressible Ig B cells.

To determine the extent of transcription repression of the {lambda}LC gene in mice fed DOX, we performed RT-PCR with primers that were specific for cDNA. We failed to detect LC mRNA (Fig. 1C).

To determine whether repression of {lambda}LC protein expression effectively abrogated LC function as part of the BCR, we compared changes in the level of intracellular-free Ca2+ in B cells stimulated with anti-{lambda}LC Ab. Although B cells from IgL-repressible mice not treated with DOX responded to anti-{lambda}LC Ab by quickly increasing the intracellular Ca2+ (Fig. 1D, blue line), B cells from mice treated with DOX did not (Fig. 1D, red line). These results indicate that DOX treatment generated B cells functionally lacking LC, which we will refer to as "LC-negative B cells."

B cells survive and continue to express membrane-bound µHC upon LC repression

Expression of surface BCR is thought to require the correct assembly of H and L chains. Hence, we questioned whether repression of LC affects surface µHC expression on splenic B cells isolated from DOX-treated mice. As expected from the analysis of {lambda}LC expression by Western Blot analysis, we detected surface {lambda}LC on all CD19-positive splenocytes from mice not fed DOX (Fig. 2A, first row), but not from mice fed DOX. Only ~5% of B6 splenocytes expressed {lambda}LC (Fig. 2A, first row, diagram on right). However, despite the complete repression of LC expression in mice fed DOX, we detected µHC in the cytoplasm as well as on the surface of B cells (Fig. 2A, second and third rows). Surface µHC was reduced by 10-fold in B cells that lack LC (Fig. 2A, second row), but cytoplasmic µHC was not.


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 2. B cells survive {lambda}LC repression and express µHC. A, Flow cytometric analysis of splenocytes from IgL-repressible mice fed or not fed DOX and B6 control, as indicated. Left column, The lymphocyte gate on the light scatter plot used in the analysis. The three columns to the right represent the fluorescence intensity plots of lymphocyte-gated events stained with labeled Abs, as indicated. Surface and cytoplasmic µHC were detected with a goat anti-mouse IgM (H + L), all other Abs were rat anti-mouse mAbs. Mature (MB) and immature (IB) B cells were identified in fluorescence intensity plots shown in row 4 obtained from lymphocyte and CD19-positive gated events. Marginal zone (MZ) and follicular (FO) B cells (row 5) were identified in fluorescence intensity plots shown in row 5 obtained from lymphocyte and B220-positive gated events. This figure shows that {lambda}LC-positive, surface CD19-positive B cells disappear in mice treated with DOX but CD19-positive, {lambda}LC-negative cells survive (upper row) expressing both surface (row 2) and cytoplasmic (row 3) µHC. Immature and marginal zone B cells are absent in DOX-treated IgL-repressible mice. Only ~5% of CD19-positive B cells in B6 mice are {lambda}LC positive. B, Frozen sections obtained from spleen of IgL-repressible mice fed (right) or not fed (left) DOX. Sections were costained with anti-{lambda} (FITC-conjugated; row 2) and anti-CD180 Abs (rhodamine-conjugated; row 3). Sections shown in the row 4 were stained with an anti-CD19 Ab (FITC-conjugated) and in row 5 with an anti-IgM (H + L) Ab (FITC-conjugated), as indicated. All sections were also stained with 4',6'-diamidino-2-phenylindole (DAPI) to identify nuclei as shown in row 1. Figure shows that {lambda}LC expression is abrogated by DOX and that surviving B cells that lack {lambda}LC express CD180, CD19, and µHC. C, RT-PCR analysis of Pax-5, VpreB, and {lambda}5 mRNA in splenocytes obtained from IgL-repressible mice fed or not fed DOX, as indicated. Pax-5 expression marks B cell lineage, whereas the absence of both VpreB and {lambda}5 expression rules out pre-B cells. PCR was done with 1/1, 1/5, and 1/25 cDNA dilutions. D, Analysis of µHC expression in Ag8.H clones by Western blot. Ag8.H cell lines where transfected with a construct expressing Ig{alpha} and another construct expressing the µHC VH17.2.25, the HC in the repressible IgL mouse that pairs with Ig{alpha}. The mature B cell line NYC served as positive control for H chain expression. E, Flow cytometry analysis of µHC VH17.2.25 surface and cytoplasmic expression in Ag8.H clones. Intracellular and membrane expression of Ig{alpha}, and µHC in Ag8.H clones. Untransfected Ag8.H-Ig{alpha} served as negative staining control (open histogram). Left column, Stable Ag8.H transfectants were cytoplasmic stained with 24C2.5 Abs against the intracellular tail of mouse Ig{alpha}, FITC-conjugated Abs against mouse Fc{gamma} served as secondary Abs (filled histogram). Right columns, Stable Ag8.H transfectants producing VH17.2.25 µHC were cytoplasmic or membrane stained with Cy5-conjugated Abs against mouse µHC (gray histograms). Figure shows that µHC VH17.2.25 is expressed on the surface. Results shown are representative of three independent experiments. SSC, Side scatter.

 
The presence of cells with markers characteristic of B cells (CD180, CD19, and µHC) could be verified in the absence of LC in histological sections of spleen obtained from IgL-repressible mice fed DOX (Fig. 2B). These data show that LC-negative cells express CD180, CD19, and µHC, indicating that B cells survived repression of LC. To determine which subsets of B cells survived repression of LC, we distinguished mature (CD19+CD24lowIgDhigh), immature (CD19+CD24highIgDlow), marginal zone (B220+CD21highCD23low), or follicular B cells (B220+CD21lowCD23high) by flow cytometry analysis of splenocytes obtained from IgL-repressible mice fed or not DOX. Fig. 2A, fourth row, shows that immature B cells and marginal zone B cells disappeared following LC repression. The surviving B cells included follicular B cells, the numbers of which decreased from 1.4 million to 0.3 million 4 wk after LC repression.

Pre-B cells that express HC do so in conjunction with surrogate LC (25). The surrogate LC is composed of {lambda}5 and V pre-B proteins, and these along with HC form the pre-BCR that reaches the cell surface (25, 26). Because the pre-BCR is thought to sustain survival of pre-B cells (27), we asked whether B cells surviving repression of LC express a pre-BCR. Fig. 2C shows that mRNA for the surrogate L chain components VpreB and {lambda}5 was absent in peripheral LC-positive as well as in LC-negative B cells. These results were corroborated by flow cytometry using Abs specific for pre-BCR components (data not shown) and indicate that surface LC-negative B cells were not pre-B cells. Because surviving B cells expressed CD19 and the Pax-5 transcription factor (Fig. 2C), and plasma cells do not (28), our results also indicate that LC-negative B cells were not terminally differentiated.

To confirm that the transgenic VH17.2.25 chain reaches the cell surface in the absence of IgL chains, we transfected SL and L chain-negative Ag8.653 first with a gene encoding Ig{alpha} and then with a vector encoding the µH chain (VH17.2.25-µHC) identical to the one expressed in the IgL-repressible mouse (Fig. 2D). Fig. 2E shows that the VH17.2.25-µHC is transported to the surface of cells in the absence of LC.

Surface LC-negative B cells are long-lived

The survival of pre-B cells and the survival of mature B cells is thought to depend on expression of a surface receptor (1, 29). Lam and colleagues (1) and Kraus and colleagues (2) found that repression of HC abolishes the expression of a complete BCR and causes death of B cells. Whether B cells die because of the absence of surface BCR or to the absence of HC on its own was not determined. In contrast, repression of LC in the IgL-repressible mouse abolishes the assembly of a complete BCR but allows surface µHC expression. To determine how long LC-negative B cells expressing neither complete BCR nor pre-BCR survive, we enumerated B cells in the spleen and in the peripheral blood of mice at different times following LC repression. The number of B cells in the spleen decreased 5- to 6-fold (from 2.4 to 0.4 million) 4 wk after LC repression but it remained constant thereafter. The decrease in the number of B cells in the spleen was not observed in the peripheral blood. Fig. 3A shows that the number of CD19-positive B cells in the blood remained constant for up to 14 wk after the start of the DOX treatment. Long-lived B cells expressed bcl-6, blimp-1, and activation-induced cytidine deaminase (aid) and did not express c-myc mRNAs, consistent with a noncycling, postgerminal center phenotype (Fig. 3B). Expression of aid and blimp-1 suggests the possibility that these factors are needed to establish or maintain survival of B cells in a nonterminally differentiated state.


Figure 3
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 3. LC-negative B cells are long-lived. A, CD19-positive B cells survive up to 14 wk following the start of DOX treatment and repression of {lambda}LC as their number remains constant in the peripheral blood of IgL-repressible mice. Cells were enumerated by Coulter counting and flow cytometry analysis of PBL with rat mAb anti-mouse CD19 allophycocyanin labeled. Figure shows the average number of CD19-positive B cells obtained from six different mice treated with DOX and one untreated mouse analyzed at each time point. B, RT-PCR analysis of mRNA obtained from CD19-positive B cells isolated by MACS purification from pooled spleens of six repressible IgL mice fed or not fed DOX for 2 wk. Surviving B cells express bcl-6, blimp-1, and aid and do not express c-myc mRNAs consistent with a noncycling, postgerminal center phenotype. To control for DNA contamination of RNA samples, non-reverse-transcribed B6 mRNA was PCR amplified (lane –). C, {lambda}LC repression abrogates de novo B cell production in the bone marrow of repressible Ig mice. Flow cytometry analysis of splenocytes obtained from IgL-repressible mice generated and maintained with (right) or without (left) DOX for two generations. Splenocytes were stained with rat anti-mouse mAbs directed to CD19 or {lambda}1, {lambda}2, and {lambda}3. D, Spleen sections of IgL-repressible mice fed (right) or not fed (left) DOX, and B6 controls were costained with anti-Ki67 (FITC conjugated) and anti-IgM (H + L) Abs (rhodamine conjugated), as noted (original magnification, x100). Surface Ig-negative B cells do not stain with anti-Ki67 Ab and thus are not dividing. E, Spleen sections of IgL-repressible mice fed (right) or not fed (left) DOX as well as B6 controls were costained with TUNEL Ab (rhodamine conjugated) and anti-CD19 Ab (FITC conjugated), as noted (original magnification, x100). {lambda}1LC-negative B cells are TUNEL negative and thus not undergoing apoptosis. Results shown are representative of three independent experiments.

 
Several factors could contribute to the maintenance of peripheral CD19-positive surface LC-negative cells: de novo production of B cells or proliferation in equilibrium with cell death and/or long life. To determine whether repression of LC completely eliminates de novo production of B cells in the bone marrow, IgL-repressible mice were treated with DOX for two generations (to exclude transfer of maternal B cells to the fetus), after which B cells in the periphery were sought. Flow cytometry analysis of splenocytes of IgL-repressible mice treated in this way revealed no B cells in the periphery (Fig. 3C, right panel). This result indicates that B cells are not produced de novo when production of {lambda} is repressed.

It is possible that B cells surviving repression of LC are the progeny of rare B cells that proliferated to maintain the B cell compartment. To test this idea, we analyzed spleen sections costained with anti-Ki67 (a cell division marker). Fig. 3D shows that no µHC-positive cells express Ki67, and hence CD19-positive B cells were not proliferating to any great extent following repression of LC. Consistent with this concept, TUNEL analysis shows that splenocytes of mice treated with DOX for 4 wk were not undergoing apoptosis (as might be expected in rapidly proliferating populations of cells; Fig. 3E). These results show that repression of LC expression did not cause enhanced turnover of B cells and therefore the maintenance of surface LC-negative B cells must be due to long life.

HC expressed on the surface of cells is full length and signals

Our results indicate that surviving surface LC-negative B cells continue to produce µHC and suggest the possibility that µHC expression in the absence of LC functions as a receptor. Because unpaired full-length µHCs are thought to be retained in the ER (22), we asked whether µHC expressed on the surface was full length. Western blot analysis of cellular and surface µHC separated by SDS-PAGE shows that LC-negative B cells expressed predominantly the full-length µHC on the surface (Fig. 4A, lane 5). In addition to the full-length protein, splenocytes from repressible IgL mice also produced a lower molecular mass band, visible in lanes 3–6 of Fig. 4A, migrating with an approximate molecular mass of ~50 kDa. The 50-kDa molecular mass band could correspond to IgG or alternatively a truncated HC, as has been described in some B cell malignancies (31). Fig. 4B shows that the 50-kDa molecular mass bands are not IgG because they fail to be detected with an Ab directed against IgG.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 4. Full-length µHC is expressed on the cell surface and signals. A, Western blot analysis of surface and cytoplasmic µHC in B cells isolated from spleens of IgL-repressible mice fed (right) or not fed (left) DOX or from B6 controls. Protein lysates obtained from isolated B cells were surface biotinylated and immunoprecipitated (with streptavidin beads). Biotinylated samples (surface) and nonbiotinylated samples (cytoplasm) were analyzed by 10% SDS-PAGE, blotted, and revealed with goat anti-mouse IgM (H + L) Ab. Figure shows that the full-length µHC is expressed on the surface of LC-negative B cells. Approximate molecular mass (m.w.) is noted on the right. B, Western blot analysis of IgG and IgM in B cells isolated from spleens of IgL-repressible mice fed or not fed DOX or from B6 controls. Samples were analyzed by 10% SDS-PAGE and blotted. Blotted proteins were revealed with a goat anti-mouse IgM (H + L) or goat anti-mouse IgG Abs as indicated. Western blot shows that the 50-kDa molecular mass bands detected by the anti-IgM (H + L) Ab are not IgG because they fail to be detected with an Ab directed against IgG. Approximate molecular mass (m.w.) is noted on the right. 4, RT-PCR analysis of the length of the µHC mRNA obtained from splenocytes of IgL-repressible mice fed or not fed DOX, as indicated. Figure shows that the mRNA is full length, i.e., it does not contain deletions in the V or C exons. Below is shown a schematic representation of the RT-PCR primer sites respective to the µHC mRNA. In brief, 1/1, 1/5, and 1/25 dilutions of the cDNA were used. D, Flow cytometry analysis of Ca2+ influx in isolated B cells obtained from the spleen of QM or from IgL-repressible mice fed or not fed DOX for 4 wk. Histograms represent the ratio of violet:blue fluorescence intensities (Indo- bound to Ca2+/unbound Indo-1) over time. The cells were stimulated with either goat anti-mouse IgM (H + L) Ab (blue), with goat anti-mouse {lambda} Ab (green), or with control Ab goat IgG (red) added at 2 min after the start (indicated by the arrow). Cross-linking of surface µHC but not {lambda}LC causes a modest Ca2+ influx by LC-negative B cells (lower panel). Results are representative of four independent experiments.

 
To determine whether the 50-kDa band resulted from a truncated H chain, lacking CH1 or the VH exon, we analyzed HC gene expression by RT-PCR. Fig. 4C shows that repressible Ig splenocytes express only the full-length RNA with no evidence of deletions in the variable or constant region exons (Fig. 4C), indicating that the 50-kDa molecular mass band apparent in lanes 3–6 of Fig. 4A, is likely a degradation product. The decrease in LC-repressed splenocytes in µHC mRNA, apparent in Fig. 4C, is attributable to the fact that LC-repressed mice have 5- to 6-fold fewer B cells compared with LC-expressing mice. Our results indicate the possibility that limited L chain availability renders the monoclonal VH17.2.25 µHC more susceptible to proteolysis compared with the polyclonal µHC population in B6.

The surface expression of unpaired µHC suggested the possibility that HC alone delivers B cell survival signals. To answer this question, we compared changes in the level of intracellular free Ca2+ in B cells stimulated with anti-IgM, whole Ab, or F(ab')2. Naive QM B cells and surface LC-positive B cells from repressible IgL mice responded to IgM cross-linking by quickly increasing the intracellular Ca2+ (Fig. 4D, upper and medium panels, blue line). Changes in the level of intracellular-free Ca2+ in QM or surface LC-positive B cells stimulated with anti-IgM had similar kinetics as those following stimulation with anti-Ig{lambda} LC (Fig. 4D, green lines). In contrast, surface LC-negative B cells responded to IgM cross-linking with a modest increase in the intracellular Ca2+ originating a lower amplitude and somewhat retarded peak when compared with {lambda}LC-positive B cells or QM B cells (Fig. 4D, lower panel, blue line). The amplitude of the Ca2+ peak in response to IgM cross-linking on the surface LC-negative B cells was reduced relative to wild-type B cells, possibly due to decreased surface receptor density. Cross-linking IgL on surface LC-negative B cells originated no response (Fig. 4D, lower panel, green line). These results indicate that unpaired µHC generates signals.

Unpaired HC in the cytoplasm triggers receptor-independent responses

Because in the absence of LC, HC is retained in the ER by BiP (32), we investigated whether LC-negative B cells activated a stress response called the unfolded protein response (UPR). We tested activation of several UPR transducers. Activated inositol-requiring enzyme endoribonuclease (33) excises 26 bp from the X-box-binding protein 1 (XBP-1) mRNA to form XBP-1 spliced (s). Activation of activating transcription factor 6, another UPR transducer, induces the transcription of xbp-1 and ER chaperone genes; eukaryotic translation initiation factor a, subunit {alpha} kinase (PERK) activation, transiently inhibits cap-dependent protein synthesis and induces C/EBP homologous protein (Chop). Fig. 5 shows that LC-negative B cells express the spliced (s) and unspliced (u) xbp-1 messages and have increased levels of BiP mRNAs consistent with inositol-requiring enzyme 1{alpha} and activating transcription factor 6 activation. Chop expression is consistent with PERK activation. These results indicate activation of all three UPR transducers and suggest the possibility that the UPR may contribute to the {lambda}LC-negative B cells’ long life.


Figure 5
View larger version (86K):
[in this window]
[in a new window]

 
FIGURE 5. LC-negative B cells have active UPR. RT-PCR analysis of UPR genes. mRNA obtained from CD19-positive B cells isolated by MACS purification from pooled spleens of six repressible IgL mice fed or not fed DOX for 2 wk. mRNA from adult B6 mice was used as a control. To control for DNA contamination of RNA samples, non-reverse-transcribed B6 mRNA was PCR amplified (lane –).

 
We also tested whether several UPR gene mRNAs were produced in SL and L chain-negative, Ig{alpha}-positive Ag8.653 expressing or not the transgenic VH17.2.25 chain. Our results (data not shown), indicate that ire1, xbp-1, spliced and unspliced, chop, and edem1 were equally expressed independently of the transgenic VH17.2.25 chain. These results indicate that in transformed cells activation of the UPR occurs independently of H chain expression. These results do not contradict the possibility that accumulation of HC in the ER triggers the UPR in mature B cells independently of BCR stimulation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The property of memory that uniquely distinguishes adaptive immunity in host defense requires long-term survival of B cells after first exposure to Ag. How long-term survival is achieved is not completely understood but is thought to depend on surface expression of the Ag receptors. Thus, survival of T cells depends on engagement of the TCR with self-MHC plus self-peptide, assuring that only functional T cells live (3). In contrast to T cells, B cells recognize novel structures that are cleared from the organism. Thus, survival of mature B cells is thought to require a mature BCR (1, 2, 34), even though the necessity of a generic self-ligand has not yet been resolved.

As one possibility, BCR may promote B cell survival by signaling constitutively. This idea is supported by the work of Lam et al. (1) and Kraus et al. (2), who showed that ablation of HC or Ig{alpha} signaling in mature B cells led to rapid cell death (in days). However, survival of B cells without BCR is not without precedent because BCR-less B cells expressing an EBV receptor instead of BCR survive in vitro and in vivo (35). Because EBV receptor-expressing B cells appear to activate tyrosine phosphorylation of BCR targets, Casola et al. (35) propose that BCR signaling is necessary for the survival of B cells.

In this study, we report that survival of mature B cells does not require the complete BCR but rather the mere production of unpaired HC suffices to assure B cell survival. In LC-negative B cells, µHC can be expressed on the surface. Because surface µHC cross-linking induces a modest calcium influx, we concluded that µHC can signal. Signaling by unpaired surface µHC may be one mechanism promoting mature B cell survival. Our results showing long-term survival of B cells expressing HC unpaired with LC support the concept that a B cell autonomous mechanism governs B cell longevity in the absence of a complete BCR.

Functional Abs lacking L chains are produced by B cells in camels (36), nurse sharks, wobbegong sharks (37), and in ratfish (38), indicating that in these species B cells develop and persist in the absence of a conventional BCR. Moreover, expression of dromedary HC-only Abs in the mouse sustains B cell development (7, 39).

HC-only Abs in camels possess molecular adaptations, such as the loss of the CH1 domain, to avoid interaction with L chains and binding to BiP, thus escaping retention in the ER (6, 40). Truncated H chains have also been associated with disease in mice and in humans causing myeloma (41) or H chain disease (8, 42, 43), respectively. H chain disease-associated µ proteins lacking the rearranged VDJ exon ({Delta}µHC) produce unpaired HC receptors that are signaling competent. Corcos et al. (8, 42) found that expression of {Delta}µHC promotes B cell differentiation in the bone marrow and in the periphery. However, mature B cells expressing {Delta}µHC are larger and have shorter half-lives than wild-type B cells (9, 44). This is despite the fact that {Delta}µHCs overcome BiP-mediated ER retention and are expressed on the surface (9). Because the HC produced by the IgL-repressible mouse is not truncated, our results indicate that when the availability of the L chain is limited, full-length H chains may escape ER trapping and form signaling competent receptors. Those may be important to promote survival of cells that lose LC expression due to somatic hypermutation or receptor editing.

That unpaired full-length µHC mediates some of the BCR functions was determined by Schuh et al. (4) and Galler et al. (5) who found that wild-type full-length µHC unbound to LC is expressed on the surface, promotes in vivo differentiation of pro-B cells (4), and induces IL-7-dependent growth (4) and signals, causing decreased RAG gene expression and allelic exclusion at the HC locus (4). It is possible that expression of unpaired full-length HC contributes to the survival of human B cells lacking the conventional BCR in normal subjects (45). Expression of unpaired full-length HC may also contribute to the development of B cell malignancies by increasing the probability of survival of cells undergoing illegitimate DNA recombination or extensive DNA breaks.

Expression of a BCR that is signaling competent does not by itself assure long life because immature B cells that are recent bone marrow emigrants have a very short life span (days) (46). Thus, other mechanisms in addition to receptor-generated signaling are necessary. Our results showing expression of unpaired µHC in the cytoplasm of LC-negative B cells suggest the possibility that cytoplasmic µHC contributes to the survival of mature B cells. Perhaps the HC-only cells that survive repression of LC do so because of persistent UPR initiated before repression of LC and accumulation of HC in the ER as described following cytokine and LPS stimulation of B cells (47, 48). However, in contrast to LPS-activated blasts, HC-only cells do generate long-lived B cells, suggesting that accumulation of HC in the ER may govern cell survival in addition to inducing terminal differentiation.


    Acknowledgments
 
We thank Dr. Jeffrey L. Platt for enthusiastic support, Karen Lien for technical assistance and Charles A. Cascalho for helpful comments.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AI48602, AI61100, AI53733, AI41570, and HL79067. This work was also supported by the Interdisciplinary Center for Clinical Research and the Deutsche Forschungsgemeinschaft (SFB 466 and FOR 832 research grant JA 96814) to H.-M.J. and the training grant GRK592 from the Deutsche Forschungsgemeinschaft to K.H. Back

2 Address correspondence and reprint requests to Dr. Marilia Cascalho, Mayo Clinic, 200 First Street SW, Medical Sciences 2-75, Rochester, MN 55905. E-mail address: cascalho.marilia{at}mayo.edu Back

3 Abbreviations used in this paper: HC, H chain; LC, L chain; SL, surrogate L; BiP, H chain-binding protein; ER, endoplasmic reticulum; tTA, tetracycline transactivator; MMTV-tTA, mouse mammary tumor virus tTA; Pmin, minimal promoter; TetO, transactivator-responsive promoter; Tm, melting temperature; RT, room temperature; DOX, doxycycline; aid/AID, activation-induced cytidine deaminase; UPR, unfolded protein response; Chop/chop, C/EBP homologous protein. Back

Received for publication July 28, 2006. Accepted for publication May 14, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Lam, K. P., R. Kuhn, K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90: 1073-1083. [Medline]
  2. Kraus, M., M. B. Alimzhanov, N. Rajewsky, K. Rajewsky. 2004. Survival of resting mature B lymphocytes depends on BCR signaling via the Ig{alpha}/beta heterodimer. Cell 117: 787-800. [Medline]
  3. Anderson, G., K. J. Hare, E. J. Jenkinson. 1999. Positive selection of thymocytes: the long and winding road. Immunol. Today 20: 463-468. [Medline]
  4. Schuh, W., S. Meister, E. Roth, H. M. Jack. 2003. Cutting edge: signaling and cell surface expression of a µ H chain in the absence of {lambda}5: a paradigm revisited. J. Immunol. 171: 3343-3347. [Abstract/Free Full Text]
  5. Galler, G. R., C. Mundt, M. Parker, R. Pelanda, I. L. Martensson, T. H. Winkler. 2004. Surface µ heavy chain signals down-regulation of the VDJ-recombinase machinery in the absence of surrogate light chain components. J. Exp. Med. 199: 1523-1532. [Abstract/Free Full Text]
  6. Conrath, K. E., U. Wernery, S. Muyldermans, V. K. Nguyen. 2003. Emergence and evolution of functional heavy-chain antibodies in Camelidae. Dev. Comp. Immunol. 27: 87-103. [Medline]
  7. Zou, X., J. A. Smith, V. K. Nguyen, L. Ren, K. Luyten, S. Muyldermans, M. Bruggemann. 2005. Expression of a dromedary heavy chain-only antibody and B cell development in the mouse. J. Immunol. 175: 3769-3779. [Abstract/Free Full Text]
  8. Corcos, D., A. Iglesias, O. Dunda, D. Bucchini, J. Jami. 1991. Allelic exclusion in transgenic mice expressing a heavy chain disease-like human µ protein. Eur. J. Immunol. 21: 2711-2716. [Medline]
  9. Corcos, D., A. Grandien, A. Vazquez, O. Dunda, P. Lores, D. Bucchini. 2001. Expression of a V region-less B cell receptor confers a tolerance-like phenotype on transgenic B cells. J. Immunol. 166: 3083-3089. [Abstract/Free Full Text]
  10. Loh, D. Y., A. L. Bothwell, M. E. White-Scharf, T. Imanishi-Kari, D. Baltimore. 1983. Molecular basis of a mouse strain-specific anti-hapten response. Cell 33: 85-93. [Medline]
  11. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250: 1720-1723. [Abstract/Free Full Text]
  12. Liu, C. P., J. W. Kappler, P. Marrack. 1996. Thymocytes can become mature T cells without passing through the CD4+ CD8+, double-positive stage. J. Exp. Med. 184: 1619-1630. [Abstract/Free Full Text]
  13. Cascalho, M., A. Ma, S. Lee, L. Masat, M. Wabl. 1996. A quasi-monoclonal mouse. Science 272: 1649-1652. [Abstract]
  14. Young, F., B. Ardman, Y. Shinkai, R. Lansford, T. K. Blackwell, M. Mendelsohn, A. Rolink, F. Melchers, F. W. Alt. 1994. Influence of immunoglobulin heavy- and light-chain expression on B-cell differentiation. Genes Dev. 8: 1043-1057. [Abstract/Free Full Text]
  15. Gossen, M., H. Bujard. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89: 5547-5551. [Abstract/Free Full Text]
  16. Hennighausen, L., R. J. Wall, U. Tillmann, M. Li, P. A. Furth. 1995. Conditional gene expression in secretory tissues and skin of transgenic mice using the MMTV-LTR and the tetracycline responsive system. J. Cell. Biochem. 59: 463-472. [Medline]
  17. Redfern, C. H., P. Coward, M. Y. Degtyarev, E. K. Lee, A. T. Kwa, L. Hennighausen, H. Bujard, G. I. Fishman, B. R. Conklin. 1999. Conditional expression and signaling of a specifically designed Gi-coupled receptor in transgenic mice. Nat. Biotechnol. 17: 165-169. [Medline]
  18. Kearney, J. F., A. Radbruch, B. Liesegang, K. Rajewsky. 1979. A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines. J. Immunol. 123: 1548-1550. [Abstract/Free Full Text]
  19. Hombach, J., L. Leclercq, A. Radbruch, K. Rajewsky, M. Reth. 1988. A novel 34-kd protein co-isolated with the IgM molecule in surface IgM-expressing cells. EMBO J. 7: 3451-3456. [Medline]
  20. Keyna, U., G. B. Beck-Engeser, J. Jongstra, S. E. Applequist, H. M. Jack. 1995. Surrogate light chain-dependent selection of Ig heavy chain V regions. J. Immunol. 155: 5536-5542. [Abstract]
  21. Jack, H. M., G. Beck-Engeser, B. Sloan, M. L. Wong, M. Wabl. 1992. A different sort of Mott cell. Proc. Natl. Acad. Sci. USA 89: 11688-11691. [Abstract/Free Full Text]
  22. Mielenz, D., A. Ruschel, C. Vettermann, H. M. Jack. 2003. Immunoglobulin µ heavy chains do not mediate tyrosine phosphorylation of Ig{alpha} from the ER-cis-Golgi. J. Immunol. 171: 3091-3101. [Abstract/Free Full Text]
  23. João, C. M., B. M. Ogle, C. Gay-Rabinstein, J. L. Platt, M. Cascalho. 2004. B cell-dependent TCR diversification. J. Immunol. 172: 4709-4716. [Abstract/Free Full Text]
  24. Laemmli, U. K.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. [Medline]
  25. Melchers, F., H. Karasuyama, D. Haasner, S. Bauer, A. Kudo, N. Sakaguchi, B. Jameson, A. Rolink. 1993. The surrogate light chain in B-cell development. Immunol. Today 14: 60-68. [Medline]
  26. Iglesias, A., A. Nichogiannopoulou, G. S. Williams, H. Flaswinkel, G. Kohler. 1993. Early B cell development requires µ signaling. Eur. J. Immunol. 23: 2622-2630. [Medline]
  27. Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature 381: 751-758. [Medline]
  28. Delogu, A., A. Schebesta, Q. Sun, K. Aschenbrenner, T. Perlot, M. Busslinger. 2006. Gene repression by pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells. Immunity 24: 269-281. [Medline]
  29. Reichlin, A., Y. Hu, E. Meffre, H. Nagaoka, S. Gong, M. Kraus, K. Rajewsky, M. C. Nussenzweig. 2001. B cell development is arrested at the immature B cell stage in mice carrying a mutation in the cytoplasmic domain of immunoglobulin beta. J. Exp. Med. 193: 13-23. [Medline]
  30. Chase, M. W.. 1967. Preparation of immunogens. C. A. Williams, and M. W. Case, eds. Methods in Immunology and Immunochemistry 197-209. Academic, New York.
  31. Witzig, T. E., D. L. Wahner-Roedler. 2002. Heavy chain disease. Curr. Treat. Options Oncol. 3: 247-254. [Medline]
  32. Vanhove, M., Y. K. Usherwood, L. M. Hendershot. 2001. Unassembled Ig heavy chains do not cycle from BiP in vivo but require light chains to trigger their release. Immunity 15: 105-114. [Medline]
  33. Wu, J., R. J. Kaufman. 2006. From acute ER stress to physiological roles of the unfolded protein response. Cell Death Differ. 13: 374-384. [Medline]
  34. Kurosaki, T.. 2002. Regulation of B cell fates by BCR signaling components. Curr. Opin. Immunol. 14: 341-347. [Medline]
  35. Casola, S., K. L. Otipoby, M. Alimzhanov, S. Humme, N. Uyttersprot, J. L. Kutok, M. C. Carroll, K. Rajewsky. 2004. B cell receptor signal strength determines B cell fate. Nat. Immunol. 5: 317-327. [Medline]
  36. Muyldermans, S., M. Lauwereys. 1999. Unique single-domain antigen binding fragments derived from naturally occurring camel heavy-chain antibodies. J. Mol. Recognit. 12: 131-140. [Medline]
  37. Greenberg, A. S., D. Avila, M. Hughes, A. Hughes, E. C. McKinny, M. F. Flajnik. 1995. A new antigen receptor gene family that undergoes rearrangement and extensive somatic diversification in sharks. Nature 374: 168-173. [Medline]
  38. Rast, J. P., C. T. Amemiya, R. T. Litman, S. J. Strong, G. W. Litman. 1998. Distinct patterns of IgH structure and organization in a divergent lineage of chrondrichthyan fishes. Immunogenetics 47: 234-245. [Medline]
  39. Janssens, R., S. Dekker, R. W. Hendriks, G. Panayotou, A. van Remoortere, J. K. San, F. Grosveld, D. Drabek. 2006. Generation of heavy-chain-only antibodies in mice. Proc. Natl. Acad. Sci. USA 103: 15130-15135. [Abstract/Free Full Text]
  40. Knarr, G., M. J. Gething, S. Modrow, J. Buchner. 1995. BiP binding sequences in antibodies. J. Biol. Chem. 270: 27589-27594. [Abstract/Free Full Text]
  41. Brandt, C. R., S. L. Morrison, B. K. Birshtein, C. Milcarek. 1984. Loss of a consensus splice signal in a mutant immunoglobulin gene eliminates the CH1 domain exon from the mRNA. Mol. Cell. Biol. 4: 1270-1277. [Abstract/Free Full Text]
  42. Corcos, D., O. Dunda, C. Butor, J. Y. Cesbron, P. Lores, D. Bucchini, J. Jami. 1995. Pre-B-cell development in the absence of {lambda}5 in transgenic mice expressing a heavy-chain disease protein. Curr. Biol. 5: 1140-1148. [Medline]
  43. Fermand, J. P., J. C. Brouet. 1999. Heavy-chain diseases. Hematol. Oncol. Clin. North Am. 13: 1281-1294. [Medline]
  44. Rosado, M. M., A. A. Freitas. 1998. The role of the B cell receptor V region in peripheral B cell survival. Eur. J. Immunol. 28: 2685-2693. [Medline]
  45. Pollok, B. A., R. Anker, P. Eldridge, L. Hendershot, D. Levitt. 1987. Molecular basis of the cell-surface expression of immunoglobulin µ chain without light chain in human B lymphocytes. Proc. Natl. Acad. Sci. USA 84: 9199-9203. [Abstract/Free Full Text]
  46. Gaudin, E., M. Rosado, F. Agenes, A. McLean, A. A. Freitas. 2004. B-cell homeostasis, competition, resources, and positive selection by self-antigens. Immunol. Rev. 197: 102-115. [Medline]
  47. Skalet, A. H., J. A. Isler, L. B. King, H. P. Harding, D. Ron, J. G. Monroe. 2005. Rapid B cell receptor-induced unfolded protein response in nonsecretory B cells correlates with pro- versus antiapoptotic cell fate. J. Biol. Chem. 280: 39762-39771. [Abstract/Free Full Text]
  48. Gass, J. N., N. M. Gifford, J. W. Brewer. 2002. Activation of an unfolded protein response during differentiation of antibody-secreting B cells. J. Biol. Chem. 277: 49047-49054. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Geraldes, P.
Right arrow Articles by Cascalho, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Geraldes, P.
Right arrow Articles by Cascalho, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS