The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1577-1585
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kurashima, Y.
Right arrow Articles by Kiyono, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kurashima, Y.
Right arrow Articles by Kiyono, H.

Sphingosine 1-Phosphate-Mediated Trafficking of Pathogenic Th2 and Mast Cells for the Control of Food Allergy1

Yosuke Kurashima, Jun Kunisawa, Morio Higuchi, Masashi Gohda, Izumi Ishikawa, Naoko Takayama, Miki Shimizu and Hiroshi Kiyono2

Division of Mucosal Immunology, Department of Microbiology and Immunology, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Sphingosine 1-phosphate (S1P) has been proposed as a regulator of lymphocyte trafficking, but its role in mucosa-associated diseases, such as in food allergies, remains to be elucidated. To examine the role of S1P in allergic diseases in the intestine, we used a Th2 cell-mediated Ag-specific allergic diarrhea model and demonstrated that type 1 S1P receptor (S1P1) expression was preferentially associated with pathogenic CD4+ T cells for the development of allergic reactions. Consistent with this demonstration, treatment with FTY720, a modulator of the S1P1, prevented allergic diarrhea by inhibiting the migration of systemically primed pathogenic CD4+ T cells induced by oral challenge with allergen into the large intestine. In addition, FTY720 hampered mast cell infiltration into the large intestine, whereas eosinophil infiltration into the large intestine and total and allergen-specific serum IgE production were comparable between mock- and FTY720-treated groups. These results suggest that modulation of the S1P-mediated pathway to inhibit the migration of pathogenic CD4+ T cells and mast cells into the large intestine could be a novel strategy for preventing allergic diarrhea.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Situated in the gastrointestinal tract, one of the harshest environments in our body, both the small and large intestinal compartments are equipped with a highly orchestrated mucosal immune system to create and maintain an immunologically dynamic homeostasis between the host and the outside (1, 2). The gut mucosal immune system consists of numerous T cells, B cells, and APCs (e.g., dendritic cells and macrophages), which play important roles in the induction of protective immunity against pathogenic microorganisms invading the host via ingestion (3). Simultaneously, the intestinal mucosal immune system is capable of immunologic ignorance (i.e., oral tolerance) against nutritional Ags and commensal bacteria (4). These active and quiescent immune responses orchestrated by the intestinal immune system play a central role in the creation and maintenance of immunologic homeostasis in the intestine. Any disruption of that immunologic balance can lead to mucosa-associated immune diseases (e.g., inflammatory bowel diseases and food allergies) (5, 6).

Although an increasing number of patients suffer from food allergies, appropriate prevention and treatment methods for allergic diseases have not been fully developed because the underlying molecular and cellular pathological mechanisms are not well understood. To clarify the mechanisms whereby food allergies are induced, we previously established a murine food allergy model using OVA as a model allergen (7). In this model, mice were systemically primed with OVA and subsequently challenged with OVA via the oral route on several occasions. After oral challenge, mice developed severe diarrhea in an allergen-specific manner. The allergic diarrhea required aberrant Th2-type responses, such as an elevated production of IL-4, IL-5, and IL-13 by the spleen and large intestine and high levels of OVA-specific serum IgE (7). In a separate study, we showed that a pathologic Th2-type environment was induced by the predominant expression of homodimer of IL-12 p40, which acted as an antagonist to heterodimeric IL-12 (p40 and p35) to trigger the shift from a Th1 to Th2 environment (8). Therefore, if the pathogenic Th2-dominant environment could be shifted to a Th1-dominant one by intranasal administration of plasmid DNA encoding the heterodimer of IL-12, allergic diarrhea could be prevented or effectively treated (9). Our previous studies also revealed that systemically primed CD4+ T cells preferentially migrated from the spleen into the large intestine after repeated oral challenge, accounting for the development of an allergic reaction and clinical symptoms (7, 10). On the basis of these findings, we speculated that, in addition to the alteration of the Th1/Th2 balance, the migration of pathogenic CD4+ T cells from the spleen into the large intestine might be a crucial step in the initiation of intestinal allergic responses that could be targeted to prevent disease development. In addition, several studies by other research groups using the murine allergic model revealed that infiltration of pathogenic cells such as mast cells, eosinophils, and CD4+ T cells caused gastroenteropathy or gastrointestinal hypersensitivity (11, 12).

Sphingosine 1-phosphate (S1P),3 a sphingolipid metabolite secreted mainly by platelets and mast cells, acts as a ligand for S1P receptors (13, 14). At present, five types of receptor have been identified (15), all of which share the same ligand (S1P) but each of which is associated with a different type of G protein, resulting in distinct signal transduction (15). Past research has shown that type 1 S1P receptor (S1P1) couples to Gi protein; S1P2 and S1P3 receptors couple to Gi, Gq, and G13 proteins; and S1P5 couples to Gi/o and G12 proteins (15). By activating small GTPases, such as Rho and Rac, S1P mediates cell migration via S1P1 (15). These observations suggest that S1P is multivalent, interacting with each receptor. Much is known about the role played by S1P in the regulation of lymphocyte trafficking, especially its roles in mediating lymphocyte emigration from the secondary lymphoid organs and thymus (13, 14). FTY720, a modulator for S1P receptors except the type 2 receptor, blocks S1P-mediated signaling by inducing internalization of the receptors from the cell surface (16, 17, 18). Thus, FTY720 prevents lymphocyte egress from the thymus and secondary lymphoid organs and thereby inhibits their infiltration into the inflammatory area (19). Because of these attractive immunologic features, FTY720 has been studied as potentially useful for the treatment of autoimmune diseases and the complications arising from transplantation (20, 21, 22). For instance, FTY720 treatment effectively inhibited aberrant T cell migration for the prevention of colitis, airway inflammation, and graft-versus-host disease (21, 22, 23, 24).

In addition to the regulation of lymphocyte trafficking, the interaction of S1P with its receptors is involved in the regulation of the cellular functions causing the allergic reactions (e.g., mast cells, eosinophils, and macrophages) (14). For instance, cross-linking Fc{epsilon}RI with IgE enhances S1P production by mast cells, and S1P reciprocally regulates the activation and trafficking of mast cells (25, 26, 27, 28). In addition, i.p. administration of S1P induces the infiltration of eosinophils into the peritoneal cavity by enhancing CCR3-RANTES-dependent chemotaxis (29). Together with the result of an additional report indicating increased S1P secretion after allergen challenge in asthma (30), these findings have led us to propose the targeting of S1P-mediated trafficking of pathogenic cells (e.g., Th2 cells, mast cells, and eosinophils) as a potential strategy for preventing and treating food allergy.

In the current study, we used FTY720 to disrupt the trafficking of pathogenic cells between the systemic and mucosal compartments and thereby prevent and treat allergic diarrhea. Among the candidate effector cells purported to be involved in the development of intestinal allergies, allergen-sensitized CD4+ T cells expressed high levels of S1P1. We demonstrated that FTY720 critically inhibited the infiltration of systemically primed CD4+ T cells into the large intestine after repeated oral challenge with the same allergen. The inhibition of CD4+ T cell migration was associated with impaired mast cell but not eosinophil infiltration into the large intestine. This study therefore offers a novel approach to the control of intestinal allergic disease by targeting the S1P-mediated pathogenic trafficking pathway of effector cells between the systemic and mucosal compartments.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Allergic diarrhea induction, FTY720 treatment, and splenectomy in a murine model

Female BALB/c mice and BALB/c nude mice, age 6–8 wk, were purchased from Japan CLEA or Japan SLC. GFP transgenic mice were provided by Dr. M. Okabe (Osaka University, Osaka, Japan) (31). All mice were provided with sterile food and water ad libitum. OVA-specific allergic diarrhea was induced as previously described (7, 8, 9, 32). Briefly, mice were primed by s.c. injection of 1 mg of OVA (Sigma-Aldrich) in CFA (Difco). One week after systemic priming, the mice were challenged orally with 50 mg of OVA and continued to be challenged three times each week.

For the treatment with FTY720, we used a previously established protocol (17, 23, 33), injecting mice i.p. with FTY720 (1 mg/kg per injection; Novartis Pharma) daily starting 1 day before systemic priming and continuing through oral allergen inoculation until the tenth postinoculation. For the splenectomy experiment, spleens were removed before systemic priming or the first, third, or eight oral challenge as previously described (34). All animals were maintained in the experimental animal facility at the University of Tokyo (Tokyo, Japan) and experiments were conducted in accordance with the guidelines provided by the Animal Care and Use Committee of the University of Tokyo.

Lymphocyte isolation

Lymphocytes were isolated from the spleen, mesenteric lymph nodes (MLNs), Peyer’s patches (PPs), and large intestine as previously described (7, 8, 9, 10, 33, 35, 36). Briefly, single-cell suspensions were prepared from the spleen and MLNs by passing them through a 70-µm mesh filter. To isolate lymphocytes from PP, the tissues were stirred in 1 mg/ml collagenase S-1 (Nitta Gelatin). Similarly, after removing epithelium by stirring in RPMI 1640 containing 1 mM EDTA and 2% FCS, large intestinal lymphocytes were isolated by collagenase treatment. Lymphocytes were further purified by discontinuous Percoll gradient centrifugation (40% and 75% layers).

Mast cell culture, in vitro migration assay, and cytokine production assay

To obtain bone marrow-derived mast cells, cells isolated from the femur are cultured for 5–8 wk in medium conditioned with WEHI-3 cells from American Type Culture Collection (ATCC) as previously described (37). The mast cells were purified by using CD117 magnetic beads (Miltenyi Biotec) and then used in an in vitro migration assay in accordance with a previously established method (26). Briefly, the upper chambers of the Transwell plate (5-µm pore) were coated with 20 µg/ml fibronectin (Invitrogen Life Technologies) for 12 h and blocked for 1 h with PBS containing 3% BSA at 37°C. Mast cells were pretreated with 2 µg/ml anti-DNP IgE (clone SPE-7; Sigma-Aldrich) in the presence of 0, 20, or 200 nM FTY720 for 12 h. After washing, pretreated 106 mast cells were added to the upper chamber together with 0, 20, or 200 nM FTY720. The 20 ng/ml DNP-human serum albumin (HSA) was placed in the lower wells. After a 6-h incubation, the surviving mast cells in the lower wells were counted by using trypan blue staining in a hemocytometer. For the cytokine assay, MC/9 cells (ATCC) were stimulated for 4 h with 1 µg/ml anti-DNP IgE and 30 ng/ml DNP-HSA and 0, 20, or 200 nM FTY720. The amount of TNF-{alpha} and IL-5 was measured by a cytometric bead array system in accordance with the manufacturer’s instructions (BD Pharmingen).

Flow cytometric analysis and cell sorting

A standard protocol was used for cell staining and subsequent flow cytometry (33, 35). Briefly, cells were incubated with 5 µg/ml anti-CD16/32 Ab (Fc block; BD Pharmingen) for 5 min and stained with fluorescently labeled Abs specific for B220, c-kit, IgE, CD4, CD69, {alpha}4beta7 integrin (BD Pharmingen), CCR3 (R&D Systems), and Fc{epsilon}RI{alpha} (eBioscience) for 30 min at 4°C. A Viaprobe (BD Pharmingen) was used to discriminate between dead and live cells. Flow cytometric analysis and cell sorting were performed using FACSCalibur and FACSAria (BD Biosciences), respectively.

Adoptive transfer experiment

Splenic CD4+ T cells were isolated from systemically primed GFP transgenic BALB/c mice by cell sorting before being i.v. transferred to SCID mice according to a previously described protocol (7). The reconstituted SCID mice were orally administrated with 50 mg of OVA three times per week (7). One week after the adoptive transfer, lymphocytes were isolated from the large intestine and analyzed by flow cytometry as described in the preceding paragraph.

Quantitative RT-PCR

To elucidate mRNA expression for S1P receptors, quantitative RT-PCR using a LightCycler (Roche Diagnostics) was performed as previously described (33). TRIzol (Invitrogen Life Technologies) and Powerscript Reverse Transcriptase (BD Biosciences) were used for total RNA isolation and complementary DNA synthesis, respectively. The oligonucleotide primers and probes for S1P1 (forward) TACACTCTGACCAACAAGGA, (reverse) ATAATGGTCTCTGGGTTGTC, (FITC probe) TGCTGGCAATTCAATTCAAGAGGCCCATCATC, (LCRed 640 probe) CAGGCATGGAATTTAGCCGCAGCAAATC; and for GAPDH (forward) TGAACGGGAAGCTCACTGG, (reverse) TCCACCACCCTGTTGCTGTA, (FITC probe) CTGAGGACCAGGTTGTCTCCTGCGA, (LCRed 640 probe) TTCAACAGCAACTCCCACTCTTCCACC) were designed and produced by Nihon Gene Research Laboratory (Sendai, Japan) (33).

Analysis of total and OVA-specific Ab production by ELISA

To measure OVA-specific IgE, microtiter plates were coated with purified anti-mouse IgE Ab (BD Pharmingen) and blocked with PBS containing 3% BSA. Diluted serum samples were added to the plates, which were then incubated for 4 h at room temperature before being washed four times with PBS containing 0.05% Tween 20. Biotin-labeled OVA was added and the plates were then incubated with HRP-conjugated anti-biotin Ab (Vector Laboratories). The reaction was developed by 3,3',5,5'-tetramethylbenzidine (Moss), and color development was terminated by the addition of 0.5 N HCl. Endpoint titers were expressed as the reciprocal log2 of the last dilution, which gave an OD at 450 nm of 0.1 greater than in nonimmunized mice. The total IgE was measured with a mouse IgE ELISA kit in accordance with the manufacturer’s instructions (Yamasa).

T cell proliferation assay and measurement of cytokine production

CD4+ T cells purified from the spleen, MLNs, and PP using CD4-coupled magnetic beads (Miltenyi Biotec) and mononuclear cells from large intestinal lamina propria were used for the proliferation assay and for the measurement of cytokine production as previously reported (7, 35). Briefly, cells were incubated for 72 h with 1 mg/ml OVA in the presence of irradiated (3000 rad) splenocytes. To measure cell proliferation, 1 µCi of [3H]thymidine was added to each well 8 h before termination, and the uptake of [3H]thymidine was determined by scintillation counting. To measure cytokine production, the amounts of cytokines (e.g., IL-4, IL-5, and IFN-{gamma}) in the culture supernatant were measured by the cytometric bead array system in accordance with the manufacturer’s instructions (BD Pharmingen).

Histological analysis

Immunohistochemical analysis was performed as previously described (7). For immunohistochemical analysis, the large intestine was fixed in 4% paraformaldehyde (Wako) and incubated in 20% sucrose. The tissues were embedded in OCT compound (Sakura Fine Technical Company). H&E staining was used to detect eosinophils (7). Similarly, intestinal mast cells were subjected to naphthol AS-D chloroacetate esterase staining (Sigma-Aldrich) and counterstained with hematoxylin (38).

Statistical analysis

The results were compared using a Student’s t test or Welch’s t test. Statistical significance was established at a value for p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Splenic T cells are essential for the induction of Ag-specific allergic diarrhea

We previously reported that systemically primed splenocytes preferentially migrated into the large intestine after repeated oral challenge with the same Ag; the splenocytes that migrated into the large intestine contributed to the development of severe allergic diarrhea (7). However, it remained unclear whether the spleen was directly involved in the intestinal allergy development, such as in the generation of pathogenic T cells. In the current study, our first experiment examined the induction of allergic diarrhea in splenectomized mice. Consistent with our previous results (7, 8, 9, 32), oral challenge (n = 4–10) with OVA resulted in severe diarrhea in spleen sham-treated (or intact) mice systemically primed with the same Ag (Fig. 1A). In contrast, the incidence of allergic diarrhea was reduced in splenectomized mice (Fig. 1A). To investigate the role of T cells in the induction of allergic diarrhea, we examined whether allergic responses were induced in nude mice lacking functional T cells due to their thymus deficiency. We found that systemically sensitized nude mice did not show any sign of allergic responses following exposure to oral allergen (Fig. 1A). These results further emphasize the importance of the spleen as an essential site for the induction and establishment of intestinal allergic responses.


Figure 1
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 1. The critical role of the spleen in the induction of allergic diarrhea. A, Three weeks after the splenectomy, splenectomized (•) mice and sham-operated ({circ}) control mice were subjected to the allergic diarrhea inducing treatment. The incidence of allergic diarrhea was examined 1 h after each oral OVA challenge (n = 10). Nude mice were also examined for induction of allergic diarrhea ({blacktriangleup}). B, Splenectomy was performed at various time points, including before systemic priming and before the first, third, or eighth oral OVA challenge, and the incidence of allergic diarrhea was examined 1 h after each OVA administration. The incidence of allergic diarrhea in splenectomized mice (n = 8 per group) after 10 challenges with oral OVA is depicted.

 
We next investigated whether the spleen was required in the priming and/or oral challenge phase for the development of allergic diarrhea. To address this issue, we performed splenectomy at various time points and examined the influence of the timing of splenectomy on the development of allergic diarrhea. Allergic diarrhea was inhibited most effectively in mice that underwent splenectomy before systemic priming or initial oral challenge (Fig. 1B). In contrast, splenectomy just before the third or tenth oral challenge did not inhibit the development of allergic diarrhea (Fig. 1B). These results indicated that the spleen is involved during the early period of allergic diarrhea development, especially during the sensitization phase.

Association of S1P1 expression with the development of allergic diarrhea

S1P regulates the trafficking of lymphocytes, especially in their egress step from secondary lymphoid organs (13, 14). Because effector cell trafficking between the spleen and large intestine plays a crucial role in the induction of allergic diarrhea (7), we sought to investigate the possible contribution of the S1P1 to trafficking by performing quantitative RT-PCR to measure the level of mRNA encoding S1P1 in splenic CD4+ T cells (Fig. 2). S1P1 expression was low in systemically primed mice without oral challenge that did not develop intestinal allergic symptoms, compared with expression levels in naive CD4+ T cells (Fig. 2). In contrast, S1P1 expression was recovered and increased in diseased mice receiving both systemic priming and repeated oral challenge (Fig. 2). The difference in S1P1 expression in CD4+ T cells from mice with diarrhea (systemic priming plus oral challenge) and mice showing no symptoms (systemic priming only) may imply the involvement of the S1P1 receptor-mediated pathway in the cell trafficking of effector CD4+ T cells from the spleen to the large intestine for the induction of intestinal allergic responses.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 2. Changes in S1P1 expression in splenic CD4+ T cells during the induction of allergic diarrhea. S1P1 expression was measured by quantitative RT-PCR. Splenic CD4+ T cells were isolated from naive mice or mice treated with systemic priming only (s.c. only) or systemic priming plus oral challenge (s.c. + oral). Data represent the relative ratio of S1P1 expression to GAPDH. Results are the mean ± SE from three separate experiments.

 
FTY720 prevents OVA-specific allergic diarrhea

The findings we report in this study (Figs. 1 and 2) lead us to speculate that manipulation of the S1P-mediated pathway could help control allergic diarrhea by inhibiting allergen-specific CD4+ T cell migration from the spleen into the large intestine. To test this hypothesis, we used FTY720 as an agonist for S1P receptors, thereby inhibiting lymphocyte egress from lymphoid organs (16, 17, 18). Mice were treated with FTY720 beginning the day before systemic priming and continuing throughout the period of OVA administration. The induction of allergic diarrhea was completely abolished in the FTY720-treated mice (Fig. 3, A and B). We next sought to examine whether the priming or challenge stage was more important for development of the disease by administering FTY720 either once before systemic priming or before every oral challenge, respectively (Fig. 3C). When administered before oral challenge, FTY720 successfully inhibited the development of allergic diarrhea (Fig. 3C), but the drug had only minimal beneficial effects when administered solely before systemic priming. These results indicate that FTY720 selectively affects cell trafficking from the spleen to the large intestine during oral challenge.


Figure 3
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 3. FTY720 suppressed the development of allergic diarrhea. Allergic diarrhea induction in mock- and FTY720-treated groups was compared. FTY720 (1 mg/kg) was i.p. administered before systemic priming with OVA/CFA and during induction of allergic diarrhea by OVA oral challenge as described in Materials and Methods. A, After 10 challenges with oral OVA, mock-treated mice showed severe diarrhea within 1 h, but FTY720-treated mice showed normal feces. B, The incidence of diarrhea in mock-treated ({circ}) and FTY720-treated (•) groups (n = 5 mice per group) after each oral allergen challenge is shown. C, The incidence of diarrhea was examined in mice (n = 8) with a different experimental schedule of FTY720 treatments.

 
FTY720 inhibits migration of systemically primed CD4+ T cells from the spleen into the large intestine in orally challenged mice

To examine whether FTY720 actually affected the migration of systemically primed CD4+ T cells from the spleen into the large intestine, we examined the influence of FTY720 on activated CD4+ T cells in the spleen and large intestine. After in vivo treatment with FTY720, the percentage of activated CD69-expressing CD4+ cells in the spleen increased but the percentage in the large intestinal lamina propria declined (Fig. 4A), indicating that activated T cells were prevented from migrating from the spleen to the large intestine. To determine whether FTY720 also could inhibit CD4+ T cell infiltration into the large intestine, we performed an adoptive transfer experiment in GFP transgenic mice (Fig. 4B). We prepared splenic CD4+ T cells from systemically primed GFP transgenic mice, adoptively transferred them via the i.v. route into SCID mice, and then repeatedly challenged those mice with OVA (Fig. 4B); 1 wk after the third oral OVA challenge, we isolated mononuclear cells from the large intestinal lamina propria and counted the number of infiltrated CD4+ T cells. We found that FTY720 treatment dramatically decreased the infiltration of GFP-positive systemically primed CD4+ T cells into the large intestine (Fig. 4B). These results demonstrate that FTY720 suppressed the preferential infiltration of systemically primed T cells into the large intestine, which was initiated by oral allergen challenge.


Figure 4
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 4. FTY720 inhibited pathogenic CD4+ T cells migration into the large intestine. A, Splenocytes and large intestinal lamina propria lymphocytes (LI-LPL) were isolated from mock-treated (–) and FTY720-treated (+) mice after 10 challenges with oral OVA. The percentage of activated (CD69+) cells among the CD4+ T cells was determined by FACS analysis. The data represent the mean ± SE from five separate experiments. *, p < 0.01. B, CD4+ cells were isolated from the spleen of GFP transgenic mice 1 wk after systemic priming with OVA and transferred into SCID mice. The reconstituted SCID mice were orally challenged with 50 mg of OVA. After three challenges with the oral OVA for 1 wk, the infiltration of GFP+ CD4+ cells into the large intestine was determined by flow cytometry. The percentage of gated area represents the infiltrated cells derived from adoptively transferred GFP+ CD4+ T cells. The results shown represent three independent experiments conducted.

 
FTY720 treatment inhibits Th2 responses without affecting the induction of allergen-specific IgE production

We next elucidated the contribution of allergen-specific T cells in the spleen and their responses to FTY720 treatment during the process of allergic diarrhea development. An OVA-induced T cell proliferation assay showed that the degree of OVA-specific proliferative response by splenic CD4+ T cells isolated from FTY720-treated mice was similar to or slightly higher than the response from mock-treated mice (Fig. 5A). We also examined OVA-specific T cell proliferation in PPs and MLNs; these gut-associated lymphoid tissues are well-known contributors to the induction of immune responses against ingested Ag (1, 2). CD4+ T cells in PPs and MLNs showed less proliferative responses than did splenic T cells, and FTY720 did not affect these allergen-specific T cell responses (Fig. 6A). We then demonstrated a reduction of IL-4 production in the spleen, PPs, and MLNs of mice treated with FTY720 (Figs. 5B and 6B). These findings suggest that the FTY720 treatment inhibits IL-4 production by OVA-specific CD4+ T cells.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 5. FTY720 treatment reduces IL-4 synthesis without affecting IgE production. A, CD4+ T cells were isolated from the spleen of mock-treated (–) or FTY720-treated (+) mice for the analysis of proliferative responses against OVA. The data represent the mean ± SE (n = 3). B, IL-4 and IFN-{gamma} production from OVA-stimulated CD4+ T cells were measured. The data represent the mean ± SE (n = 4). *, p < 0.01. C and D, Serum was collected from mock- or FTY720-treated mice after challenge with oral OVA 10 times to measure OVA-specific IgE (C) or total IgE (D) production by ELISA. The data represent the mean ± SE (n = 6).

 

Figure 6
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 6. OVA-specific CD4+ T cells responses in the gut-associated lymphoid tissues of mock-treated (–) and FTY720-treated (+) mice. A and B, CD4+ T cells were isolated from the MLNs and PP of mock- or FTY720-treated mice and subjected to the analysis of OVA-specific T cell proliferative responses (A) and their cytokine production (B). The data represent the mean ± SE from three separate experiments. **, p < 0.05.

 
Because Th2-mediated IgE responses are involved in allergic diarrhea (11), we supposed that the reduction of IL-4 production in FTY720-treated mice led to a decrease in IgE production; this effect might be a key contributing factor for preventing allergic diarrhea. To test this hypothesis, we examined IgE production and found that, despite its complete inhibition of allergic diarrhea (Fig. 3, A and B), FTY720 treatment unexpectedly failed to affect either Ag-specific or total IgE production in serum (Fig. 5, C and D). These findings indicated that FTY720 effectively prevented allergic diarrhea development without altering IgE responses.

FTY720 treatment alters mast cell, but not eosinophil, infiltration into the large intestine

Eosinophils are inflammatory cells that are thought to be involved in allergic diseases in mice and humans, although this issue is a subject of debate (12, 39). We next investigated whether FTY720 inhibited intestinal eosinophilia. According to the criteria outlined in a previous study (40), we defined eosinophils as those cells in CD4 populations that expressed CCR3 and the {alpha}4beta7 integrin. Flow cytometric analysis revealed that FTY720 treatment did not reduce eosinophil numbers in the large intestine (Fig. 7A). The conclusion was further confirmed by H&E staining, which showed similar distributions of eosinophils in the large intestines of FTY720-treated and nontreated mice (Fig. 7A). These results suggest that eosinophils are not targets of FTY720.


Figure 7
View larger version (53K):
[in this window]
[in a new window]

 
FIGURE 7. Infiltration of mast cells but not eosinophils was inhibited by FTY720 treatment. A, After challenge 10 times with oral OVA, CCR3+ {alpha}4beta7 integrin+ CD4 eosinophils in the large intestinal lamina propria were analyzed by flow cytometry analysis (top) or H&E staining (bottom; arrowheads). B, Similarly, IgE-bound c-kit+ mast cells were determined by flow cytometry (top) and naphthol AS-D chloroacetate esterase staining (bottom; arrowheads). Results shown are the representative data of five separate experiments. The percentage of gated area represents infiltrated eosinophils (A) and mast cells (B).

 
We next investigated whether FTY720 treatment affected mast cells, which are other effector cells involved in intestinal allergic hypersensitivity. Flow cytometric analysis indicated that c-kit+ and IgE-bound mast cells were markedly reduced in the large intestinal lamina propria after the treatment with FTY720 (Fig. 7B). A similar result was obtained in mast cells costained with anti-c-kit and anti-Fc{epsilon}RI{alpha} Abs (data not shown). Naphthol AS-D chloroacetate esterase staining further confirmed this observation (Fig. 7B). Therefore, treatment with FTY720 effectively inhibited the accumulation of mast cells at the disease site.

Two-layered effects of FTY720 on mast cell trafficking

Inasmuch as the FTY720 treatment specifically affected mast cells, we examined whether intestinal mast cells expressed S1P1. Consistent with the results of a previous study (26), lamina propria mast cells expressed S1P1 (Fig. 8A). In agreement with the effects of FTY720 on mast cells but not eosinophils (Fig. 7), the expression of S1P1 on lamina propria mast cells was much higher than expression on eosinophils (Fig. 8A). We then performed an in vitro assay using bone marrow-derived mast cells to examine whether FTY720 directly inhibited mast cell migration. We revealed that mast cells treated with Ag-specific (DNP) IgE were triggered to migrate by the corresponding Ag (DNP), but also that this migration was impaired by treatment with FTY720 (Fig. 8B). We measured Fc{epsilon}RI{alpha} on mast cells because some regulatory cytokines, including TGF-beta and IL-10, directly inhibit Fc{epsilon}RI expression in mast cells and subsequently prevent their interaction with Ag (41, 42). In vitro culture of mast cells with physiological concentrations of S1P or FTY720 did not alter Fc{epsilon}RI expression, whereas TGF-beta1 reduced Fc{epsilon}RI{alpha} expression (Fig. 8C) as previously reported (42). Additional analyses revealed that FTY720 treatment inhibited IL-5 production but not TNF-{alpha} production from allergen-stimulated mast cells (Fig. 8D). This finding is consistent with a previous report demonstrating that FTY720 inhibited PGD2 production from mast cells without affecting their degranulation and TNF-{alpha} production (28). These findings suggest that FTY720 selectively inhibits specific biologic functions (e.g., IL-5 production) of intestinal mast cells.


Figure 8
View larger version (45K):
[in this window]
[in a new window]

 
FIGURE 8. FTY720 mediates the migration and function of S1P1-positive mast cells. A, Mast cells and eosinophils were isolated from the large intestine of mice with allergic diarrhea. S1P1 expression was examined by quantitative RT-PCR. Data shown represents the relative ratio of S1P1 expression to GAPDH. Results represent the mean ± SE from three separate experiments. B, A transmigration assay was performed with bone marrow-derived mast cells. Mast cells were preincubated with DNP-IgE in the presence of 0, 20, or 200 nM FTY720 for 12 h before being added to the fibronectin-coated upper chamber of a Transwell plate with 20 ng/ml DNP-HSA in the lower chamber. Six hours later, the number of cells that had migrated into the lower chamber was counted. C, After 3 days of culture of peritoneal mast cells in 50% WEHI-3 conditioned culture medium containing TGF-beta1 (10 ng/ml), S1P (20 or 200 nM), or FTY720 (20 or 200 nM), the expression of Fc{epsilon}RI{alpha} on the mast cells was determined by flow cytometry. Data are presented as the mean fluorescence intensity (MFI) of the experiment (n = 6). D, MC/9 cells were stimulated with DNP-IgE and 20 ng/ml DNP-HSA in the presence or absence of FTY720, and their production of IL-5 and TNF-{alpha} production was examined. Data represent the mean ± SE (n = 3). E, Mice were i.p. administered with 50 mg of OVA after systemic priming and 10 challenges with oral OVA. The anaphylactic response in the foot was measured after 1 h and body temperature were also examined at various time points. Data represent the mean ± SE (n = 5). *, p < 0.01. F, IL-4, IL-5, and IFN-{gamma} production from OVA-stimulated large intestinal lamina propria lymphocytes was measured. Experiments were repeated twice with similar results. Data represent the mean ± SE (n = 6).

 
Anaphylactic shock and hypothermia were induced when FTY720-treated mice received i.p. the same amounts of OVA as given orally, although the FTY720-treated mice did not show any allergic diarrhea after oral OVA challenge (Fig. 8E). These data suggest that FTY720 exerts its influence by inhibiting the migration of mast cells into the large intestinal lamina propria and their synthesis of some biologically active molecules (e.g., inhibition of IL-5 and PGD2), but mast cells retain their ability to capture IgE via Fc{epsilon}RI{alpha} and subsequently induce degranulation in response to a corresponding systemically administered allergen. As an additional layer in the inhibitory mechanism of FTY720, we found that lymphocytes in the large intestinal lamina propria of FTY720-treated mice showed impaired production of IL-4 and IL-5 (Fig. 8F), cytokines that activate and recruit mast cells (43, 44). Therefore, it is plausible that FTY720 hampers mast cell migration into the large intestine by both direct inhibition of S1P-mediated mast cell migration and indirect effects on Th2-associated cytokine production for mast cell migration or activation. Both of these effects may be critical factors in FTY720-associated inhibition of allergic diarrhea.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Increased understanding of S1P and its receptor S1P1 has opened an avenue of investigation into a previously unexplored facet of the immune system, i.e., the role played by lipid-associated biological metabolites in the cell trafficking between primary and secondary lymphoid tissues (13, 14). Because S1P and S1P1 mediate the egress of lymphocytes from lymphoid tissues, molecular interruption of the interaction between ligand and receptor may lead to the inhibition of the effector and pathological lymphoid cell trafficking for the establishment of pathologic conditions. In acting as an agonist for S1P receptors and thereby inhibiting lymphocyte egress from lymphoid organs, FTY720 shows strong therapeutic potential for preventing the rejection of transplanted organs and for treating autoimmune diseases, such as autoimmune encephalomyelitis and systemic lupus erythematosus (20). In fact, some of these possible therapeutic uses are currently being clinically evaluated (20). Although S1P has been implicated in allergic responses in the lung (30) and although high enzymatic activity, required for S1P generation, exists (e.g., sphingosine kinase and neural ceramidases) in the intestine (45, 46), the involvement of S1P in the development of allergic responses, specifically food allergies, has remained obscure. In the current study, we have addressed this issue and demonstrated that inhibition of the S1P-mediated pathway leads to suppression of Ag-specific intestinal allergic hypersensitivity.

Our current results indicate that allergic responses are inhibited when activated CD4+ T cells are prevented from migrating from the spleen into the large intestine at the sensitization phase, because that migration is the pathway responsible for the induction of aberrant allergic responses. Therefore, removing the spleen during systemic sensitization impaired the development of allergic diarrhea, whereas splenectomy during oral challenge failed to prevent allergic diarrhea (Fig. 1). In this experiment, we noted that ~30% of splenectomized mice still showed allergic symptoms, a finding suggesting that other lymph nodes may compensate for the spleen as a site for priming allergen-specific CD4+ T cells (Fig. 1). However, FTY720 treatment completely inhibited the development of allergic diarrhea (Fig. 3, A and B). Therefore, it seems that FTY720 prevents the migration of pathogenic cells from the spleen and possibly other systemic lymphoid tissues into the large intestine.

There is now increased evidence that naive lymphocytes express high levels of S1P1; that expression is down-regulated when lymphocytes are activated by T cell receptors and then up-regulated once again to promote egress from lymphoid organs (17, 47). Consistent with this fact, splenic CD4+ T cells showed a temporal reduction in S1P1 expression after systemic priming (Fig. 2). The reduction seemed to allow cells to remain in the spleen until they once again had an opportunity to be activated and subsequently begin their egress from the spleen. S1P1 expression was restored by repeated oral challenge, which enabled the cells to migrate to the large intestine in an S1P-dependent manner.

In addition to CD4+ T cells, accumulating evidence demonstrates that dendritic cells express S1P1 and that FTY720 treatment inhibits their migration to draining lymph nodes (48, 49, 50). A recent study revealed that local treatment with FTY720 inhibited the migration of dendritic cells from the lung to the mediastinal lymph nodes, leading to impaired formation of allergen-specific Th2 cells in lymph nodes (51). Therefore, it is also possible that FTY720 may inhibit the migration of dendritic cells from the intestine to the draining lymph nodes, subsequently preventing the activation of CD4+ T cells in the large intestine.

Although our current findings clearly suggest that FTY720 effectively targeted the S1P-mediated migration pathway between the systemic and large intestinal compartments and thereby helped to prevent allergic diarrhea, we still do not know the exact molecular mechanism for the S1P-dependent preferential migration of systemically primed pathogenic CD4+ T cells from the spleen to the large intestine. Indeed, our previous and current findings suggested that, after repeated oral challenge, pathogenic T cells were preferentially located in the large intestine but not in the small intestine, MLNs, and PPs (7) (Fig. 6). In relation to this issue, our group has recently demonstrated that PP provide a milieu for inducing regulatory T cells for the control of food allergy (32). In particular, PPs-null mice were more susceptible to developing allergic diarrhea than were PPs-intact mice. Therefore, it is plausible that these regulatory T cells in the PP might prevent the migration, proliferation, or activation of pathogenic T cells in the small intestinal compartment.

We also observed that mast cell migration into the large intestine was inhibited by the interruption of S1P- and S1P1-mediated molecular events by FTY720 (Fig. 7B). There are a number of possible underlying mechanisms for the regulation of mast cell trafficking into the large intestine. First, FTY720 might directly inhibit the migration of mast cells into the large intestine. Mast cells express S1P1 (26) and our data also confirmed that result (Fig. 8A). This idea is further supported by the data generated through our in vitro migration assay, which showed a direct suppressive effect of FTY720 on mast cell migration toward Ag (Fig. 8B). In agreement with this observation, mast cells capturing Ag-specific IgE preferentially migrated toward Ag in an S1P-dependent manner in previous studies (27, 52). Therefore, cross-linking of allergen-IgE complexes and Fc{epsilon}RI can activate sphingosine kinase 1, resulting in the generation of S1P (26, 27). Transactivation of the S1P1-mediated Gi protein-signaling cascade is important in the rearrangement of the cytoskeleton and the migration of mast cells toward Ag (25, 26, 27).

In an alternative mechanism, pathogenic CD4+ T cells may guide mast cells to the large intestine via secretion of hypersensitivity-associated cytokines. To this end, IL-4 and IL-5, the major Th2 cytokines associated with allergic responses, have been shown to possess activity of mast cell activation and recruitment (43, 44) and promote switching of mast cell precursors to connective tissue- or mucosal-type mature mast cells in the presence of IL-3 (44). Our current results show that FTY720-induced inhibition of pathogenic T cell migration from the spleen to the large intestine led to simultaneous inhibition of IL-4 and IL-5 production (Fig. 8F), supporting the possibility that FTY720 treatment led to the inhibition of IL-4- and IL-5-mediated mast cell migration and activation in the large intestine. This idea is further supported by our recent and separate preliminary observations that repeated oral challenge did not induce the infiltration of mast cells into the large intestine of SCID mice that were adoptively transferred with or without mast cells pretreated with serum derived from mice with diarrhea (our unpublished observations).

The fact that we did not detect mast cells in the large intestine without oral challenge suggests the third possibility that mast cells infiltrated the large intestine only in the presence of allergen (data not shown). FTY720 thus may inhibit Ag transport from the intestinal lumen into the large intestine. Previous studies revealed that allergen transport under allergic conditions was enhanced by CD23 (Fc{epsilon}RII) that was expressed on intestinal epithelial cells, and that enhancement protected allergen from degradation during the translocation (53). Perhaps, FTY720 negatively regulates CD23 expression on epithelial cells and reduces allergen transport into the large intestine, thus inhibiting mast cell migration. We also cannot disregard the possibility that interactions between mast cells and endothelial cells were disrupted by treatment with FTY720 because endothelial cells also express S1P receptors for the regulation of their barrier function (54). Continuous study will be required to shed further light on the molecular mechanisms of migration.

Although it showed remarkable effects on mast cell migration, FTY720 treatment did not affect eosinophil migration into the large intestine (Fig. 7A). Because human eosinophils express S1P receptors, including S1P1, and because S1P promotes CCR3-dependent migration in human eosinophils (29), modification of the eosinophils trafficking through the S1P-mediated pathway may offer a novel therapeutic strategy (39). However, to date no study has been done on S1P receptor expression on murine eosinophils. Our current experiment indicated that S1P1 expression was higher in mast cells than in eosinophils (Fig. 8A). These observations imply that the S1P-S1P1 dependency of murine eosinophils is much lower than that of mast cells and of human eosinophils, accounting for our observing fewer inhibitory effects of FTY720 on eosinophils in our murine intestinal allergy model. These findings indicate that eosinophils are not involved in the development of food allergy as a previous report demonstrated (12). This evidence strengthens the hypothesis that mast cells play a key role in the development of allergic diarrhea and that the inhibition of mast cell migration into the large intestine is a critical step in the FTY720-mediated inhibition of allergic diarrhea. Our study sheds the light on a novel approach to the prevention and treatment of intestinal allergic disease; targeting S1P-mediated pathogenic cell migration.


    Acknowledgments
 
We thank Dr. K. McGhee for editorial help. We also thank Novartis Pharma (Basel, Switzerland) for providing FTY720.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from Core Research for Evolutional Science and Technology (CREST) of the Japan Science and Technology Corporation (JST), the Ministry of Education, Science, Sports, and Culture, the Ministry of Health and Welfare in Japan, the Waksman Foundation, and Yakult Bio-Science Foundation. Back

2 Address correspondence and reprint requests to Dr. Hiroshi Kiyono, Division of Mucosal Immunology, Department of Microbiology and Immunology, The Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. E-mail address: kiyono{at}ims.u-tokyo.ac.jp Back

3 Abbreviations used in this paper: S1P, sphingosine 1-phosphate; S1P1, type 1 S1P receptor; HSA, human serum albumin; MLN, mesenteric lymph node; PP, Peyer’s patch. Back

Received for publication April 27, 2007. Accepted for publication May 20, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Kiyono, H., S. Fukuyama. 2004. NALT- versus Peyer’s-patch-mediated mucosal immunity. Nat. Rev. Immunol. 4: 699-710. [Medline]
  2. Kunisawa, J., S. Fukuyama, H. Kiyono. 2005. Mucosa-associated lymphoid tissues in aerodigestive tract: their shared and divergent traits and their importance to the orchestration of mucosal immune system. Curr. Mol. Med. 5: 557-572. [Medline]
  3. Kunisawa, J., H. Kiyono. 2005. A marvel of mucosal T cells and secretory antibodies for the creation of first lines of defense. Cell Mol. Life Sci. 62: 1308-1321. [Medline]
  4. Faria, A. M., H. L. Weiner. 2005. Oral tolerance. Immunol. Rev. 206: 232-259. [Medline]
  5. Adams, D. H., B. Eksteen. 2006. Aberrant homing of mucosal T cells and extra-intestinal manifestations of inflammatory bowel disease. Nat. Rev. Immunol. 6: 244-251. [Medline]
  6. Sicherer, S. H., H. A. Sampson. 2006. Food allergy. J. Allergy Clin. Immunol. 117: S470-S475. [Medline]
  7. Kweon, M. N., M. Yamamoto, M. Kajiki, I. Takahashi, H. Kiyono. 2000. Systemically derived large intestinal CD4+ Th2 cells play a central role in STAT6-mediated allergic diarrhea. J. Clin. Invest. 106: 199-206. [Medline]
  8. Hino, A., M. N. Kweon, K. Fujihashi, J. R. McGhee, H. Kiyono. 2004. Pathological role of large intestinal IL-12p40 for the induction of Th2-type allergic diarrhea. Am. J. Pathol. 164: 1327-1335. [Abstract/Free Full Text]
  9. Hino, A., S. Fukuyama, K. Kataoka, M. N. Kweon, K. Fujihashi, H. Kiyono. 2005. Nasal IL-12p70 DNA prevents and treats intestinal allergic diarrhea. J. Immunol. 174: 7423-7432. [Abstract/Free Full Text]
  10. Kweon, M. N., I. Takahashi, M. Yamamoto, M. H. Jang, N. Suenobu, H. Kiyono. 2002. Development of antigen induced colitis in SCID mice reconstituted with spleen derived memory type CD4+ CD45RB+ T cells. Gut 50: 299-306. [Abstract/Free Full Text]
  11. Nakajima-Adachi, H., A. Ebihara, A. Kikuchi, T. Ishida, K. Sasaki, K. Hirano, H. Watanabe, K. Asai, Y. Takahashi, Y. Kanamori, et al 2006. Food antigen causes Th2-dependent enteropathy followed by tissue repair in T-cell receptor transgenic mice. J. Allergy Clin. Immunol. 117: 1125-1132. [Medline]
  12. Brandt, E. B., R. T. Strait, D. Hershko, Q. Wang, E. E. Muntel, T. A. Scribner, N. Zimmermann, F. D. Finkelman, M. E. Rothenberg. 2003. Mast cells are required for experimental oral allergen-induced diarrhea. J. Clin. Invest. 112: 1666-1677. [Medline]
  13. Cyster, J. G.. 2005. Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid organs. Annu. Rev. Immunol. 23: 127-159. [Medline]
  14. Rosen, H., E. J. Goetzl. 2005. Sphingosine 1-phosphate and its receptors: an autocrine and paracrine network. Nat. Rev. Immunol. 5: 560-570. [Medline]
  15. Sanchez, T., T. Hla. 2004. Structural and functional characteristics of S1P receptors. J. Cell. Biochem. 92: 913-922. [Medline]
  16. Mandala, S., R. Hajdu, J. Bergstrom, E. Quackenbush, J. Xie, J. Milligan, R. Thornton, G.-J. Shei, D. Card, C. Keohane, et al 2002. Alteration of lymphocyte trafficking by sphingosine-1-phosphate receptor agonists. Science 296: 346-349. [Abstract/Free Full Text]
  17. Matloubian, M., C. G. Lo, G. Cinamon, M. J. Lesneski, Y. Xu, V. Brinkmann, M. L. Allende, R. L. Proia, J. G. Cyster. 2004. Lymphocyte egress from thymus and peripheral lymphoid organs is dependent on S1P receptor 1. Nature 427: 355-360. [Medline]
  18. Gräler, M. H., E. J. Goetzl. 2004. The immunosuppressant FTY720 down-regulates sphingosine 1-phosphate G-protein-coupled receptors. FASEB J. 18: 551-553. [Abstract/Free Full Text]
  19. Yanagawa, Y., K. Sugahara, H. Kataoka, T. Kawaguchi, Y. Masubuchi, K. Chiba. 1998. FTY720, a novel immunosuppressant, induces sequestration of circulating mature lymphocytes by acceleration of lymphocyte homing in rats. II. FTY720 prolongs skin allograft survival by decreasing T cell infiltration into grafts but not cytokine production in vivo. J. Immunol. 160: 5493-5499. [Abstract/Free Full Text]
  20. Brinkmann, V., M. D. Davis, C. E. Heise, R. Albert, S. Cottens, R. Hof, C. Bruns, E. Prieschl, T. Baumruker, P. Hiestand, et al 2002. The immune modulator FTY720 targets sphingosine 1-phosphate receptors. J. Biol. Chem. 277: 21453-21457. [Abstract/Free Full Text]
  21. Mizushima, T., T. Ito, D. Kishi, Y. Kai, H. Tamagawa, R. Nezu, H. Kiyono, H. Matsuda. 2004. Therapeutic effects of a new lymphocyte homing reagent FTY720 in interleukin-10 gene-deficient mice with colitis. Inflamm. Bowel Dis. 10: 182-192. [Medline]
  22. Fujii, R., T. Kanai, Y. Nemoto, S. Makita, S. Oshima, R. Okamoto, K. Tsuchiya, T. Totsuka, M. Watanabe. 2006. FTY720 suppresses CD4+CD44highCD62L effector memory T cell-mediated colitis. Am. J. Physiol. 291: G267-G274.
  23. Sawicka, E., G. Dubois, G. Jarai, M. Edwards, M. Thomas, A. Nicholls, R. Albert, C. Newson, V. Brinkmann, C. Walker. 2005. The sphingosine 1-phosphate receptor agonist FTY720 differentially affects the sequestration of CD4+CD25+ T-regulatory cells and enhances their functional activity. J. Immunol. 175: 7973-7980. [Abstract/Free Full Text]
  24. Kim, Y. M., T. Sachs, W. Asavaroengchai, R. Bronson, M. Sykes. 2003. Graft-versus-host disease can be separated from graft-versus-lymphoma effects by control of lymphocyte trafficking with FTY720. J. Clin. Invest. 111: 659-669. [Medline]
  25. Jolly, P. S., M. Bektas, K. R. Watterson, H. Sankala, S. G. Payne, S. Milstien, S. Spiegel. 2005. Expression of SphK1 impairs degranulation and motility of RBL-2H3 mast cells by desensitizing S1P receptors. Blood 105: 4736-4742. [Abstract/Free Full Text]
  26. Jolly, P. S., M. Bektas, A. Olivera, C. Gonzalez-Espinosa, R. L. Proia, J. Rivera, S. Milstien, S. Spiegel. 2004. Transactivation of sphingosine-1-phosphate receptors by Fc{epsilon}RI triggering is required for normal mast cell degranulation and chemotaxis. J. Exp. Med. 199: 959-970. [Abstract/Free Full Text]
  27. Olivera, A., N. Urtz, K. Mizugishi, Y. Yamashita, A. M. Gilfillan, Y. Furumoto, H. Gu, R. L. Proia, T. Baumruker, J. Rivera. 2006. IgE-dependent activation of sphingosine kinases 1 and 2 and secretion of sphingosine 1-phosphate requires Fyn kinase and contributes to mast cell responses. J. Biol. Chem. 281: 2515-2525. [Abstract/Free Full Text]
  28. Payne, S. G., C. A. Oskeritzian, R. Griffiths, P. Subramanian, S. E. Barbour, C. E. Chalfant, S. Milstien, S. Spiegel. 2007. The immunosuppressant drug FTY720 inhibits cytosolic phospholipase A2 independently of sphingosine-1-phosphate receptors. Blood 109: 1077-1085. [Abstract/Free Full Text]
  29. Roviezzo, F., F. Del Galdo, G. Abbate, M. Bucci, B. D’Agostino, E. Antunes, G. De Dominicis, L. Parente, F. Rossi, G. Cirino, R. De Palma. 2004. Human eosinophil chemotaxis and selective in vivo recruitment by sphingosine 1-phosphate. Proc. Natl. Acad. Sci. USA 101: 11170-11175. [Abstract/Free Full Text]
  30. Jolly, P. S., H. M. Rosenfeldt, S. Milstien, S. Spiegel. 2002. The roles of sphingosine-1-phosphate in asthma. Mol. Immunol. 38: 1239-1245. [Medline]
  31. Ikawa, M., S. Yamada, T. Nakanishi, M. Okabe. 1998. ‘Green mice’ and their potential usage in biological research. FEBS Lett. 430: 83-87. [Medline]
  32. Takayama, N., O. Igarashi, M. N. Kweon, H. Kiyono. 2007. Regulatory role of Peyer’s patches for the inhibition of OVA-induced allergic diarrhea. Clin. Immunol. 123: 199-208. [Medline]
  33. Kunisawa, J., Y. Kurashima, M. Gohda, M. Higuchi, I. Ishikawa, F. Miura, I. Ogahara, H. Kiyono. 2007. Sphingosine 1-phosphate regulates peritoneal B cell trafficking for subsequent intestinal IgA production. Blood 109: 3749-3756. [Abstract/Free Full Text]
  34. Gajewska, B. U., D. Alvarez, M. Vidric, S. Goncharova, M. R. Stämpfli, A. J. Coyle, J.-C. Gutierrez-Ramos, M. Jordana. 2001. Generation of experimental allergic airways inflammation in the absence of draining lymph nodes. J. Clin. Invest. 108: 577-583. [Medline]
  35. Kunisawa, J., T. Nakanishi, I. Takahashi, A. Okudaira, Y. Tsutsumi, K. Katayama, S. Nakagawa, H. Kiyono, T. Mayumi. 2001. Sendai virus fusion protein mediates simultaneous induction of MHC class I/II-dependent mucosal and systemic immune responses via the nasopharyngeal-associated lymphoreticular tissue immune system. J. Immunol. 167: 1406-1412. [Abstract/Free Full Text]
  36. Kunisawa, J., I. Takahashi, A. Okudaira, T. Hiroi, K. Katayama, T. Ariyama, Y. Tsutsumi, S. Nakagawa, H. Kiyono, T. Mayumi. 2002. Lack of antigen-specific immune responses in anti-IL-7 receptor {alpha} chain antibody-treated Peyer’s patch-null mice following intestinal immunization with microencapsulated antigen. Eur. J. Immunol. 32: 2347-2355. [Medline]
  37. Diaz, B. L., H. Fujishima, Y. Kanaoka, Y. Urade, J. P. Arm. 2002. Regulation of prostaglandin endoperoxide synthase-2 and IL-6 expression in mouse bone marrow-derived mast cells by exogenous but not endogenous prostanoids. J. Immunol. 168: 1397-1404. [Abstract/Free Full Text]
  38. Wastling, J. M., P. Knight, J. Ure, S. Wright, E. M. Thornton, C. L. Scudamore, J. Mason, A. Smith, H. R. Miller. 1998. Histochemical and ultrastructural modification of mucosal mast cell granules in parasitized mice lacking the beta-chymase, mouse mast cell protease-1. Am. J. Pathol. 153: 491-504. [Abstract/Free Full Text]
  39. Rothenberg, M. E., S. P. Hogan. 2006. The eosinophil. Annu. Rev. Immunol. 24: 147-174. [Medline]
  40. Lloyd, C. M., T. Delaney, T. Nguyen, J. Tian, C. Martinez-A, A. J. Coyle, J.-C. Gutierrez-Ramos. 2000. CC chemokine receptor (CCR)3/eotaxin is followed by CCR4/monocyte-derived chemokine in mediating pulmonary T helper lymphocyte type 2 recruitment after serial antigen challenge in vivo. J. Exp. Med. 191: 265-274. [Abstract/Free Full Text]
  41. Gillespie, S. R., R. R. DeMartino, J. Zhu, H. J. Chong, C. Ramirez, C. P. Shelburne, L. A. Bouton, D. P. Bailey, A. Gharse, P. Mirmonsef, et al 2004. IL-10 inhibits Fc{epsilon}RI expression in mouse mast cells. J. Immunol. 172: 3181-3188. [Abstract/Free Full Text]
  42. Gomez, G., C. D. Ramirez, J. Rivera, M. Patel, F. Norozian, H. V. Wright, M. V. Kashyap, B. O. Barnstein, K. Fischer-Stenger, L. B. Schwartz, et al 2005. TGF-beta1 inhibits mast cell Fc{epsilon}RI expression. J. Immunol. 174: 5987-5993. [Abstract/Free Full Text]
  43. Wills-Karp, M.. 1999. Immunologic basis of antigen-induced airway hyperresponsiveness. Annu. Rev. Immunol. 17: 255-281. [Medline]
  44. Gurish, M. F., J. A. Boyce. 2002. Mast cell growth, differentiation, and death. Clin. Rev. Allergy Immunol. 22: 107-118. [Medline]
  45. Fukuda, Y., A. Kihara, Y. Igarashi. 2003. Distribution of sphingosine kinase activity in mouse tissues: contribution of SPHK1. Biochem. Biophys. Res. Commun. 309: 155-160. [Medline]
  46. Kono, M., J. L. Dreier, J. M. Ellis, M. L. Allende, D. N. Kalkofen, K. M. Sanders, J. Bielawski, A. Bielawska, Y. A. Hannun, R. L. Proia. 2006. Neutral ceramidase encoded by the Asah2 gene is essential for the intestinal degradation of sphingolipids. J. Biol. Chem. 281: 7324-7331. [Abstract/Free Full Text]
  47. Graeler, M., E. J. Goetzl. 2002. Activation-regulated expression and chemotactic function of sphingosine 1-phosphate receptors in mouse splenic T cells. FASEB J. 16: 1874-1878. [Abstract/Free Full Text]
  48. Müller, H., S. Hofer, N. Kaneider, H. Neuwirt, B. Mosheimer, G. Mayer, G. Konwalinka, C. Heufler, M. Tiefenthaler. 2005. The immunomodulator FTY720 interferes with effector functions of human monocyte-derived dendritic cells. Eur. J. Immunol. 35: 533-545. [Medline]
  49. Czeloth, N., G. Bernhardt, F. Hofmann, H. Genth, R. Förster. 2005. Sphingosine-1-phosphate mediates migration of mature dendritic cells. J. Immunol. 175: 2960-2967. [Abstract/Free Full Text]
  50. Lan, Y. Y., A. De Creus, B. L. Colvin, M. Abe, V. Brinkmann, P. T. Coates, A. W. Thomson. 2005. The sphingosine-1-phosphate receptor agonist FTY720 modulates dendritic cell trafficking in vivo. Am. J. Transplant. 5: 2649-2659. [Medline]
  51. Idzko, M., H. Hammad, M. van Nimwegen, M. Kool, T. Muller, T. Soullie, M. A. Willart, D. Hijdra, H. C. Hoogsteden, B. N. Lambrecht. 2006. Local application of FTY720 to the lung abrogates experimental asthma by altering dendritic cell function. J. Clin. Invest. 116: 2935-2944. [Medline]
  52. Kitaura, J., K. Eto, T. Kinoshita, Y. Kawakami, M. Leitges, C. A. Lowell, T. Kawakami. 2005. Regulation of highly cytokinergic IgE-induced mast cell adhesion by Src, Syk, Tec, and protein kinase C family kinases. J. Immunol. 174: 4495-4504. [Abstract/Free Full Text]
  53. Yang, P. C., M. C. Berin, L. C. Yu, D. H. Conrad, M. H. Perdue. 2000. Enhanced intestinal transepithelial antigen transport in allergic rats is mediated by IgE and CD23 (Fc{epsilon}RII). J. Clin. Invest. 106: 879-886. [Medline]
  54. Brinkmann, V., T. Baumruker. 2006. Pulmonary and vascular pharmacology of sphingosine 1-phosphate. Curr. Opin. Pharmacol. 6: 244-250. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
W.-Q. Lai, A. W. Irwan, H. H. Goh, H. S. Howe, D. T. Yu, R. Valle-Onate, I. B. McInnes, A. J. Melendez, and B. P. Leung
Anti-Inflammatory Effects of Sphingosine Kinase Modulation in Inflammatory Arthritis
J. Immunol., December 1, 2008; 181(11): 8010 - 8017.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Kunisawa, M. Gohda, Y. Kurashima, I. Ishikawa, M. Higuchi, and H. Kiyono
Sphingosine 1-phosphate-dependent trafficking of peritoneal B cells requires functional NF{kappa}B-inducing kinase in stromal cells
Blood, May 1, 2008; 111(9): 4646 - 4652.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gohda, J. Kunisawa, F. Miura, Y. Kagiyama, Y. Kurashima, M. Higuchi, I. Ishikawa, I. Ogahara, and H. Kiyono
Sphingosine 1-Phosphate Regulates the Egress of IgA Plasmablasts from Peyer's Patches for Intestinal IgA Responses
J. Immunol., April 15, 2008; 180(8): 5335 - 5343.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. A. Oskeritzian, S. E. Alvarez, N. C. Hait, M. M. Price, S. Milstien, and S. Spiegel
Distinct roles of sphingosine kinases 1 and 2 in human mast-cell functions
Blood, April 15, 2008; 111(8): 4193 - 4200.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W.-Q. Lai, H. H. Goh, Z. Bao, W. S. F. Wong, A. J. Melendez, and B. P. Leung
The Role of Sphingosine Kinase in a Murine Model of Allergic Asthma
J. Immunol., March 15, 2008; 180(6): 4323 - 4329.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Kunisawa, Y. Kurashima, M. Higuchi, M. Gohda, I. Ishikawa, I. Ogahara, N. Kim, M. Shimizu, and H. Kiyono
Sphingosine 1-phosphate dependence in the regulation of lymphocyte trafficking to the gut epithelium
J. Exp. Med., October 1, 2007; 204(10): 2335 - 2348.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kurashima, Y.
Right arrow Articles by Kiyono, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kurashima, Y.
Right arrow Articles by Kiyono, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS