|
|
||||||||
Division of Mucosal Immunology, Department of Microbiology and Immunology, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although an increasing number of patients suffer from food allergies, appropriate prevention and treatment methods for allergic diseases have not been fully developed because the underlying molecular and cellular pathological mechanisms are not well understood. To clarify the mechanisms whereby food allergies are induced, we previously established a murine food allergy model using OVA as a model allergen (7). In this model, mice were systemically primed with OVA and subsequently challenged with OVA via the oral route on several occasions. After oral challenge, mice developed severe diarrhea in an allergen-specific manner. The allergic diarrhea required aberrant Th2-type responses, such as an elevated production of IL-4, IL-5, and IL-13 by the spleen and large intestine and high levels of OVA-specific serum IgE (7). In a separate study, we showed that a pathologic Th2-type environment was induced by the predominant expression of homodimer of IL-12 p40, which acted as an antagonist to heterodimeric IL-12 (p40 and p35) to trigger the shift from a Th1 to Th2 environment (8). Therefore, if the pathogenic Th2-dominant environment could be shifted to a Th1-dominant one by intranasal administration of plasmid DNA encoding the heterodimer of IL-12, allergic diarrhea could be prevented or effectively treated (9). Our previous studies also revealed that systemically primed CD4+ T cells preferentially migrated from the spleen into the large intestine after repeated oral challenge, accounting for the development of an allergic reaction and clinical symptoms (7, 10). On the basis of these findings, we speculated that, in addition to the alteration of the Th1/Th2 balance, the migration of pathogenic CD4+ T cells from the spleen into the large intestine might be a crucial step in the initiation of intestinal allergic responses that could be targeted to prevent disease development. In addition, several studies by other research groups using the murine allergic model revealed that infiltration of pathogenic cells such as mast cells, eosinophils, and CD4+ T cells caused gastroenteropathy or gastrointestinal hypersensitivity (11, 12).
Sphingosine 1-phosphate (S1P),3 a sphingolipid metabolite secreted mainly by platelets and mast cells, acts as a ligand for S1P receptors (13, 14). At present, five types of receptor have been identified (15), all of which share the same ligand (S1P) but each of which is associated with a different type of G protein, resulting in distinct signal transduction (15). Past research has shown that type 1 S1P receptor (S1P1) couples to Gi protein; S1P2 and S1P3 receptors couple to Gi, Gq, and G13 proteins; and S1P5 couples to Gi/o and G12 proteins (15). By activating small GTPases, such as Rho and Rac, S1P mediates cell migration via S1P1 (15). These observations suggest that S1P is multivalent, interacting with each receptor. Much is known about the role played by S1P in the regulation of lymphocyte trafficking, especially its roles in mediating lymphocyte emigration from the secondary lymphoid organs and thymus (13, 14). FTY720, a modulator for S1P receptors except the type 2 receptor, blocks S1P-mediated signaling by inducing internalization of the receptors from the cell surface (16, 17, 18). Thus, FTY720 prevents lymphocyte egress from the thymus and secondary lymphoid organs and thereby inhibits their infiltration into the inflammatory area (19). Because of these attractive immunologic features, FTY720 has been studied as potentially useful for the treatment of autoimmune diseases and the complications arising from transplantation (20, 21, 22). For instance, FTY720 treatment effectively inhibited aberrant T cell migration for the prevention of colitis, airway inflammation, and graft-versus-host disease (21, 22, 23, 24).
In addition to the regulation of lymphocyte trafficking, the interaction of S1P with its receptors is involved in the regulation of the cellular functions causing the allergic reactions (e.g., mast cells, eosinophils, and macrophages) (14). For instance, cross-linking Fc
RI with IgE enhances S1P production by mast cells, and S1P reciprocally regulates the activation and trafficking of mast cells (25, 26, 27, 28). In addition, i.p. administration of S1P induces the infiltration of eosinophils into the peritoneal cavity by enhancing CCR3-RANTES-dependent chemotaxis (29). Together with the result of an additional report indicating increased S1P secretion after allergen challenge in asthma (30), these findings have led us to propose the targeting of S1P-mediated trafficking of pathogenic cells (e.g., Th2 cells, mast cells, and eosinophils) as a potential strategy for preventing and treating food allergy.
In the current study, we used FTY720 to disrupt the trafficking of pathogenic cells between the systemic and mucosal compartments and thereby prevent and treat allergic diarrhea. Among the candidate effector cells purported to be involved in the development of intestinal allergies, allergen-sensitized CD4+ T cells expressed high levels of S1P1. We demonstrated that FTY720 critically inhibited the infiltration of systemically primed CD4+ T cells into the large intestine after repeated oral challenge with the same allergen. The inhibition of CD4+ T cell migration was associated with impaired mast cell but not eosinophil infiltration into the large intestine. This study therefore offers a novel approach to the control of intestinal allergic disease by targeting the S1P-mediated pathogenic trafficking pathway of effector cells between the systemic and mucosal compartments.
| Materials and Methods |
|---|
|
|
|---|
Female BALB/c mice and BALB/c nude mice, age 6–8 wk, were purchased from Japan CLEA or Japan SLC. GFP transgenic mice were provided by Dr. M. Okabe (Osaka University, Osaka, Japan) (31). All mice were provided with sterile food and water ad libitum. OVA-specific allergic diarrhea was induced as previously described (7, 8, 9, 32). Briefly, mice were primed by s.c. injection of 1 mg of OVA (Sigma-Aldrich) in CFA (Difco). One week after systemic priming, the mice were challenged orally with 50 mg of OVA and continued to be challenged three times each week.
For the treatment with FTY720, we used a previously established protocol (17, 23, 33), injecting mice i.p. with FTY720 (1 mg/kg per injection; Novartis Pharma) daily starting 1 day before systemic priming and continuing through oral allergen inoculation until the tenth postinoculation. For the splenectomy experiment, spleens were removed before systemic priming or the first, third, or eight oral challenge as previously described (34). All animals were maintained in the experimental animal facility at the University of Tokyo (Tokyo, Japan) and experiments were conducted in accordance with the guidelines provided by the Animal Care and Use Committee of the University of Tokyo.
Lymphocyte isolation
Lymphocytes were isolated from the spleen, mesenteric lymph nodes (MLNs), Peyers patches (PPs), and large intestine as previously described (7, 8, 9, 10, 33, 35, 36). Briefly, single-cell suspensions were prepared from the spleen and MLNs by passing them through a 70-µm mesh filter. To isolate lymphocytes from PP, the tissues were stirred in 1 mg/ml collagenase S-1 (Nitta Gelatin). Similarly, after removing epithelium by stirring in RPMI 1640 containing 1 mM EDTA and 2% FCS, large intestinal lymphocytes were isolated by collagenase treatment. Lymphocytes were further purified by discontinuous Percoll gradient centrifugation (40% and 75% layers).
Mast cell culture, in vitro migration assay, and cytokine production assay
To obtain bone marrow-derived mast cells, cells isolated from the femur are cultured for 5–8 wk in medium conditioned with WEHI-3 cells from American Type Culture Collection (ATCC) as previously described (37). The mast cells were purified by using CD117 magnetic beads (Miltenyi Biotec) and then used in an in vitro migration assay in accordance with a previously established method (26). Briefly, the upper chambers of the Transwell plate (5-µm pore) were coated with 20 µg/ml fibronectin (Invitrogen Life Technologies) for 12 h and blocked for 1 h with PBS containing 3% BSA at 37°C. Mast cells were pretreated with 2 µg/ml anti-DNP IgE (clone SPE-7; Sigma-Aldrich) in the presence of 0, 20, or 200 nM FTY720 for 12 h. After washing, pretreated 106 mast cells were added to the upper chamber together with 0, 20, or 200 nM FTY720. The 20 ng/ml DNP-human serum albumin (HSA) was placed in the lower wells. After a 6-h incubation, the surviving mast cells in the lower wells were counted by using trypan blue staining in a hemocytometer. For the cytokine assay, MC/9 cells (ATCC) were stimulated for 4 h with 1 µg/ml anti-DNP IgE and 30 ng/ml DNP-HSA and 0, 20, or 200 nM FTY720. The amount of TNF-
and IL-5 was measured by a cytometric bead array system in accordance with the manufacturers instructions (BD Pharmingen).
Flow cytometric analysis and cell sorting
A standard protocol was used for cell staining and subsequent flow cytometry (33, 35). Briefly, cells were incubated with 5 µg/ml anti-CD16/32 Ab (Fc block; BD Pharmingen) for 5 min and stained with fluorescently labeled Abs specific for B220, c-kit, IgE, CD4, CD69,
4
7 integrin (BD Pharmingen), CCR3 (R&D Systems), and Fc
RI
(eBioscience) for 30 min at 4°C. A Viaprobe (BD Pharmingen) was used to discriminate between dead and live cells. Flow cytometric analysis and cell sorting were performed using FACSCalibur and FACSAria (BD Biosciences), respectively.
Adoptive transfer experiment
Splenic CD4+ T cells were isolated from systemically primed GFP transgenic BALB/c mice by cell sorting before being i.v. transferred to SCID mice according to a previously described protocol (7). The reconstituted SCID mice were orally administrated with 50 mg of OVA three times per week (7). One week after the adoptive transfer, lymphocytes were isolated from the large intestine and analyzed by flow cytometry as described in the preceding paragraph.
Quantitative RT-PCR
To elucidate mRNA expression for S1P receptors, quantitative RT-PCR using a LightCycler (Roche Diagnostics) was performed as previously described (33). TRIzol (Invitrogen Life Technologies) and Powerscript Reverse Transcriptase (BD Biosciences) were used for total RNA isolation and complementary DNA synthesis, respectively. The oligonucleotide primers and probes for S1P1 (forward) TACACTCTGACCAACAAGGA, (reverse) ATAATGGTCTCTGGGTTGTC, (FITC probe) TGCTGGCAATTCAATTCAAGAGGCCCATCATC, (LCRed 640 probe) CAGGCATGGAATTTAGCCGCAGCAAATC; and for GAPDH (forward) TGAACGGGAAGCTCACTGG, (reverse) TCCACCACCCTGTTGCTGTA, (FITC probe) CTGAGGACCAGGTTGTCTCCTGCGA, (LCRed 640 probe) TTCAACAGCAACTCCCACTCTTCCACC) were designed and produced by Nihon Gene Research Laboratory (Sendai, Japan) (33).
Analysis of total and OVA-specific Ab production by ELISA
To measure OVA-specific IgE, microtiter plates were coated with purified anti-mouse IgE Ab (BD Pharmingen) and blocked with PBS containing 3% BSA. Diluted serum samples were added to the plates, which were then incubated for 4 h at room temperature before being washed four times with PBS containing 0.05% Tween 20. Biotin-labeled OVA was added and the plates were then incubated with HRP-conjugated anti-biotin Ab (Vector Laboratories). The reaction was developed by 3,3',5,5'-tetramethylbenzidine (Moss), and color development was terminated by the addition of 0.5 N HCl. Endpoint titers were expressed as the reciprocal log2 of the last dilution, which gave an OD at 450 nm of 0.1 greater than in nonimmunized mice. The total IgE was measured with a mouse IgE ELISA kit in accordance with the manufacturers instructions (Yamasa).
T cell proliferation assay and measurement of cytokine production
CD4+ T cells purified from the spleen, MLNs, and PP using CD4-coupled magnetic beads (Miltenyi Biotec) and mononuclear cells from large intestinal lamina propria were used for the proliferation assay and for the measurement of cytokine production as previously reported (7, 35). Briefly, cells were incubated for 72 h with 1 mg/ml OVA in the presence of irradiated (3000 rad) splenocytes. To measure cell proliferation, 1 µCi of [3H]thymidine was added to each well 8 h before termination, and the uptake of [3H]thymidine was determined by scintillation counting. To measure cytokine production, the amounts of cytokines (e.g., IL-4, IL-5, and IFN-
) in the culture supernatant were measured by the cytometric bead array system in accordance with the manufacturers instructions (BD Pharmingen).
Histological analysis
Immunohistochemical analysis was performed as previously described (7). For immunohistochemical analysis, the large intestine was fixed in 4% paraformaldehyde (Wako) and incubated in 20% sucrose. The tissues were embedded in OCT compound (Sakura Fine Technical Company). H&E staining was used to detect eosinophils (7). Similarly, intestinal mast cells were subjected to naphthol AS-D chloroacetate esterase staining (Sigma-Aldrich) and counterstained with hematoxylin (38).
Statistical analysis
The results were compared using a Students t test or Welchs t test. Statistical significance was established at a value for p < 0.05.
| Results |
|---|
|
|
|---|
We previously reported that systemically primed splenocytes preferentially migrated into the large intestine after repeated oral challenge with the same Ag; the splenocytes that migrated into the large intestine contributed to the development of severe allergic diarrhea (7). However, it remained unclear whether the spleen was directly involved in the intestinal allergy development, such as in the generation of pathogenic T cells. In the current study, our first experiment examined the induction of allergic diarrhea in splenectomized mice. Consistent with our previous results (7, 8, 9, 32), oral challenge (n = 4–10) with OVA resulted in severe diarrhea in spleen sham-treated (or intact) mice systemically primed with the same Ag (Fig. 1A). In contrast, the incidence of allergic diarrhea was reduced in splenectomized mice (Fig. 1A). To investigate the role of T cells in the induction of allergic diarrhea, we examined whether allergic responses were induced in nude mice lacking functional T cells due to their thymus deficiency. We found that systemically sensitized nude mice did not show any sign of allergic responses following exposure to oral allergen (Fig. 1A). These results further emphasize the importance of the spleen as an essential site for the induction and establishment of intestinal allergic responses.
|
Association of S1P1 expression with the development of allergic diarrhea
S1P regulates the trafficking of lymphocytes, especially in their egress step from secondary lymphoid organs (13, 14). Because effector cell trafficking between the spleen and large intestine plays a crucial role in the induction of allergic diarrhea (7), we sought to investigate the possible contribution of the S1P1 to trafficking by performing quantitative RT-PCR to measure the level of mRNA encoding S1P1 in splenic CD4+ T cells (Fig. 2). S1P1 expression was low in systemically primed mice without oral challenge that did not develop intestinal allergic symptoms, compared with expression levels in naive CD4+ T cells (Fig. 2). In contrast, S1P1 expression was recovered and increased in diseased mice receiving both systemic priming and repeated oral challenge (Fig. 2). The difference in S1P1 expression in CD4+ T cells from mice with diarrhea (systemic priming plus oral challenge) and mice showing no symptoms (systemic priming only) may imply the involvement of the S1P1 receptor-mediated pathway in the cell trafficking of effector CD4+ T cells from the spleen to the large intestine for the induction of intestinal allergic responses.
|
The findings we report in this study (Figs. 1 and 2) lead us to speculate that manipulation of the S1P-mediated pathway could help control allergic diarrhea by inhibiting allergen-specific CD4+ T cell migration from the spleen into the large intestine. To test this hypothesis, we used FTY720 as an agonist for S1P receptors, thereby inhibiting lymphocyte egress from lymphoid organs (16, 17, 18). Mice were treated with FTY720 beginning the day before systemic priming and continuing throughout the period of OVA administration. The induction of allergic diarrhea was completely abolished in the FTY720-treated mice (Fig. 3, A and B). We next sought to examine whether the priming or challenge stage was more important for development of the disease by administering FTY720 either once before systemic priming or before every oral challenge, respectively (Fig. 3C). When administered before oral challenge, FTY720 successfully inhibited the development of allergic diarrhea (Fig. 3C), but the drug had only minimal beneficial effects when administered solely before systemic priming. These results indicate that FTY720 selectively affects cell trafficking from the spleen to the large intestine during oral challenge.
|
To examine whether FTY720 actually affected the migration of systemically primed CD4+ T cells from the spleen into the large intestine, we examined the influence of FTY720 on activated CD4+ T cells in the spleen and large intestine. After in vivo treatment with FTY720, the percentage of activated CD69-expressing CD4+ cells in the spleen increased but the percentage in the large intestinal lamina propria declined (Fig. 4A), indicating that activated T cells were prevented from migrating from the spleen to the large intestine. To determine whether FTY720 also could inhibit CD4+ T cell infiltration into the large intestine, we performed an adoptive transfer experiment in GFP transgenic mice (Fig. 4B). We prepared splenic CD4+ T cells from systemically primed GFP transgenic mice, adoptively transferred them via the i.v. route into SCID mice, and then repeatedly challenged those mice with OVA (Fig. 4B); 1 wk after the third oral OVA challenge, we isolated mononuclear cells from the large intestinal lamina propria and counted the number of infiltrated CD4+ T cells. We found that FTY720 treatment dramatically decreased the infiltration of GFP-positive systemically primed CD4+ T cells into the large intestine (Fig. 4B). These results demonstrate that FTY720 suppressed the preferential infiltration of systemically primed T cells into the large intestine, which was initiated by oral allergen challenge.
|
We next elucidated the contribution of allergen-specific T cells in the spleen and their responses to FTY720 treatment during the process of allergic diarrhea development. An OVA-induced T cell proliferation assay showed that the degree of OVA-specific proliferative response by splenic CD4+ T cells isolated from FTY720-treated mice was similar to or slightly higher than the response from mock-treated mice (Fig. 5A). We also examined OVA-specific T cell proliferation in PPs and MLNs; these gut-associated lymphoid tissues are well-known contributors to the induction of immune responses against ingested Ag (1, 2). CD4+ T cells in PPs and MLNs showed less proliferative responses than did splenic T cells, and FTY720 did not affect these allergen-specific T cell responses (Fig. 6A). We then demonstrated a reduction of IL-4 production in the spleen, PPs, and MLNs of mice treated with FTY720 (Figs. 5B and 6B). These findings suggest that the FTY720 treatment inhibits IL-4 production by OVA-specific CD4+ T cells.
|
|
FTY720 treatment alters mast cell, but not eosinophil, infiltration into the large intestine
Eosinophils are inflammatory cells that are thought to be involved in allergic diseases in mice and humans, although this issue is a subject of debate (12, 39). We next investigated whether FTY720 inhibited intestinal eosinophilia. According to the criteria outlined in a previous study (40), we defined eosinophils as those cells in CD4– populations that expressed CCR3 and the
4
7 integrin. Flow cytometric analysis revealed that FTY720 treatment did not reduce eosinophil numbers in the large intestine (Fig. 7A). The conclusion was further confirmed by H&E staining, which showed similar distributions of eosinophils in the large intestines of FTY720-treated and nontreated mice (Fig. 7A). These results suggest that eosinophils are not targets of FTY720.
|
RI
Abs (data not shown). Naphthol AS-D chloroacetate esterase staining further confirmed this observation (Fig. 7B). Therefore, treatment with FTY720 effectively inhibited the accumulation of mast cells at the disease site. Two-layered effects of FTY720 on mast cell trafficking
Inasmuch as the FTY720 treatment specifically affected mast cells, we examined whether intestinal mast cells expressed S1P1. Consistent with the results of a previous study (26), lamina propria mast cells expressed S1P1 (Fig. 8A). In agreement with the effects of FTY720 on mast cells but not eosinophils (Fig. 7), the expression of S1P1 on lamina propria mast cells was much higher than expression on eosinophils (Fig. 8A). We then performed an in vitro assay using bone marrow-derived mast cells to examine whether FTY720 directly inhibited mast cell migration. We revealed that mast cells treated with Ag-specific (DNP) IgE were triggered to migrate by the corresponding Ag (DNP), but also that this migration was impaired by treatment with FTY720 (Fig. 8B). We measured Fc
RI
on mast cells because some regulatory cytokines, including TGF-
and IL-10, directly inhibit Fc
RI expression in mast cells and subsequently prevent their interaction with Ag (41, 42). In vitro culture of mast cells with physiological concentrations of S1P or FTY720 did not alter Fc
RI expression, whereas TGF-
1 reduced Fc
RI
expression (Fig. 8C) as previously reported (42). Additional analyses revealed that FTY720 treatment inhibited IL-5 production but not TNF-
production from allergen-stimulated mast cells (Fig. 8D). This finding is consistent with a previous report demonstrating that FTY720 inhibited PGD2 production from mast cells without affecting their degranulation and TNF-
production (28). These findings suggest that FTY720 selectively inhibits specific biologic functions (e.g., IL-5 production) of intestinal mast cells.
|
RI
and subsequently induce degranulation in response to a corresponding systemically administered allergen. As an additional layer in the inhibitory mechanism of FTY720, we found that lymphocytes in the large intestinal lamina propria of FTY720-treated mice showed impaired production of IL-4 and IL-5 (Fig. 8F), cytokines that activate and recruit mast cells (43, 44). Therefore, it is plausible that FTY720 hampers mast cell migration into the large intestine by both direct inhibition of S1P-mediated mast cell migration and indirect effects on Th2-associated cytokine production for mast cell migration or activation. Both of these effects may be critical factors in FTY720-associated inhibition of allergic diarrhea. | Discussion |
|---|
|
|
|---|
Our current results indicate that allergic responses are inhibited when activated CD4+ T cells are prevented from migrating from the spleen into the large intestine at the sensitization phase, because that migration is the pathway responsible for the induction of aberrant allergic responses. Therefore, removing the spleen during systemic sensitization impaired the development of allergic diarrhea, whereas splenectomy during oral challenge failed to prevent allergic diarrhea (Fig. 1). In this experiment, we noted that
30% of splenectomized mice still showed allergic symptoms, a finding suggesting that other lymph nodes may compensate for the spleen as a site for priming allergen-specific CD4+ T cells (Fig. 1). However, FTY720 treatment completely inhibited the development of allergic diarrhea (Fig. 3, A and B). Therefore, it seems that FTY720 prevents the migration of pathogenic cells from the spleen and possibly other systemic lymphoid tissues into the large intestine.
There is now increased evidence that naive lymphocytes express high levels of S1P1; that expression is down-regulated when lymphocytes are activated by T cell receptors and then up-regulated once again to promote egress from lymphoid organs (17, 47). Consistent with this fact, splenic CD4+ T cells showed a temporal reduction in S1P1 expression after systemic priming (Fig. 2). The reduction seemed to allow cells to remain in the spleen until they once again had an opportunity to be activated and subsequently begin their egress from the spleen. S1P1 expression was restored by repeated oral challenge, which enabled the cells to migrate to the large intestine in an S1P-dependent manner.
In addition to CD4+ T cells, accumulating evidence demonstrates that dendritic cells express S1P1 and that FTY720 treatment inhibits their migration to draining lymph nodes (48, 49, 50). A recent study revealed that local treatment with FTY720 inhibited the migration of dendritic cells from the lung to the mediastinal lymph nodes, leading to impaired formation of allergen-specific Th2 cells in lymph nodes (51). Therefore, it is also possible that FTY720 may inhibit the migration of dendritic cells from the intestine to the draining lymph nodes, subsequently preventing the activation of CD4+ T cells in the large intestine.
Although our current findings clearly suggest that FTY720 effectively targeted the S1P-mediated migration pathway between the systemic and large intestinal compartments and thereby helped to prevent allergic diarrhea, we still do not know the exact molecular mechanism for the S1P-dependent preferential migration of systemically primed pathogenic CD4+ T cells from the spleen to the large intestine. Indeed, our previous and current findings suggested that, after repeated oral challenge, pathogenic T cells were preferentially located in the large intestine but not in the small intestine, MLNs, and PPs (7) (Fig. 6). In relation to this issue, our group has recently demonstrated that PP provide a milieu for inducing regulatory T cells for the control of food allergy (32). In particular, PPs-null mice were more susceptible to developing allergic diarrhea than were PPs-intact mice. Therefore, it is plausible that these regulatory T cells in the PP might prevent the migration, proliferation, or activation of pathogenic T cells in the small intestinal compartment.
We also observed that mast cell migration into the large intestine was inhibited by the interruption of S1P- and S1P1-mediated molecular events by FTY720 (Fig. 7B). There are a number of possible underlying mechanisms for the regulation of mast cell trafficking into the large intestine. First, FTY720 might directly inhibit the migration of mast cells into the large intestine. Mast cells express S1P1 (26) and our data also confirmed that result (Fig. 8A). This idea is further supported by the data generated through our in vitro migration assay, which showed a direct suppressive effect of FTY720 on mast cell migration toward Ag (Fig. 8B). In agreement with this observation, mast cells capturing Ag-specific IgE preferentially migrated toward Ag in an S1P-dependent manner in previous studies (27, 52). Therefore, cross-linking of allergen-IgE complexes and Fc
RI can activate sphingosine kinase 1, resulting in the generation of S1P (26, 27). Transactivation of the S1P1-mediated Gi protein-signaling cascade is important in the rearrangement of the cytoskeleton and the migration of mast cells toward Ag (25, 26, 27).
In an alternative mechanism, pathogenic CD4+ T cells may guide mast cells to the large intestine via secretion of hypersensitivity-associated cytokines. To this end, IL-4 and IL-5, the major Th2 cytokines associated with allergic responses, have been shown to possess activity of mast cell activation and recruitment (43, 44) and promote switching of mast cell precursors to connective tissue- or mucosal-type mature mast cells in the presence of IL-3 (44). Our current results show that FTY720-induced inhibition of pathogenic T cell migration from the spleen to the large intestine led to simultaneous inhibition of IL-4 and IL-5 production (Fig. 8F), supporting the possibility that FTY720 treatment led to the inhibition of IL-4- and IL-5-mediated mast cell migration and activation in the large intestine. This idea is further supported by our recent and separate preliminary observations that repeated oral challenge did not induce the infiltration of mast cells into the large intestine of SCID mice that were adoptively transferred with or without mast cells pretreated with serum derived from mice with diarrhea (our unpublished observations).
The fact that we did not detect mast cells in the large intestine without oral challenge suggests the third possibility that mast cells infiltrated the large intestine only in the presence of allergen (data not shown). FTY720 thus may inhibit Ag transport from the intestinal lumen into the large intestine. Previous studies revealed that allergen transport under allergic conditions was enhanced by CD23 (Fc
RII) that was expressed on intestinal epithelial cells, and that enhancement protected allergen from degradation during the translocation (53). Perhaps, FTY720 negatively regulates CD23 expression on epithelial cells and reduces allergen transport into the large intestine, thus inhibiting mast cell migration. We also cannot disregard the possibility that interactions between mast cells and endothelial cells were disrupted by treatment with FTY720 because endothelial cells also express S1P receptors for the regulation of their barrier function (54). Continuous study will be required to shed further light on the molecular mechanisms of migration.
Although it showed remarkable effects on mast cell migration, FTY720 treatment did not affect eosinophil migration into the large intestine (Fig. 7A). Because human eosinophils express S1P receptors, including S1P1, and because S1P promotes CCR3-dependent migration in human eosinophils (29), modification of the eosinophils trafficking through the S1P-mediated pathway may offer a novel therapeutic strategy (39). However, to date no study has been done on S1P receptor expression on murine eosinophils. Our current experiment indicated that S1P1 expression was higher in mast cells than in eosinophils (Fig. 8A). These observations imply that the S1P-S1P1 dependency of murine eosinophils is much lower than that of mast cells and of human eosinophils, accounting for our observing fewer inhibitory effects of FTY720 on eosinophils in our murine intestinal allergy model. These findings indicate that eosinophils are not involved in the development of food allergy as a previous report demonstrated (12). This evidence strengthens the hypothesis that mast cells play a key role in the development of allergic diarrhea and that the inhibition of mast cell migration into the large intestine is a critical step in the FTY720-mediated inhibition of allergic diarrhea. Our study sheds the light on a novel approach to the prevention and treatment of intestinal allergic disease; targeting S1P-mediated pathogenic cell migration.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from Core Research for Evolutional Science and Technology (CREST) of the Japan Science and Technology Corporation (JST), the Ministry of Education, Science, Sports, and Culture, the Ministry of Health and Welfare in Japan, the Waksman Foundation, and Yakult Bio-Science Foundation. ![]()
2 Address correspondence and reprint requests to Dr. Hiroshi Kiyono, Division of Mucosal Immunology, Department of Microbiology and Immunology, The Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. E-mail address: kiyono{at}ims.u-tokyo.ac.jp ![]()
3 Abbreviations used in this paper: S1P, sphingosine 1-phosphate; S1P1, type 1 S1P receptor; HSA, human serum albumin; MLN, mesenteric lymph node; PP, Peyers patch. ![]()
Received for publication April 27, 2007. Accepted for publication May 20, 2007.
| References |
|---|
|
|
|---|
RI triggering is required for normal mast cell degranulation and chemotaxis. J. Exp. Med. 199: 959-970.
chain antibody-treated Peyers patch-null mice following intestinal immunization with microencapsulated antigen. Eur. J. Immunol. 32: 2347-2355. [Medline]
-chymase, mouse mast cell protease-1. Am. J. Pathol. 153: 491-504.
RI expression in mouse mast cells. J. Immunol. 172: 3181-3188.
1 inhibits mast cell Fc
RI expression. J. Immunol. 174: 5987-5993.
RII). J. Clin. Invest. 106: 879-886. [Medline]This article has been cited by other articles:
![]() |
J. Kunisawa, M. Gohda, Y. Kurashima, I. Ishikawa, M. Higuchi, and H. Kiyono Sphingosine 1-phosphate-dependent trafficking of peritoneal B cells requires functional NF{kappa}B-inducing kinase in stromal cells Blood, May 1, 2008; 111(9): 4646 - 4652. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gohda, J. Kunisawa, F. Miura, Y. Kagiyama, Y. Kurashima, M. Higuchi, I. Ishikawa, I. Ogahara, and H. Kiyono Sphingosine 1-Phosphate Regulates the Egress of IgA Plasmablasts from Peyer's Patches for Intestinal IgA Responses J. Immunol., April 15, 2008; 180(8): 5335 - 5343. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Oskeritzian, S. E. Alvarez, N. C. Hait, M. M. Price, S. Milstien, and S. Spiegel Distinct roles of sphingosine kinases 1 and 2 in human mast-cell functions Blood, April 15, 2008; 111(8): 4193 - 4200. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Q. Lai, H. H. Goh, Z. Bao, W. S. F. Wong, A. J. Melendez, and B. P. Leung The Role of Sphingosine Kinase in a Mur |