The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1648-1658
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monick, M. M.
Right arrow Articles by Hunninghake, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monick, M. M.
Right arrow Articles by Hunninghake, G. W.

Respiratory Syncytial Virus Synergizes with Th2 Cytokines to Induce Optimal Levels of TARC/CCL171

Martha M. Monick2,*, Linda S. Powers*, Ihab Hassan*, Dayna Groskreutz*, Timur O. Yarovinsky§, Christopher W. Barrett*, Elaine M. Castilow{dagger},{ddagger}, Delia Tifrea{ddagger}, Steven M. Varga{dagger},{ddagger} and Gary W. Hunninghake*

Departments of * Internal Medicine and {dagger} Microbiology and {ddagger} Interdisciplinary Graduate Program in Immunology, University of Iowa Carver College of Medicine and Veterans Administration Medical Center, Iowa City, IA 52242; and § Department of Immunobiology, Yale University, New Haven, CT 06510


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Respiratory syncytial virus (RSV) is a ubiquitous virus that preferentially infects airway epithelial cells, causing asthma exacerbations and severe disease in immunocompromised hosts. Acute RSV infection induces inflammation in the lung. Thymus- and activation-regulated chemokine (TARC) recruits Th2 cells to sites of inflammation. We found that acute RSV infection of BALB/c mice increased TARC production in the lung. Immunization of BALB/c mice with individual RSV proteins can lead to the development of Th1- or Th2-biased T cell responses in the lung after RSV infection. We primed animals with a recombinant vaccinia virus expressing either the RSV fusion (F) protein or the RSV attachment (G) protein, inducing Th1- and Th2-biased pulmonary memory T cell responses, respectively. After RSV infection, TARC production significantly increased in the vaccinia virus G-primed animals only. These data suggest a positive feedback loop for TARC production between RSV infection and Th2 cytokines. RSV-infected lung epithelial cells cultured with IL-4 or IL-13 demonstrated a marked increase in the production of TARC. The synergistic effect of RSV and IL-4/IL-13 on TARC production reflected differential induction of NF{kappa}B and STAT6 by the two stimuli (both are in the TARC promoter). These findings demonstrate that RSV induces a chemokine TARC that has the potential to recruit Th2 cells to the lung.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Respiratory syncytial virus (RSV)3 is a member of the Paramyxoviridae family of viruses (1). It preferentially infects airway epithelium and is responsible for significant pathology in infants, young children, asthmatics, and immunocompromised adults (1, 2, 3, 4). Virtually all children become infected with RSV by the age of 2 years. In most cases, the virus remains localized to the nasopharyngeal epithelium and causes only mild disease. However, in a subset of individuals, RSV spreads to the lower respiratory tract, causing a severe acute bronchiolitis. In RSV-induced bronchiolitis, there is a strong inflammatory response mediated by both Th1 and Th2 cells with epithelial sloughing, eosinophilia, hypersecretion of mucus, edema, airflow obstruction, and wheezing (5, 6). Viral clearance and recovery from infection do not lead to prolonged resistance (1).

Asthma is an immune-mediated disease characterized by CD4+ T cells that secrete IL-4, IL-5, and IL-13 (Th2 cells), accumulation of eosinophils, circulating IgE Abs, and airway hyperresponsiveness (7). RSV infection has been linked to asthma and has been shown to cause asthma exacerbations (8, 9, 10, 11). Less clear is the intriguing epidemiological link between infants who have severe RSV infections and develop asthma in subsequent years (10, 12, 13, 14).

The primary immune response to RSV is characterized by a generalized inflammatory response (15, 16, 17, 18, 19, 20, 21, 22, 23). Depending on the time and conditions of infection, both Th1 and Th2 chemokines (small secreted peptides that regulate leukocyte trafficking) can be induced by RSV (18, 24, 25). Th1- and Th2-associated chemokines are secreted at sites of inflammation and function to recruit and activate other immune cells. Recent data have suggested that production of these mediators not only is linked to classic immune cells (macrophages and T cells) but also comes from other cells such as epithelial and endothelial cells.

There is increasing evidence that thymus- and activation-regulated chemokine (TARC) is involved in the recruitment of Th2 cells during an allergic response (26, 27, 28). Th2 cells express the TARC receptor, chemokine (CC motif) receptor 4 (CCR4) and asthmatics have been shown to have increased levels of TARC in the airways (29). TARC can be produced by airway epithelial cells (30), but very little is known about how TARC production is regulated. For the human gene, two transcription factors have been shown to play a role in TARC production, NF{kappa}B and STAT6 (31, 32). In contrast to TARC, IFN-{gamma}-inducible protein 10 (IP-10)/CXCL10 is a chemokine that preferentially attracts Th1 T cells via the receptor CXCR3. It is highly inducible by the Th1 cytokine, IFN-{gamma}. IP-10 expression has also been shown to be up-regulated in asthmatic airways, demonstrating the complex nature of the Th1/Th2 inflammation in that disease (33).

In this study, we use both an in vivo murine model and an in vitro epithelial cell model to evaluate the expression of the chemokine TARC during RSV infection. We demonstrate that TARC production is a late event after RSV infection and that it occurs following expression of the Th1 chemokine, IP-10. We generated mice biased toward a Th1 or Th2 memory phenotype in the lung by priming with vaccinia vectors expressing either the RSV F (Th1) or G (Th2) protein followed by intranasal RSV infection. After challenge with RSV, there was considerably more TARC induction in the Th2-biased animals. In an in vitro model, we observed a super induction of TARC when RSV infection is combined with IL-4 or IL-13 exposure. No similar effect was observed when RSV infection was combined with Th1-like cytokines, nor did the Th2 cytokines affect IP-10 induction. This combined effect of RSV and Th2 cytokines was consistent with the effect of RSV and IL-4 or IL-13 on the relevant transcription factors (NF{kappa}B and STAT6). Binding sites for both NF{kappa}B and STAT6 are present in the TARC promoter region (30, 31, 32, 34, 35). RSV activated only NF{kappa}B, and IL-4/IL-13 activated only STAT6. Only when both RSV and IL-4/IL-13 were present in the cultures was there activation of both NF{kappa}B and STAT6. Thus, the presence of both RSV and either IL-4 or IL-13 led to activation of both transcription factors needed for optimal TARC production. This study shows that TARC is produced at low levels with primary RSV infection and that TARC production is markedly amplified in settings where both RSV and Th2 cytokines are present.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Chemicals were obtained from Sigma-Aldrich and Calbiochem. Protease inhibitors were obtained from Roche Diagnostics. IkB{alpha}, p65, and STAT6 Abs were from Santa Cruz Biotechnology. Abs to STAT6 phosphorylated on tyrosine 641 was from Cell Signaling. IL-4 and IL-13 Duoset ELISAs were from R&D Systems. qRT-PCR reagents are from Promega. Primers were obtained from Integrated DNA Technologies. Bay11-7082 and the JAK1 inhibitor were both from EMD Biosciences.

Epithelial cell culture and viral infection

A549 lung epithelial cells were obtained from American Type Culture Collection. A549 cells were used because they most closely mimic RSV observations in primary human airway cells (3, 4, 36). Cells were maintained in 75-cm2 tissue culture flasks (Corning) in minimal essential medium (Invitrogen Life Technologies) with 10% FCS and gentamicin. For infection, cells at ~80% confluence were treated with human RSV, strain A2 (multiplicity of infection (moi) of 2). Viral stocks were obtained from Advanced Biotechnologies Inc. Because of a report of possible adenovirus contamination in some RSV stocks (37), we tested our stock for adenovirus by PCR and found it to be completely free of adenoviral contamination. The initial stock (1 x 109 half-maximal tissue culture-infective dose) was aliquoted and kept frozen at –135°C. A fresh aliquot was thawed for each experiment. The virus was never refrozen.

RSV inactivation

RSV was inactivated using the Stratagene UV Stratalinker 1800 and radiating cell supernatant containing RSV with 450,000 µJ of energy three times.

Mice and virus stocks

BALB/c mice were purchased from the National Cancer Institute. Mice were housed in a pathogen-free environment. All the animal protocols were approved by the University of Iowa Institutional Animal Care and Use Committee. The A2 strain of RSV was a gift from Barney Graham (National Institutes of Health, Bethesda, MD). Recombinant vaccinia virus stocks (gifts from Gail Wertz, University of Virginia, Charlottesville, VA, and J. L. Beeler, Food and Drug Administration, National Institutes of Health, Bethesda, MD) were grown in BSC-40 cells (American Type Culture Collection, Manassas, VA) and sucrose purified before use.

Infection of mice

With a 25-gauge needle, mice were scarified on the rump by lightly scratching 10 µl of a recombinant vaccinia virus (equivalent to 3 x 106 PFU/mouse) expressing the attachment (G) protein of RSV, the fusion (F) protein of RSV, or beta-galactosidase as a control. After 3 wk, mice were challenged intranasally with 100 µl of 2 x 106 PFU/mouse RSV under light anesthesia with 30% halothane (Halocarbon Laboratories) in mineral oil (Fisher Scientific). Mouse weights were recorded on a daily basis. Weight data (grams) was converted to a percentage of the starting (day 0) weight of each individual mouse. Day 0 is the day of RSV infection. Illness scores for each mouse were recorded based on the following scale: 0, no apparent illness; 1, slightly ruffled fur; 2, an active mouse with ruffled fur; 3, inactive and ruffled fur; 4, hunched posture, gait, inactive and ruffled fur; 5, moribund or dead. For the acute RSV infection, mice were treated identically, except that there was no scarification with the recombinant vaccinia virus vectors.

Whole-cell protein isolation

Whole cell protein was obtained by lysing the cells on ice for 20 min, in 300 µl of lysis buffer (0.05 M Tris (pH 7.4), 0.15 M NaCl, 1% Nonidet P-40, with added protease and phosphatase inhibitors: 1 protease minitab (Roche Biochemicals)/10 ml and 100 µl of 100x phosphatase inhibitor mixture (Calbiochem)/10 ml. The lysates were sonicated for 20 s, kept at 4°C for 30 min, and spun at 15,000 x g for 10 min; the supernatant was saved. Protein determinations were made using a protein measurement kit (Bradford Protein Assay) from Bio-Rad. Cell lysates were stored at –70°C until use.

Cytosolic and nuclear protein extracts

Experimental cells were resuspended in 0.4 ml of lysis buffer (10 mM HEPES (pH 7.8), 10 mM KCl, 2 mM MgCl2, 0.1 mM EDTA), placed on ice for 15 min, and then vigorously mixed after the addition of 25 µl of 10% Nonidet P-40. After a 30 s of centrifugation (16,000 x g at 4°C), the supernatant was saved as the cytosolic fraction, and the pelleted nuclei were resuspended in 50 µl of extraction buffer (50 mM HEPES (pH 7.8), 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, 10% glycerol). The nuclei were incubated on ice for 20 min and vortexed, and debris was removed with a 16,000 x g quick spin at 4°C. Nuclear and cytosolic extracts were stored at 70°C.

Western analysis

Western analysis for the presence of particular proteins or for phosphorylated forms of proteins was performed as previously described (38). Briefly, 40 µg of protein were mixed 1:1 with 2x sample buffer (20% glycerol, 4% SDS, 10% 2-ME, 0.05% bromphenol blue, and 1.25 M Tris, pH 6.8) and loaded onto a 10% SDS-PAGE gel and run at 110 V for 2 h. Cell proteins were transferred to Immuno-Blot polyvinylidene difluoride (PVDF) membrane (Bio-Rad) with a Bio-Rad semidry transfer system, according to the manufacturer’s instructions. Equal loading of the protein groups on the blots was evaluated using Ponceaus S (Sigma-Aldrich), a staining solution designed for staining proteins on PVDF membranes. The PVDF was then blocked with 5% milk in Tris-buffered saline with 0.1% Tween 20 for 1 h, washed, and then incubated with the primary Ab at dilutions of 1/500 to 1/2000 overnight. The blots were washed four times with Tris-buffered saline with 0.1% Tween 20 and incubated for 1 h with HRP-conjugated anti-IgG Ab (1/5,000–1/20,000). Immunoreactive bands were developed using a chemiluminescent substrate, ECL Plus or ECL (Amersham Biosciences). An autoradiograph was obtained, with exposure times of 10 s–2 min. Protein levels were quantified using a FluorS scanner and Quantity One software for analysis (Bio-Rad). The data were analyzed and statistics performed using Graphpad software. Densitometry is expressed as fold increase (experimental value/control value).

Measurement of secreted proteins

A549 lung epithelial cells were plated at ~80% confluence. After designated culture, supernatants were collected and frozen at –70°C. TARC and IP-10 concentrations in cell culture supernatants were determined using DuoSet ELISA kits from R&D systems.

Epithelial cell survival assays

Cell viability was analyzed by the Guava EasyCyte mini (Guava Technologies). The Guava ViaCount assay distinguishes between viable and nonviable cells based on the differential permeability of DNA-binding dyes in the ViaCount Reagent (Guava Technologies). Cell viability was also analyzed by monitoring ATP levels after RSV with and without IL-4 (culture performed in a 96-well plate; CellTiter-Glo Luminescent Cell Viability Assay; Promega). After incubation with virus and cytokine, cultures were brought to room temperature, and an equal volume of CellTiter-Glo reagent was added. After a 2-min mix, the plate was read on a Safire plate reader from Tecam, set for chemiluminescence.

Real-time RT-PCR (qRT-PCR)

For cell cultures, total RNA was extracted using the Absolutely RNA Kit according to the manufacturer’s instructions (Stratagene). RNA was quantified using the RiboGreen Kit (Invitrogen Life Technologies). For mouse lungs, RNA was extracted with Invitrogen Trizol reagent, cleaned up with Stratagene Absolutely RNA, and quantified with Bio-Rad Experion. Total RNA was reverse transcribed to cDNA using the iScript cDNA Synthesis Kit from Bio-Rad. The resulting cDNA (2 µl; from either mouse lungs or a human cell line) was then mixed with 48 µl of PCR master mix consisting of iQ SYBR Green Supermix (Bio-Rad), 15 pmol of forward primer, and 15 pmol of reverse primer in a 0.2-ml PCR tube (Bio-Rad). PCR amplification was then performed in an iCycler iQ Fluorescence Thermocycler (Bio-Rad) (3, 4, 36). Chemokine gene expression was normalized to the housekeeping gene, hypoxanthine-guanine phosphoribosyltransferase (HPRT), with approximately equal amplification efficiency. The {Delta} threshold cycle (Ct) was calculated as the difference between Ct values, determined using the equation 2{Delta}Ct. The following primers were used for human TARC (agggacctgcacacagagac, aggtagtcccgggagacagt), IP-10 (aacctccagtctcagcaccatgaa, tgaagcagggtcagaacatccact), and HPRT (ttggaaagggtgtttattcctc, tcccctgttgactggtcatt). For the mouse lung samples, the following primers were used: TARC (ttgtgttcgcctgtagtgcata, caggaagttggtgagctggtata); IP-10 (aacctccagtctcagcaccatgaa, tgaagcagggtcagaacatccact); IL-13 (cagtcctggctcttgcttg, gcgaaacagttgctttgtgt); IFN-{gamma} (gctttggagctcttcctcat, tgagctcattgaatgcttgg); and HPRT (cctcatggactgattatggac, cagattcaacttgcg ctcatc).

mRNA stability assay

A549 cells were stimulated with RSV (moi 2) with and without added IL-4 (10 ng/ml) for 24 h and treated with 10 µg/ml actinomycin D to inhibit transcription. Additional harvests were then made at 3 and 6 h after actinomycin D treatment. Total RNA was isolated using Absolutely RNA Miniprep kit (Stratagene). RNA concentration was measured using Quant-iT RiboGreen RNA assay kit (Invitrogen Life Technologies). Total RNA (1 µg) was reverse transcribed to cDNA using an iScript cDNA Synthesis Kit (Bio-Rad). qRT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad) in an iCycler iQ Fluorescence Thermocycler (Bio-Rad). The specific primer sets for TARC and housekeeping genes are shown in "Real-time RT-PCR (qRT-PCR)." Relative gene expression was calculated and normalized to HPRT or GAPDH mRNA as previously described (39). Cytokine mRNA stability was expressed as percent mRNA remaining at given time points after transcriptional inhibition relative to the mRNA abundance at t = 0 ((ratio of actinomycin D sample/ratio of 24 h RSV or RSV + IL-4) x 100; GraphPad Software).

Statistical analysis

Statistical analysis was performed on ELISA results and real-time PCR data using either ANOVA followed by Bonferroni’s test for multiple comparisons or Student’s t test and are reported as the mean ± SEM. These methods were performed using GraphPad Prizm 4 for Windows (GraphPad Software).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
RSV induces both Th1-promoting and Th2-promoting chemokines in a murine infection model

RSV infection of airway epithelium causes the release of many cytokines and chemokines (25). One of the well-described RSV-induced chemokines is IP-10 (21, 40, 41). In contrast, the only report of TARC production after RSV is a microarray study, which lists TARC as one of many induced cytokine/chemokines (42). The focus of this paper is the Th2 cell-recruiting chemokine TARC; we show data on IP-10 to highlight the differences between TARC production and other better described inflammatory mediators. We were interested in how and when RSV induces these two potentially divergent mediators. BALB/c mice were infected intranasally with RSV, and at different time points postinfection, animals were sacrificed and lungs were harvested for RNA isolation. Fig. 1A shows that after RSV infection there is a peak of IP-10 induction at day 5. In contrast, TARC mRNA comes up at later time points (peaking at day 10) and stays up-regulated for longer periods (staying slightly up-regulated as long as 300 days postinfection). These data demonstrate in an animal model that RSV induction of the Th1-recruiting chemokine, IP-10, precedes induction of the Th2-recruiting chemokine, TARC. In addition, TARC mRNA remains elevated for a significantly longer time.


Figure 1
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 1. RSV induces TARC protein and mRNA in BALB/c mice. In primed animals (Th1 or Th2), Th2 priming increases RSV induced TARC. A, BALB/c mice (two per group) were infected intranasally with RSV and followed up to 300 days postinfection. At designated time points, mice were euthanized as described in Materials and Methods, lungs were harvested, and RNA was isolated. TARC and IP-10 levels were measured using qRT-PCR. B, BALB/c mice (four per group) were scarified with 3 x 106 PFU of a recombinant vaccinia virus (vv) expressing beta-galactosidase (bgal), the attachment (G) protein of RSV or the fusion (F) protein of RSV. Three weeks later, mice were challenged intranasally with 2 x 106 PFU of RSV under anesthetization. One lung was processed for RNA. TARC and IP-10 levels were measured by qRT-PCR. Significance was measured by using ANOVA followed by Bonferroni’s test for multiple comparisons and represents the mean ± SEM (GraphPad Prism). C, For the animals used in B, information was obtained on histology, weight and illness score changes, and mRNA (IL-4, IL-13, and IFN-{gamma}). Weights and illness scores were kept from day 0 for all mice as described in Materials and Methods (data are summarized in two graphs, averages ± SE). From euthanized animals, one lung from each animal was fixed for histology (H&E stain), and one lung from each animal was processed for RNA. IL-4, IL-13, and IFN-{gamma} mRNAs were measured by qRT-PCR. Significance was measured by using ANOVA followed by Bonferroni’s test for multiple comparisons and represents the mean ± SEM (GraphPad Prism).

 
Mice primed to develop a memory Th2-biased response in the lung produce increased TARC in response to RSV infection compared with mice primed to develop a memory Th1-biased pulmonary response

Priming BALB/c mice with either the F or the G proteins from RSV has been shown to bias the memory T cell response in the lung toward either a Th1 or a Th2 phenotype, respectively (1, 2, 43, 44). We made use of this model to ask whether animals primed for a memory Th2 response would produce more TARC in the lung in response to a subsequent RSV infection. BALB/c mice were primed using recombinant vaccinia virus constructs expressing either the F or the G proteins according to a previously described protocol (1, 2, 43, 44). Three weeks after priming, some of the animals were challenged with RSV intranasally. Three days after RSV infection, the animals were sacrificed and blood and lungs harvested.

Fig. 1B demonstrates that priming with a construct that expresses the G protein from RSV (induces a Th2-biased memory T cell response in the lung) led to increased production of TARC after RSV infection. Priming with either the F or the G protein led to increased IP-10, given that in both conditions there is increased IFN-{gamma} production. The time point examined here (3 days) is 2–4 days before the appearance of TARC mRNA in mice undergoing an acute RSV infection (Fig. 1A).

In Fig. 1C, we show that priming with either F or G protein increases systemic disease (as evidenced by decreased body weight and increased illness score). Both the F and G priming increase IFN-{gamma} production by RSV. However, only in the animals primed with G protein was there an increase in the Th2 cytokines IL-4 and IL-13 after RSV. There was not a large increase in IL-4 and IL-13; however, the increase was enough to demonstrate a significant increase in the amount of TARC mRNA. These data demonstrate that in a murine model, skewing the RSV-specific memory T cell response toward a Th2 bias leads to a significant increase in TARC production after RSV infection.

In the acute RSV infection shown in Fig. 1A, we have no evidence that RSV alone induces Th2 cytokines. In fact, a recent study by Lukacs et al. (45) demonstrates that the A2 strain of RSV (used in this study) does not induce IL-4 or IL-13 in a BALB/c model. They show that, in contrast, the clinical isolate, line 19, induces both IL-4 and IL-13. It will be of interest to determine whether acute RSV infection with line 19 RSV increases TARC production in BALB/c mice.

RSV induces both IP-10 and TARC in lung epithelial cells

In the studies shown in Fig. 2A, we infected a human lung epithelial line, A549 cells with RSV (moi 2) and saved supernatants and RNA at various time points. We have found that the natural course of RSV infection in A549 cells starts with a period of rapid RSV replication, leading to cell death between 48 and 96 h (4, 36, 38, 46). We examined time points from 0 to 72 h for protein production and 0 to 48 h for mRNA production. In the mRNA studies, we stopped experiments at 48 h of infection to avoid the variability that occurred with the onset of cell death between 48 and 72 h. IP-10 mRNA began going up as early as 16 h, whereas TARC accumulation began 24 h postinfection. At 72 h postinfection, TARC protein was going up and at 48 h postinfection TARC mRNA was still rapidly increasing. In contrast, IP-10 mRNA amounts leveled at 48 h, and protein production was returning to baseline by 72 h. As a composite, the data presented in Fig. 2A show that in an in vitro model, RSV infection induces IP-10 and TARC in a sequential manner.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 2. RSV increases TARC protein and mRNA in lung epithelial cells. The increased TARC requires active viral replication. In contrast to IP-10 induction, TARC is only minimally induced by TNF-{alpha} or TNF-{alpha} plus IFN-beta. A, A549 cells were cultured at 80% confluence and then infected with RSV at moi 2. At selected time points, cells and supernatants were harvested for both RNA and protein analysis. Supernatants were analyzed using TARC- and IP-10-specific ELISAs. RNA was analyzed as described in Materials and Methods. Each graph (Tarc and IP-10) is a composite of three separate experiments. Significance was measured using a one-tailed Student t test (GraphPad Prism). B, A549 cells were cultured with and without RSV (moi 2) for 48 h. The supernatant was removed and split in half, and one half was UV treated. The four supernatants (Control, UV Control, RSV, and UV RSV) were then placed on fresh A549 cells, cultured to 80% confluence, and incubated for a further 48 h. The final supernatant was then harvested, and TARC and IP-10 were measured by ELISA. Significance (RSV supernatant vs UV RSV supernatant) was measured using a one-tailed Student t test (GraphPad Prism). C, A549 cells were cultured at 80% confluence and then treated with RSV (moi 2), TNF-{alpha} (10 ng/ml), IFN-beta (1000 U/ml), or TNF-{alpha} and IFN-beta together. After 48 h, supernatants were harvested, and TARC and IP-10 were measured by ELISA. Significance (all groups compared with RSV-infected sample) was measured using a one-tailed Student t test (GraphPad Prism).

 
RSV-induced TARC is dependent on ongoing viral replication while IP-10 is not

RSV infection induces a number of cytokines that are known to induce other cytokines and chemokines (i.e., TNF-{alpha}, IL-1beta) and IFN-beta (1, 4, 21, 47, 48, 49, 50, 51, 52, 53). To examine whether either IP-10 or TARC production was secondary to a released cytokine, we performed the following experiment. A549 cells were infected with and without RSV at moi 2 for 48 h. The supernatant was harvested and divided into two portions, and one half of each portion was UV treated to kill the RSV. The UV-treated and not-UV-treated supernatants were then placed on fresh A549 cells, and the cells were cultured for a further 48 h. Final supernatants were harvested, and IP-10 and TARC were measured. Fig. 2B demonstrates that the UV-treated supernatant was incapable of inducing TARC in the secondary culture, whereas the supernatant with the live virus induced significant TARC levels. However, in contrast, IP-10 was induced by the supernatant whether or not the RSV in the supernatant was viable. Both the TARC and IP-10 levels were higher than those shown in Fig. 2A, because the ELISA is measuring chemokines produced in both the first supernatant-generating incubation (200–400 pg/ml quantities of both TARC and IP-10) and the second incubation.

We next examined two likely candidates for the IP-10-inducing effect of the supernatants. In Fig. 2C, we show that treating lung epithelial cells with TNF-{alpha} or IFN-beta or a combination of the two has little effect on TARC production. TNF-{alpha} does induce low levels of TARC, which has been reported previously (54). IFN-beta, one of two type I IFNs produced by RSV, does not induce any TARC, nor does it augment the low levels of TNF-{alpha}-induced TARC (55, 56). IP-10, in contrast, is induced by TNF-{alpha} to a greater extent than RSV, and there is significant synergy between TNF-{alpha} and IFN-beta. As a composite, these data demonstrate that, whereas IP-10 can be induced via paracrine responses to RSV-induced mediators (possibly by both TNF-{alpha} and IFN-beta), TARC induction requires active viral signals.

The Th2 cytokines IL-4 and IL-13 both significantly enhance production of TARC in RSV-infected cells

TARC is one of the few chemokines with demonstrable Th2 cell chemoattractant activity (57, 58, 59). We were interested in determining whether the presence of Th2 cytokines (as can occur in an asthmatic’s lung or in individuals who have been previously infected with RSV) would have any effect on the production of IP-10 and TARC. We first examined the effect of IL-4 or IL-13 on RSV-induced TARC. IL-4 or IL-13 was added to epithelial cultures at the same time as RSV, and the samples were cultured for various times. Fig. 3A demonstrates that exposing lung epithelial cells to both RSV and IL-4 has a substantial effect on TARC production, while not increasing IP-10 production. The top two graphs show TARC protein release and mRNA production after IL-4. The differences completely overshadow TARC production by RSV alone. IL-4 alone produced no TARC protein and only very small increases in TARC mRNA. In the bottom two graphs, the effect of IL-4 exposure on RSV-induced IP-10 is shown. In contrast to TARC, IL-4 has no stimulatory effect on the production of IP-10 in RSV-infected cells. In fact, IL-4 appears to cause an initial inhibition of RSV-induced IP-10 protein. We next examined the effect of IL-13 on TARC and IP-10 production after RSV infection. Like IL-4, IL-13 caused a significant increase in TARC production (Fig. 3B). This was true both of TARC protein and TARC mRNA. Also like IL-4, IL-13 did not increase RSV-induced IP-10. Unlike IL-4, IL-13 did not inhibit RSV-induced IP-10. These data show that either Th2 cytokine increases TARC production after RSV, while having no effect or inhibiting RSV-induced IP-10 production.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 3. The addition of IL-4 or IL-13 to a RSV-infected culture synergistically increases TARC production, while having no effect on IP-10 production. A, A549 cells were cultured at 80% confluence. Cells were infected with RSV (moi 2) at the same time as the addition of IL-4 (10 ng/ml). At selected time points, cells and supernatants were harvested for both RNA and protein analysis. For both protein and mRNA, IL-4 alone did not induce TARC or IP-10. Supernatants were analyzed using TARC and IP-10 specific ELISA’s. RNA was analyzed as described in Materials and Methods. Each graph (Tarc and IP-10) is a composite of three separate experiments. Significance (RSV alone compared with RSV+IL-4) was measured using a one-tailed Student’s t test (GraphPad Prism). B, A549 cells were cultured at 80% confluence and then infected with RSV (moi 2) with and without added IL-13 (10 ng/ml). Cells were infected with RSV (moi 2) at the same time as the addition of IL-13 (10 ng/ml). At selected time points, cells and supernatants were harvested for both RNA and protein analysis. For both protein and mRNA, IL-13 alone did not induce TARC or IP-10. Supernatants were analyzed using TARC- and IP-10-specific ELISAs. RNA was analyzed as described in Materials and Methods. Each graph (Tarc and IP-10) is a composite of three separate experiments. Significance (RSV alone compared with RSV + IL-13) was measured using a one-tailed Student t test (GraphPad Prism). ns, Not significant.

 
We combined other cytokines with RSV and studied their effect on TARC production (data not shown). IL-6 and IL-10 had no effect (either positive or negative) on TARC protein production. IFN-{gamma} minimally increased RSV-induced TARC protein. We demonstrated in Fig. 2C that TNF-{alpha} induced small amounts of TARC protein and that in combination with RSV there was a 2- to 3-fold increase in TARC production. This was significantly lower that the 10- to 30-fold increase seen when IL-4 or IL-13 was combined with RSV infection. As a composite, the data in Fig. 3 demonstrate that both canonical Th2 cytokines, IL-4 and IL-13, significantly induce the production of TARC mRNA and protein during RSV infection.

IL-4 and IL-13 have no effect on the viability of RSV-infected lung epithelial cells

One possible explanation for the increased TARC production with IL-4 or IL-13 in combination with RSV is that the cytokines increase survival of the RSV-infected cells. To rule out this possibility, we infected lung epithelial cells with RSV in combination with IL-4 or IL-13 and examined viability in two ways. The top graph in Fig. 3C demonstrates that 48 h after infection, RSV has increased plasma membrane permeability (propidium iodide (PI) staining and FACS). IL-4 and IL-13 have no effect on the viability changes due to the RSV infection (Fig. 4A). The bottom graph examines total ATP levels, also as a marker of cell viability. As with the PI staining, the addition of IL-4 or IL-13 had no effect on the decrease in ATP due to RSV infection. Increased TARC mRNA and protein, if it did not result from changes in cell viability, could result from changes in mRNA stability or in TARC gene transcription. We next examined the effect of IL-4/IL-13 on mRNA stability in RSV-infected lung epithelial cells.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

 
FIGURE 4. IL-4 or IL-13 does not increase survival of RSV-infected cells. IL-4 or IL-13 has no effect on TARC or IP-10 mRNA stability in RSV-infected cultures. A, A549 cells were cultured at 80% confluence and then infected with RSV (moi 2) with and without added IL-4 (10 ng/ml). After 48 h of culture, cell viability was measured using either PI staining (Guava EasyCyte mini) or ATP loss (ATP assay from Promega). There was no difference in viability with the addition of IL-4 or IL-13 to RSV-infected cultures. B, A549 cells were cultured at 80% confluence and then infected with RSV at a moi 2. After 24 h of culture, actinomycin D (ActD) was added (10 µg/ml), and cells were cultured for an additional 3 or 5 h. Cells were harvested for RNA. RNA was analyzed as described in Materials and Methods. Each graph (Tarc and IP-10) is a composite of three separate experiments. For calculations, mRNA levels at 24 h of RSV or RSV + IL-4 were set as 100%, and 3- or 6-h actinomycin percent was calculated as (ratio of ActD sample/ratio of 24-h RSV or RSV + IL-40) x 100). Significance was measured (each actinomycin sample was compared with the amount of mRNA (TARC or IP-10) present at 24 h (before the addition of actinomycin D) using a one-tailed Student t test (GraphPad Prism).

 
IL-4 does not alter the stability of RSV-induced TARC mRNA

We next examined mRNA stability of both TARC and IP-10 after exposure to RSV with and without IL-4 (Fig. 4B). Because qRT-PCR does not detect any TARC transcript in unstimulated cells, statistically, we could not examine the ability of RSV to alter TARC mRNA stability compared with baseline. We could look at whether IL-4 changes the stability of the RSV-induced TARC. We addressed this question by incubating cells with and without RSV and IL-4 for 48 h, stopping transcription with actinomycin D and measuring mRNA levels at 3 and 6 h after the stop of transcription. We found that IP-10, which has a long 3'-untranslated region, has a relatively short-lived mRNA species. This is supported by the IP-10 literature (60). TARC with its minimal 3'-untranslated region was a very stable transcript, and the TARC stability was not altered by RSV or IL-4. TARC mRNA has a very small 3'-untranslated region (201 nucleotides) with no demonstrable UAAAU sequences, consistent with both the long-term stability of the TARC transcript and the lack of changes in stability with RSV + IL-4 exposure. These data, in combination with the greatly increased TARC mRNA with the combination of RSV and Th2 cytokines, suggest that the increased TARC is the result of changes in transcription.

RSV alone induces NF{kappa}B activity; IL-4 alone induces STAT6 activity; together, RSV and IL-4 activate both NF{kappa}B and STAT6

Two transcription factors have demonstrated importance in TARC production, NF{kappa}B and STAT6 (30, 31, 32, 34, 35). NF{kappa}B is known to be activated by RSV infection and STAT6 is known to be activated by IL-4 and IL-13 (38, 61, 62). We next evaluated the effect of RSV with and without IL-4 on NF{kappa}B activation and STAT6 activation. Fig. 5A demonstrates that by 24 h post infection, RSV induced degradation of I{kappa}B{alpha} (consistent with NF{kappa}B activation) but had no effect on STAT6 activation (phosphorylation of tyrosine 641). In contrast, IL-4-induced phosphorylation of STAT6 on tyrosine 641 but did not activate NF{kappa}B. When RSV and IL-4 were combined, both transcription factors were activated. We also looked at nuclear localization of p65 NF{kappa}B subunit and STAT6 total protein. Consistent with the data in Fig. 5A, Fig. 5B demonstrates that RSV induces p65 nuclear translocation and IL-4 induces STAT6 nuclear translocation. Both exposures combined resulted in nuclear localization of both p65 and STAT6. These data suggest that the synergy between RSV and IL-4 results, in part, from the fact that neither exposure (RSV or IL-4) induces both of the transcription factors needed for optimal TARC production. However, in combination, there is activation of both NF{kappa}B and STAT6 and significantly increased TARC production. RSV alone was capable of inducing low levels of TARC without a STAT6 signal. We have no evidence that RSV alone induces IL-4 or IL-13 in BALB/c mice, and it does not induce these cytokines in lung epithelial cells. We are examining the hypothesis that RSV, via NF{kappa}B and some as yet unidentified factor(s), induces transcription of the TARC gene. Further, we hypothesize that RSV alters the environment at the TARC promoter, allowing for the STAT6 effect seen when both RSV and IL-4 are present.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 5. RSV infection alone activates NF{kappa}B and not STAT6. IL-4 exposure alone activates STAT6 and not NF{kappa}B. A, A549 cells were infected with RSV (moi 2) with and without IL-4 (10 ng/ml) or IL-13 (10 ng/ml) for 24 h. Whole-cell lysates were obtained, and Western analysis was performed for I{kappa}B{alpha} (37 kDa) and phosphorylated (Phos) STAT6 (tyrosine 641). Equal loading was performed by analyzing the same blot for beta-actin (42 kDa). Primary and secondary Ab dilutions for I{kappa}B{alpha} were 1/1,000 and 1/10,000, respectively. Primary and secondary Ab dilutions for phosphorylated STAT6 were 1/500 and 1/5000, respectively. Also shown is densitometry for both I{kappa}B{alpha} and phosphorylated STAT6 bands. B, A549 cells were infected with RSV (moi 2) with and without IL-4 (10 ng/ml) for 24 h. Cells were harvested, and nuclear and cytosolic fractions were isolated as described in Materials and Methods. Western analysis was performed for total p65 and total STAT6. Controls for protein loading were done by staining for beta-actin. Control for the nuclear/cytosolic isolation was performed by staining for HDAC2, a nuclear protein. Also shown is densitometry for both p65 and STAT6 bands.

 
Inhibition of NF{kappa}B inhibits TARC production

We used NF{kappa}B inhibitors to study the effect of NF{kappa}B on TARC production. Fig. 6A demonstrates that inhibiting NF{kappa}B with the translocation inhibitor, Bay11-7082, blocks both the RSV-induced TARC and the synergistic increase in TARC with IL-4 exposure. The graph on the right shows only the RSV-induced TARC. With a smaller y-axis, it is clear that the NF{kappa}B inhibitor blocks TARC production by RSV alone. We repeated these experiments using an adenovirus vector containing a mutant I{kappa}B{alpha} (S32/36A), kindly provided by J. Engelhardt (Department of Anatomy and Cell Biology, University of Iowa, Iowa City, IA). This I{kappa}B{alpha} cannot be ubiquitinated and degraded and thus serves to keep NF{kappa}B in the cytosol. Fig. 6B shows, consistent with the chemical inhibitor data, that NF{kappa}B activity is essential for TARC production by RSV and by the combination of RSV and IL-4.


Figure 6
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 6. Inhibition of NF{kappa}B blocks TARC production after RSV infection and after RSV + IL-4 exposure. A, A549 cells were cultured at 80% confluence and then infected with RSV (moi 2) with and without added IL-4 (10 ng/ml). Some samples were also treated with an NF{kappa}B inhibitor, Bay11-7082 (50 µM). Cells were cultured with treatments for 48 h, supernatants were harvested, and TARC protein was measured by ELISA. A graph on the right shows an expanded version of the RSV alone data. Significance (RSV alone compared with RSV + Bay11-7082 and RSV + IL-4 alone compared with RSV + IL-4 + Bay11-7082) was measured using a one-tailed Student t test (GraphPad Prism). B, A549 cells were cultured at 80% confluence and then infected with adenovirus (Ad) vectors expressing either BglII (negative control) or I{kappa}B{alpha} S3236A (nondegradable I{kappa}B{alpha} mutant). After 16 h, cells were infected with RSV (moi 2) with and without added IL-4 (10 ng/ml). Cells were cultured with treatments for a further 48 h, supernatants were harvested, and TARC protein was measured by ELISA. Significance (RSV alone compared with RSV + I{kappa}B{alpha} S3236A and RSV + IL-4 alone compared with RSV + IL-4 + I{kappa}B{alpha} S3236A) was measured using a one-tailed Student t test (GraphPad Prism).

 
Inhibition of JAK1 inhibits RSV and IL-4 TARC production, but not TARC production by RSV alone

The JAK1 inhibitor was used to block STAT6 activity because it would block IL-4 signaling downstream of either the classic IL-4 receptor (found primarily in hemopoietic cells (signaling via JAK1 and JAK3) and the combination IL-13 and IL-4 receptor found in a wider range of cell types (signaling via JAK1 and JAK2 or Tyk2; Ref. 63). The JAK1 inhibitor blocked production of TARC when cells were exposed to both RSV and IL-4 (Fig. 7). However, inhibiting STAT6 had no effect on the production of TARC by RSV alone. The graph on the right is an expanded version of the RSV alone data showing that the JAK1 inhibitor had no effect on TARC production by RSV alone, in contrast to the significant fall in TARC produced with a combination of RSV and IL-4.


Figure 7
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 7. Inhibition of JAK1 blocks TARC production after RSV + IL-4 exposure but has no effect on TARC production after RSV alone. A549 cells were cultured at 80% confluence and then infected with RSV (moi 2) with and without added IL-4 (10 ng/ml). Some samples were also treated with a JAK1 inhibitor (10 µM). Cells were cultured with treatments for 48 h, supernatants were harvested, and TARC protein was measured by ELISA. The graph on the right shows an expanded version of the RSV alone data. Significance (RSV alone compared with RSV + JAK1 inhibitor and RSV + IL-4 alone compared with RSV + IL-4 + JAK1 inhibitor) was measured using a one-tailed Student t test (GraphPad Prism). Con, Control.

 
As a composite, these data demonstrate that NF{kappa}B is essential for TARC production after RSV and for the synergistic increase in TARC with IL-4 and RSV together. In contrast, STAT6 (the transcription factor activated by both IL-4 and IL-13 signaling) is necessary for the IL-4/IL-13 synergistic effect on RSV-induced TARC, although not being necessary for the effects of RSV alone on TARC production.

Despite the fact that TARC has been shown to recruit Th2 cells via the CCR4 receptor and is up-regulated in asthmatic airways, very little is known about TARC regulation. In this paper, we demonstrate that RSV induces TARC production in the lung and in lung epithelial cells. Beyond this observation, we show that RSV and Th2 cytokines (IL-4 or IL-13) synergize to significantly increase the magnitude of TARC production. IL-4 or IL-13 do not produce significant TARC levels on their own but do provide a STAT6 signal that synergizes with RSV-induced NF{kappa}B to up-regulate TARC induction. Neither stimulus alone (RSV or IL-4/IL-13) generates both a STAT6 and an NF{kappa}B signal; combined they cooperate to induce significant amounts of TARC (Fig. 8).


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 8. TARC gene expression in lung epithelial cells (or in lungs from mice) is optimally driven by a combination of STAT6 and NF{kappa}B. RSV induces NF{kappa}B and low levels of TARC. IL-4 or IL-13 induces STAT6 activation but not NF{kappa}B activation. Together, RSV infection and IL-4 or IL-13 exposure lead to activation of both NF{kappa}B and STAT6, resulting in high levels of TARC production.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we have examined the role of RSV infection in the induction of Th1 recruiting and Th2 recruiting chemokines, IP-10 and TARC. Although we examined production of both chemokines, the focus of this project is TARC. IP-10 is a well-described outcome of IFN-beta exposure, and RSV induces IFN-beta. We examined IP-10 in parallel as an aid in determining what was unique about TARC mRNA and protein generation.

The only description of viral-induced TARC is a microarray study examining induction of a number of chemokines; it showed only that there was an increase in the transcript (42). We wanted to more comprehensively examine TARC production and whether RSV, the only virus known to induce a Th2-like response, produced TARC. We used a variety of models to examine the effect of RSV on TARC production. We first infected BALB/c mice with RSV and examined mRNA of both IP-10 and TARC. We found a sequential up-regulation (IP-10 first, TARC second) of the chemokines. Compared with IP-10, there was a prolonged expression of TARC. To study the effect of a Th2 bias, we made use of a murine model, in which priming by either F or G RSV proteins sets up a Th1- or Th2-biased pulmonary memory T cell response following RSV infection. After priming (3-wk incubation) and a 3-day RSV infection, we found significantly greater expression of TARC in the lungs of RSV-infected animals that were primed to express a memory Th2 cell phenotype.

We then found a synergistic effect of RSV and IL-4 exposure on TARC production in an in vitro model of lung epithelial cells. These data suggest a possible positive amplification loop between RSV and IL-4 or IL-13. Although our present animal data do not support induction of a Th2 phenotype by RSV alone, they are suggestive of in vivo interactions between IL-4 or IL-13 and RSV, increasing TARC production.

When we examined the transcription factors involved in TARC production (NF{kappa}B and STAT6), we found that each stimulus activated only one of these factors; RSV activates NF{kappa}B, and IL-4 activates STAT6. Only when both RSV and IL-4 were present together was there activation of both NF{kappa}B and STAT6. This observation leads to the conclusion that IL-4 and RSV synergize in inducing TARC by each providing one of the transcription factors needed for optimal activation of the TARC promoter.

In both the animal- and cell-based models, RSV alone, with no evidence of IL-4 to activate STAT6, still induces TARC. It is our hypothesis that low levels of TARC can be produced by RSV-induced NF{kappa}B and an as yet unidentified RSV-induced factor. The reason we believe that there is an unidentified RSV-induced factor is that some other inducers of NF{kappa}B do not produce TARC (i.e., TLR ligands; data not shown). The inhibitor data showing that a JAK1 inhibitor blocks the IL-4 effect on TARC in the presence of RSV but not RSV-induced TARC are consistent with this hypothesis.

One interesting hypothesis for the synergy between NF{kappa}B and STAT6 is the recruitment of CREB-binding protein (CBP)/p300 to promoters by NF{kappa}B. STAT6 in contrast to other STATs has no binding site for and does not recruit CBP/p300 on its own (64). CBP/p300s are multifunctional coactivator proteins that act as bridging factors to the basal transcription machinery, including RNA polymerase II. They also remodel chromatin by acetylating nucleosomal histones. CBP/p300 is essential for STAT-driven transcription (65, 66, 67), and STAT6 does not recruit it on its own. One hypothesis that fits our data (no TARC with IL-4 or IL-13 alone and high TARC with RSV and IL-4/IL-13) is that RSV brings CBP/p300 to the transcription start site where it is also used by STAT6, allowing for an IL-4 response where there was none (or only an extremely minimal response) before. We are at present pursuing this hypothesis.

As a composite, these data demonstrate that infection with RSV induces the Th2 chemokine TARC via a mechanism distinct from RSV-induced IP-10. Furthermore, the synergistic increase in TARC production with IL-4/IL-13 and RSV suggests that RSV infection of individuals who already have an increased capacity to generate a Th2 immune environment may have more severe disease after RSV than individuals without a Th2 bias in the lung.


    Acknowledgments
 
We thank Jeff Cagley and Nina Lovan for many excellent and cheerfully performed qRT-PCR analyses.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a Veterans Administration Merit Review Grant and by National Institutes of Health Grants AI063502 (to S.M.V.), HL-60316, HL-077431, HL079901-01A1 (to G.W.H.), and RR00059 from the General Clinical Research Centers Program, National Center for Research Resources, National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Martha M. Monick, Division of Pulmonary, Critical Care, and Occupational Medicine, Room 100, Eckstein Medical Research Building, Carver College of Medicine, University of Iowa, Iowa City, IA 52242. E-mail address: martha-monick{at}uiowa.edu Back

3 Abbreviations used in this paper: RSV, respiratory syncytial virus; HPRT, hypoxanthine guanine phosphoribosyl transferase; IP-10/CXCL10, human IFN-inducible protein 10; moi, multiplicity of infection; PI, propidium iodide; qRT-PCR, quantitative RT-PCR; TARC/CCL17, thymus- and activation-regulated chemokine; PVDF, polyvinylidene difluoride; CBP, CREB-binding protein. Back

Received for publication March 16, 2007. Accepted for publication May 25, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Varga, S. M., T. J. Braciale. 2002. RSV-induced immunopathology: dynamic interplay between the virus and host immune response. Virology 295: 203-207. [Medline]
  2. Varga, S. M., X. Wang, R. M. Welsh, T. J. Braciale. 2001. Immunopathology in RSV infection is mediated by a discrete oligoclonal subset of antigen-specific CD4+ T cells. Immunity 15: 637-646. [Medline]
  3. Monick, M. M., K. Cameron, J. Staber, L. S. Powers, T. O. Yarovinsky, J. G. Koland, G. W. Hunninghake. 2005. Activation of the epidermal growth factor receptor by respiratory syncytial virus results in increased inflammation and delayed apoptosis. J. Biol. Chem. 280: 2147-2158. [Abstract/Free Full Text]
  4. Monick, M. M., T. O. Yarovinsky, L. S. Powers, N. S. Butler, A. B. Carter, G. Gudmundsson, G. W. Hunninghake. 2003. Respiratory syncytial virus up-regulates TLR4 and sensitizes airway epithelial cells to endotoxin. J. Biol. Chem. 278: 53035-53044. [Abstract/Free Full Text]
  5. Walter, M. J., J. D. Morton, N. Kajiwara, E. Agapov, M. J. Holtzman. 2002. Viral induction of a chronic asthma phenotype and genetic segregation from the acute response. J. Clin. Invest. 110: 165-175. [Medline]
  6. Holt, P. G., P. D. Sly. 2002. Interactions between RSV infection, asthma, and atopy: unraveling the complexities. J. Exp. Med. 196: 1271-1275. [Free Full Text]
  7. Wenzel, S. E.. 2006. Asthma: defining of the persistent adult phenotypes. Lancet 368: 804-813. [Medline]
  8. Sly, P. D., M. E. Hibbert. 1989. Childhood asthma following hospitalization with acute viral bronchiolitis in infancy. Pediatr. Pulmonol. 7: 153-158. [Medline]
  9. Murray, M., M. S. Webb, C. O’Callaghan, A. S. Swarbrick, A. D. Milner. 1992. Respiratory status and allergy after bronchiolitis. Arch. Dis. Child. 67: 482-487. [Abstract/Free Full Text]
  10. Sigurs, N., R. Bjarnason, F. Sigurbergsson, B. Kjellman, B. Bjorksten. 1995. Asthma and immunoglobulin E antibodies after respiratory syncytial virus bronchiolitis: a prospective cohort study with matched controls. Pediatrics 95: 500-505. [Abstract/Free Full Text]
  11. Sigurs, N., R. Bjarnason, F. Sigurbergsson, B. Kjellman. 2000. Respiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. Am. J. Respir. Crit. Care Med. 161: 1501-1507. [Abstract/Free Full Text]
  12. Sigurs, N.. 2001. Epidemiologic and clinical evidence of a respiratory syncytial virus-reactive airway disease link. Am. J. Respir. Crit. Care Med. 163: S2-S6. [Medline]
  13. Eigen, H.. 1999. The RSV-asthma link: the emerging story: introduction. J. Pediatr. 135: 1[Medline]
  14. Hogg, J. C.. 1999. Childhood viral infection and the pathogenesis of asthma and chronic obstructive lung disease. Am. J. Respir. Crit. Care Med. 160: S26-S28. [Abstract/Free Full Text]
  15. Tripp, R. A., D. Moore, A. t. Barskey, L. Jones, C. Moscatiello, H. Keyserling, L. J. Anderson. 2002. Peripheral blood mononuclear cells from infants hospitalized because of respiratory syncytial virus infection express T helper-1 and T helper-2 cytokines and CC chemokine messenger RNA. J. Infect. Dis. 185: 1388-1394. [Medline]
  16. McNamara, P. S., B. F. Flanagan, L. M. Baldwin, P. Newland, C. A. Hart, R. L. Smyth. 2004. Interleukin 9 production in the lungs of infants with severe respiratory syncytial virus bronchiolitis. Lancet 363: 1031-1037. [Medline]
  17. Garofalo, R. P., J. Patti, K. A. Hintz, V. Hill, P. L. Ogra, R. C. Welliver. 2001. Macrophage inflammatory protein-1{alpha} (not T helper type 2 cytokines) is associated with severe forms of respiratory syncytial virus bronchiolitis. J. Infect. Dis. 184: 393-399. [Medline]
  18. Tripp, R. A., C. Oshansky, R. Alvarez. 2005. Cytokines and respiratory syncytial virus infection. Proc. Am. Thorac. Soc. 2: 147-149. [Abstract/Free Full Text]
  19. Durbin, J. E., R. K. Durbin. 2004. Respiratory syncytial virus-induced immunoprotection and immunopathology. Viral Immunol. 17: 370-380. [Medline]
  20. Krishnan, S., M. Halonen, R. C. Welliver. 2004. Innate immune responses in respiratory syncytial virus infections. Viral Immunol. 17: 220-233. [Medline]
  21. Culley, F. J., A. M. Pennycook, J. S. Tregoning, T. Hussell, P. J. Openshaw. 2006. Differential chemokine expression following respiratory virus infection reflects Th1- or Th2-biased immunopathology. J. Virol. 80: 4521-4527. [Abstract/Free Full Text]
  22. Johnson, T. R., R. A. Parker, J. E. Johnson, B. S. Graham. 2003. IL-13 is sufficient for respiratory syncytial virus G glycoprotein-induced eosinophilia after respiratory syncytial virus challenge. J. Immunol. 170: 2037-2045. [Abstract/Free Full Text]
  23. Graham, B. S., T. R. Johnson, R. S. Peebles. 2000. Immune-mediated disease pathogenesis in respiratory syncytial virus infection. Immunopharmacology 48: 237-247. [Medline]
  24. Kristjansson, S., S. P. Bjarnarson, G. Wennergren, A. H. Palsdottir, T. Arnadottir, A. Haraldsson, I. Jonsdottir. 2005. Respiratory syncytial virus and other respiratory viruses during the first 3 months of life promote a local TH2-like response. J. Allergy Clin. Immunol. 116: 805-811. [Medline]
  25. Becker, Y.. 2006. Respiratory syncytial virus (RSV) evades the human adaptive immune system by skewing the Th1/Th2 cytokine balance toward increased levels of Th2 cytokines and IgE, markers of allergy-a review. Virus Genes 33: 235-252. [Medline]
  26. Sekiya, T., M. Miyamasu, M. Imanishi, H. Yamada, T. Nakajima, M. Yamaguchi, T. Fujisawa, R. Pawankar, Y. Sano, K. Ohta, et al 2000. Inducible expression of a Th2-type CC chemokine thymus- and activation-regulated chemokine by human bronchial epithelial cells. J. Immunol. 165: 2205-2213. [Abstract/Free Full Text]
  27. Panina-Bordignon, P., A. Papi, M. Mariani, P. Di Lucia, G. Casoni, C. Bellettato, C. Buonsanti, D. Miotto, C. Mapp, A. Villa, et al 2001. The C-C chemokine receptors CCR4 and CCR8 identify airway T cells of allergen-challenged atopic asthmatics. J. Clin. Invest. 107: 1357-1364. [Medline]
  28. Liu, L., N. N. Jarjour, W. W. Busse, E. A. Kelly. 2004. Enhanced generation of helper T type 1 and 2 chemokines in allergen-induced asthma. Am. J. Respir. Crit. Care Med. 169: 1118-1124. [Abstract/Free Full Text]
  29. Ying, S., B. O’Connor, J. Ratoff, Q. Meng, K. Mallett, D. Cousins, D. Robinson, G. Zhang, J. Zhao, T. H. Lee, C. Corrigan. 2005. Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity. J. Immunol. 174: 8183-8190. [Abstract/Free Full Text]
  30. Berin, M. C., L. Eckmann, D. H. Broide, M. F. Kagnoff. 2001. Regulated production of the T helper 2-type T-cell chemoattractant TARC by human bronchial epithelial cells in vitro and in human lung xenografts. Am. J. Respir. Cell Mol. Biol. 24: 382-389. [Abstract/Free Full Text]
  31. Wirnsberger, G., D. Hebenstreit, G. Posselt, J. Horejs-Hoeck, A. Duschl. 2006. IL-4 induces expression of TARC/CCL17 via two STAT6 binding sites. Eur. J. Immunol. 36: 1882-1891. [Medline]
  32. Komine, M., T. Kakinuma, S. Kagami, Y. Hanakawa, K. Hashimoto, K. Tamaki. 2005. Mechanism of thymus- and activation-regulated chemokine (TARC)/CCL17 production and its modulation by roxithromycin. J. Invest. Dermatol. 125: 491-498. [Medline]
  33. Miotto, D., P. Christodoulopoulos, R. Olivenstein, R. Taha, L. Cameron, A. Tsicopoulos, A. B. Tonnel, O. Fahy, J. J. Lafitte, A. D. Luster, et al 2001. Expression of IFN-{gamma}-inducible protein; monocyte chemotactic proteins 1, 3, and 4; and eotaxin in Th1- and Th2-mediated lung diseases. J. Allergy Clin. Immunol. 107: 664-670. [Medline]
  34. Liddiard, K., J. S. Welch, J. Lozach, S. Heinz, C. K. Glass, D. R. Greaves. 2006. Interleukin-4 induction of the CC chemokine TARC (CCL17) in murine macrophages is mediated by multiple STAT6 sites in the TARC gene promoter. BMC Mol. Biol. 7: 45[Medline]
  35. Heijink, I. H., P. Marcel Kies, A. J. van Oosterhout, D. S. Postma, H. F. Kauffman, E. Vellenga. 2007. Der p, IL-4, and TGF-beta cooperatively induce EGFR-dependent TARC expression in airway epithelium. Am. J. Respir. Cell Mol. Biol. 36: 351-359. [Abstract/Free Full Text]
  36. Groskreutz, D. J., M. M. Monick, L. S. Powers, T. O. Yarovinsky, D. C. Look, G. W. Hunninghake. 2006. Respiratory syncytial virus induces TLR3 protein and protein kinase R, leading to increased double-stranded RNA responsiveness in airway epithelial cells. J. Immunol. 176: 1733-1740. [Abstract/Free Full Text]
  37. Cameron, R., C. Buck, D. Merrill, A. Luttick. 2003. Identification of contaminating adenovirus type 1 in the ATCC reference strain of respiratory syncytial virus A2 (VR-1302). Virus Res. 92: 151-156. [Medline]
  38. Thomas, K. W., M. M. Monick, J. M. Staber, T. Yarovinsky, A. B. Carter, G. W. Hunninghake. 2002. Respiratory syncytial virus inhibits apoptosis and induces NF-{kappa}B activity through a phosphatidylinositol 3-kinase-dependent pathway. J. Biol. Chem. 277: 492-501. [Abstract/Free Full Text]
  39. Butler, N. S., M. M. Monick, T. O. Yarovinsky, L. S. Powers, G. W. Hunninghake. 2002. Altered IL-4 mRNA stability correlates with Th1 and Th2 bias and susceptibility to hypersensitivity pneumonitis in two inbred strains of mice. J. Immunol. 169: 3700-3709. [Abstract/Free Full Text]
  40. Rudd, B. D., E. Burstein, C. S. Duckett, X. Li, N. W. Lukacs. 2005. Differential role for TLR3 in respiratory syncytial virus-induced chemokine expression. J. Virol. 79: 3350-3357. [Abstract/Free Full Text]
  41. Liu, P., M. Jamaluddin, K. Li, R. P. Garofalo, A. Casola, A. R. Brasier. 2006. Retinoic acid inducible gene-I mediates early anti-viral response and Toll like receptor 3 expression in respiratory syncytial virus-infected airway epithelial cells. J. Virol. 81: 1401-1411. [Medline]
  42. Zhang, Y., B. A. Luxon, A. Casola, R. P. Garofalo, M. Jamaluddin, A. R. Brasier. 2001. Expression of respiratory syncytial virus-induced chemokine gene networks in lower airway epithelial cells revealed by cDNA microarrays. J. Virol. 75: 9044-9058. [Abstract/Free Full Text]
  43. Varga, S. M., E. L. Wissinger, T. J. Braciale. 2000. The attachment (G) glycoprotein of respiratory syncytial virus contains a single immunodominant epitope that elicits both Th1 and Th2 CD4+ T cell responses. J. Immunol. 165: 6487-6495. [Abstract/Free Full Text]
  44. Varga, S. M., N. A. Beckman, M. Chu, T. J. Braciale. 2002. Sensitive detection and quantitation of mouse eosinophils in tissues using an enzymatic eosinophil peroxidase assay: its use to rapidly measure pulmonary eosinophilia during experimental respiratory syncytial virus infection of mice. J. Immunol. Methods 262: 111-120. [Medline]
  45. Lukacs, N. W., M. L. Moore, B. D. Rudd, A. A. Berlin, R. D. Collins, S. J. Olson, S. B. Ho, R. S. Peebles, Jr. 2006. Differential immune responses and pulmonary pathophysiology are induced by two different strains of respiratory syncytial virus. Am. J. Pathol. 169: 977-986. [Abstract/Free Full Text]
  46. Monick, M. M., K. Cameron, L. S. Powers, N. S. Butler, D. McCoy, R. K. Mallampalli, G. W. Hunninghake. 2004. Sphingosine kinase mediates activation of extracellular signal-related kinase and Akt by respiratory syncytial virus. Am. J. Respir. Cell Mol. Biol. 30: 844-852. [Abstract/Free Full Text]
  47. Durbin, J. E., T. R. Johnson, R. K. Durbin, S. E. Mertz, R. A. Morotti, R. S. Peebles, B. S. Graham. 2002. The role of IFN in respiratory syncytial virus pathogenesis. J. Immunol. 168: 2944-2952. [Abstract/Free Full Text]
  48. Fiedler, M. A., K. Wernke-Dollries, J. M. Stark. 1995. Respiratory syncytial virus increases IL-8 gene expression and protein release in A549 cells. Am. J. Physiol. 269: L865-L872. [Medline]
  49. Hacking, D., J. Hull. 2002. Respiratory syncytial virus: viral biology and the host response. J. Infect. 45: 18-24. [Medline]
  50. John, A. E., A. A. Berlin, N. W. Lukacs. 2003. Respiratory syncytial virus-induced CCL5/RANTES contributes to exacerbation of allergic airway inflammation. Eur. J. Immunol. 33: 1677-1685. [Medline]
  51. Mastronarde, J. G., B. He, M. M. Monick, N. Mukaida, K. Matsushima, G. W. Hunninghake. 1996. Induction of interleukin (IL)-8 gene expression by respiratory syncytial virus involves activation of nuclear factor (NF)-{kappa}B and NF-IL-6. J. Infect. Dis. 174: 262-267. [Medline]
  52. Monick, M. M., J. M. Staber, K. W. Thomas, G. W. Hunninghake. 2001. Respiratory syncytial virus infection results in activation of multiple protein kinase C isoforms leading to activation of mitogen-activated protein kinase. J. Immunol. 166: 2681-2687. [Abstract/Free Full Text]
  53. Oh, J. W., H. B. Lee, I. K. Park, J. O. Kang. 2002. Interleukin-6, interleukin-8, interleukin-11, and interferon-{gamma} levels in nasopharyngeal aspirates from wheezing children with respiratory syncytial virus or influenza A virus infection. Pediatr. Allergy Immunol. 13: 350-356. [Medline]
  54. Faffe, D. S., T. Whitehead, P. E. Moore, S. Baraldo, L. Flynt, K. Bourgeois, R. A. Panettieri, S. A. Shore. 2003. IL-13 and IL-4 promote TARC release in human airway smooth muscle cells: role of IL-4 receptor genotype. Am. J. Physiol. 285: L907-L914.
  55. Guerrero-Plata, A., S. Baron, J. S. Poast, P. A. Adegboyega, A. Casola, R. P. Garofalo. 2005. Activity and regulation of {alpha} interferon in respiratory syncytial virus and human metapneumovirus experimental infections. J. Virol. 79: 10190-10199. [Abstract/Free Full Text]
  56. Liu, P., M. Jamaluddin, K. Li, R. P. Garofalo, A. Casola, A. R. Brasier. 2007. Retinoic acid-inducible gene I mediates early antiviral response and Toll-like receptor 3 expression in respiratory syncytial virus-infected airway epithelial cells. J. Virol. 81: 1401-1411. [Abstract/Free Full Text]
  57. Vestergaard, C., M. Deleuran, B. Gesser, C. G. Larsen. 2004. Thymus- and activation-regulated chemokine (TARC/CCL17) induces a Th2-dominated inflammatory reaction on intradermal injection in mice. Exp. Dermatol. 13: 265-271. [Medline]
  58. Bisset, L. R., P. Schmid-Grendelmeier. 2005. Chemokines and their receptors in the pathogenesis of allergic asthma: progress and perspective. Curr. Opin. Pulm. Med. 11: 35-42. [Medline]
  59. Chau, T. S., W. P. Lai, P. Y. Cheung, M. J. Favus, M. S. Wong. 2005. Age-related alteration of vitamin D metabolism in response to low-phosphate diet in rats. Br. J. Nutr. 93: 299-307. [Medline]
  60. Vockerodt, M., D. Pinkert, S. Smola-Hess, A. Michels, R. M. Ransohoff, H. Tesch, D. Kube. 2005. The Epstein-Barr virus oncoprotein latent membrane protein 1 induces expression of the chemokine IP-10: importance of mRNA half-life regulation. Int. J. Cancer. 114: 598-605. [Medline]
  61. Hebenstreit, D., P. Luft, A. Schmiedlechner, G. Regl, A. M. Frischauf, F. Aberger, A. Duschl, J. Horejs-Hoeck. 2003. IL-4 and IL-13 induce SOCS-1 gene expression in A549 cells by three functional STAT6-binding motifs located upstream of the transcription initiation site. J. Immunol. 171: 5901-5907. [Abstract/Free Full Text]
  62. Hebenstreit, D., G. Wirnsberger, J. Horejs-Hoeck, A. Duschl. 2006. Signaling mechanisms, interaction partners, and target genes of STAT6. Cytokine Growth Factor Rev. 17: 173-188. [Medline]
  63. Chatila, T. A.. 2004. Interleukin-4 receptor signaling pathways in asthma pathogenesis. Trends Mol. Med. 10: 493-499. [Medline]
  64. Valineva, T., J. Yang, R. Palovuori, O. Silvennoinen. 2005. The transcriptional co-activator protein p100 recruits histone acetyltransferase activity to STAT6 and mediates interaction between the CREB-binding protein and STAT6. J. Biol. Chem. 280: 14989-14996. [Abstract/Free Full Text]
  65. Paulson, M., S. Pisharody, L. Pan, S. Guadagno, A. L. Mui, D. E. Levy. 1999. Stat protein transactivation domains recruit p300/CBP through widely divergent sequences. J. Biol. Chem. 274: 25343-25349. [Abstract/Free Full Text]
  66. Zhang, J. J., U. Vinkemeier, W. Gu, D. Chakravarti, C. M. Horvath, J. E. Darnell, Jr. 1996. Two contact regions between Stat1 and CBP/p300 in interferon {gamma} signaling. Proc. Natl. Acad. Sci. USA 93: 15092-15096. [Abstract/Free Full Text]
  67. Hiroi, M., Y. Ohmori. 2003. The transcriptional coactivator CREB-binding protein cooperates with STAT1 and NF-{kappa}B for synergistic transcriptional activation of the CXC ligand 9/monokine induced by interferon-{gamma} gene. J. Biol. Chem. 278: 651-660. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. R. Olson, S. M. Hartwig, and S. M. Varga
The Number of Respiratory Syncytial Virus (RSV)-Specific Memory CD8 T Cells in the Lung Is Critical for Their Ability to Inhibit RSV Vaccine-Enhanced Pulmonary Eosinophilia
J. Immunol., December 1, 2008; 181(11): 7958 - 7968.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. A. Hudson, G. P. Christophi, R. C. Gruber, J. R. Wilmore, D. A. Lawrence, and P. T. Massa
Induction of IL-33 expression and activity in central nervous system glia
J. Leukoc. Biol., September 1, 2008; 84(3): 631 - 643.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monick, M. M.
Right arrow Articles by Hunninghake, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monick, M. M.
Right arrow Articles by Hunninghake, G. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS