HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Serwold, T. Articles by Weissman, I. L. Search for Related Content PubMed PubMed Citation Articles by Serwold, T. Articles by Weissman, I. L.

Early TCR Expression and Aberrant T Cell Development in Mice with Endogenous Prerearranged T Cell Receptor Genes¹

Thomas Serwold^2,*, Konrad Hochedlinger, Matthew A. Inlay^*, Rudolf Jaenisch and Irving L. Weissman^2,*

^* Department of Pathology and Department of Developmental Biology, B259 Beckman Center, Stanford University School of Medicine, Stanford, CA 94305; Department of Medicine, Harvard Medical School, Massachusetts General Hospital, Cancer Center and Center for Regenerative Medicine, Boston, MA 02114; and Whitehead Institute for Biomedical Research, Nine Cambridge Center, Cambridge, MA 02142

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The factors that regulate the rate of production of T cells by the thymus remain incompletely defined. To test whether generation of functional T cell receptors limits the rate of thymic T cell export, we made use of a line of mice, LN3, that have endogenously prerearranged TCR genes. The prerearranged TCR genes were expressed abnormally early in hemopoietic development, indicating that RAG-mediated recombination, rather than transcription factor expression, is the key determinant of the initiation of robust TCR transcription. Thymic T cell export rates were similar between wild-type (wt) and LN3 mice, indicating that T cell maturation rates in these mice are determined by factors other than TCR gene rearrangement. In competitive bone marrow chimeras, however, LN3 thymocytes were out-competed by wt cells and failed to develop beyond the double-negative 4 stage. Furthermore, wt progenitors transplanted intrathymically into LN3 mice proliferated excessively, suggesting that increased proliferative signals in the LN3 thymus compensate for faulty T cell development driven by early TCR expression.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The normal mouse thymus produces and exports millions of new T cells every day (1). Approximately 5% of thymocytes successfully mature; the other 95% of thymocytes die, either because they fail to generate a TCR that recognizes self-MHC/peptides sufficiently or because the TCR they generate has too high of an avidity for self-MHC-peptide complexes.

Because of the low frequency of successful rearrangements to generate TCRs that are positively selected, and the unpredictability of the selection outcome of individual thymocytes, it has been a challenge to follow many aspects of positive and negative selection of normal thymocytes, such as the precise developmental stages when these events occur, their intrathymic locations, the signaling pathways that are active, and which thymic epithelial populations are important in the process. It has also remained unclear whether successful TCR rearrangement is the only limiting step in T cell generation in the thymus or whether this is determined by other factors.

To facilitate the study of thymocyte selection, mouse models with higher rates of selection, such as those expressing TCR transgenes, or TCR-reactive superantigens have been used. In mice expressing superantigens, which are inherited open reading frames of mouse mammary tumor viruses, normal TCR gene rearrangement drives relatively high rates of positive and/or negative selection in mice expressing the appropriate MHC (2, 3). However, idiosyncrasies of superantigen binding and expression may drive selection events that do not occur under normal circumstances in these mice.

TCR-transgenic animals undergo even higher rates of positive and negative selection than superantigen-expressing mice, and normal peptide-MHC complexes drive selection. Nevertheless, one caveat with TCR-transgenic animals is that TCR transgenes tend to be expressed earlier and at higher levels than the wild-type (wt)³ genes during T cell development. Early expression of TCR transgenes interferes with the TCR-preT complex formation and signaling and, in the absence of this signal, double-negative (DN) 3 thymocytes fail to differentiate normally to the double-positive (DP) stage (4, 5, 6). To solve this problem, Hogquist and colleagues (7) used a Cre-lox strategy to precisely limit initiation of transgenic TCR expression appropriately to the DP stage. They found that negative selection in these mice occurred during the DP-single positive transition, contradicting previous studies that used the same mice expressing the same TCR under control of a promoter that drove abnormally early expression (7). Thus, although TCR-transgenic mice have greatly facilitated the study of positive and negative selection, their tendency to miss-time expression of the TCR genes have underscored the importance of controlling the timing of TCR gene expression during the process of T cell development.

The use of cis-regulatory elements to control the timing of TCR expression has been only partially successful, because early expression of TCR occurs even when genomic TCR constructs have been used (8). This might suggest that native elements do not properly regulate the initial timing of expression of prerearranged TCR genes. Alternatively, it was possible that distal regulatory elements controlled the timing of expression of TCR genes. Mice with functional TCRs knocked into their precise native chromosomal locations have not been available to address this question to this point.

Nuclear transfer (NT) techniques have enabled generation of animals whose nuclei originate from fully differentiated adult cells (9). This technique has been used to generate NT mice cloned from the nuclei of mature lymph node T and B cells, and the resulting cloned animals contained rearranged T cell and BCR genes in all cells (10). Such mice enable the study of regulation of prerearranged TCR and BCR genes in the native context and the study of thymic selection driven by endogenously regulated prerearranged TCR genes. Although mice generated by NT do have significant alterations in gene expression due to failure of transferred nuclei to fully reverse their epigenetic modifications (11), these abnormalities are repaired in the offspring of cloned mice, indicating that one passage through gametogenesis and early embryonic development is sufficient to restore normal epigenetic modifications and gene expression patterns (12, 13, 14).

In this study, we used NT to generate a mouse from a mature T cell nucleus. This mouse was bred multiple generations to the parental background to generate a line of mice, called LN3, in which all cells have prerearranged TCR and TCR genes at their appropriate genomic locus. Our data indicate that T cell development in these mice is aberrant and that this is due to the precocious expression of the prerearranged TCR genes. Thus, these data implicate RAG-mediated recombination of the TCR genes as the key event in initiating expression of the TCR genes and indicate that all of the transcription factors necessary for robust TCR expression are present in early hemopoietic progenitors. Our data also show that the defect caused by the early expression of the TCR genes is compensated for in the LN3 mice by increased levels of intrathymic proliferative factors, providing evidence that thymic output is dynamically regulated.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice

LN3 mice were generated using methods previously described (10). They were backcrossed to Thy1.1-congenic C57BL/6/Ka (Ly5.1, Thy1.1) as well as C57BL/6/RAG2^–/– and C57BL/6/Ka/IA^b–/–/₂m^–/– mice, maintaining the offspring with the LN3 TCR and TCR genes at each generation. Animals were kept at the Stanford University Medical Center and fed with standard mouse chow and acidified water ad libitum. For analysis of hemopoietic populations, mice that were 6–12 wk old were used. For bone marrow chimeras, recipients were 8–12 wk old at the time of transplantation. The Stanford Animal Use and Care Committee approved all studies and procedures involving the use of animals.

Abs and flow cytometry

Single-cell suspensions of thymus, spleen, or bone marrow were cleared of RBC using 0.85% ammonium chloride/0.1% potassium bicarbonate and were stained in PBS containing 2% heat-treated calf serum. Abs to CD3 (KT31.1), CD4 (GK1.4), CD8 (53-6.7), CD25 (PC61), CD44 (IM7), c-Kit (2B8) Ly5.1 (AL1-4A2), and Ly5.2 (A20) TCR (GL3) were purified from hybridoma supernatants and directly conjugated to fluorochromes: Alexa Fluor 405, 488, and 594 (Molecular Probes), PE, allophycocyanin, Cy7PE, and Cy5PE. Abs to TCR (H57) and CD24 (30-F1) were purchased from BD Pharmingen. FACS plots shown are gated on live cells by forward and side scatter and by exclusion of propidium iodide. Multicolor sorting and analysis were performed on a highly modified BD Biosciences FACS machine using argon (488 nm), dye (598 nm), and krypton (405 nm) lasers, and data were collected using DIVA digital electronics. Analysis of data was performed with FlowJo (Tree Star).

Quantitative analysis of TCR transcription via real-time RT-PCR

RNA was purified from double-sorted wt and LN3 populations using the RNeasy mini kit (Qiagen), and cDNA was generated using the First Strand cDNA synthesis kit (Invitrogen Life Technologies) according to the manufacturers’ instructions. PCR amplification of cDNA was performed using the 2x SYBR Green Master Mix (Applied Biosystems) on an Applied Biosystems Prism 7000 SDS. Relative expression levels were calculated with the standard curve method, according to Applied Biosystems instructions, using serial dilutions of cDNA harvested from whole LN3 thymus. Primers were used at a concentration of 400 nM. Primer sequences were as follows: -actin.F, CCACAGCTGAGAGGGAAATC; -actin.R, CTTCTCCAGGGAGGAAGAGG; V1.F, GGAATGTGAGCAACATCTGG; V1.R, GCACCGTCTCATTTCGAATC; V3-1.F, GGGCAGGTCTTCAGTTGCT, V3-1.R; GCAGCTGTGAGGTTCAGAGA; D1.F, GAGAAGAATGGGGCCTTACC; D1.R, CGTTGGCAGAAGAGGATTTC, V10.F, GAGACGGCTGTTTTCCAGAC; and V10.R, GGCCCA GAGTTTGCTTACAA.

Bone marrow chimeras

Recipient mice (C57BL/6, Ly5.2⁺/Ly5.1⁺) were lethally irradiated by giving two 475-rad doses 4 h apart with an x-ray irradiator. Donor bone marrow from both wt (Ly5.2) and LN3 (Ly5.1) mice was depleted of mature cells using Abs to CD3, CD4, CD8, B220, Mac-1, Gr-1, and Ter119, followed by magnetic depletion with anti-rat IgG-conjugated paramagnetic beads (Dynal). Equal numbers of lineage-depleted bone marrow cells from both wt and LN3 donors were injected into the retro-orbital venous sinus of recipient mice. Analysis of bone marrow chimeras was performed 12 wk after transplantation.

Intrathymic injections

Intrathymic injections were performed using previously described surgical techniques (15). For thymic output experiments, unirradiated, 4- to 6-wk-old mice were injected with 15 µl of 1 mg/ml FITC in PBS (pH 7.4). For testing of the donor cell expansion, unirradiated C57BL/6 (Ly5.2-congenic) or RAGLN3 mice (Ly5.2) were injected with 1 x 10⁴ C57BL/6 or 5 x 10³ LN3 DN1 cells (Ly5.1) that were defined as c-Kit^high, CD44^high, CD25^– and lineage^–/low, and double sorted. Recipient mice were analyzed at day 10 after injection.

Intracellular staining for TCR

Cells were stained for surface Ags normally, then fixed for 20 min in PBS plus 4% paraformaldehyde. Cells were then permeabilized using 0.2% saponin in PBS for 20 min at room temperature, followed by staining with PE-conjugated anti-TCR (H57; BD Pharmingen). Cells were then washed in PBS and analyzed.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
TCR gene rearrangements and T cell development in LN3 mice

Using our previous approach, we transferred the nucleus of a mature T cell from a (129/SvJae x C57BL/6)F₁ male mouse into an enucleated oocyte to derive a cloned blastocyst from which we generated a T cell-derived ES cell line (10). The ES cells were injected into tetraploid blastocysts and transplanted into recipient females to generate cloned mice, LN3, that contained prerearranged TCR genes in all cells. We used Southern blotting and inverted PCR to identify the TCR and TCR variable regions that were rearranged in the LN3 mice (data not shown). The TCR locus had two rearranged alleles: one in-frame V-D-J rearrangement (V1-D1-J1.4) and one incomplete D1-J2.2 rearrangement (Fig. 1A). There was also one productive TCR rearrangement (V3.1-J30) and one out of frame rearrangement (V9.1-J43). We bred this cloned animal, maintaining the two productive TCR gene rearrangements, onto the C57BL/6 (Thy1.1-congenic) background >10 generations to determine the effect of prerearranged TCR genes on T cell development.

View larger version (34K): [in this window] [in a new window]   FIGURE 1. Gene rearrangements and T lineage analysis of LN3 mice. A, Genomic organization of wt and LN3 TCR and TCR loci. B, Thymocyte progenitor populations in wt mice and in mice that contain one or both of the prerearranged LN3 TCR genes. Bottom two panels, Representative profiles from RAG2–/– mice that contain both the LN3-derived TCR and the TCR gene or the TCR chain alone. Left column, A CD4 and CD8 stain of live-gated thymocytes. Middle column, Gated on CD4–/lowCD8–/low thymocytes and shows CD3 and TCR staining. Third column, Cells from the CD3– gate in second column and delineates the early thymocyte populations using c-Kit and CD25. Right column, CD4 and CD8 profiles of CD3+ cells from the spleens of the indicated mice. The cytometry profiles are representative of at least three mice of each type.

LN3 mice contain a preponderance of CD8⁺ T cells in both the thymus and the spleen, suggesting that the LN3 TCR is MHC class I restricted (Fig. 1B). The MHC restriction of the LN3 TCR was verified in LN3^RAG mice, in which >99% of splenic T cells are CD8⁺ (Fig. 1B, bottom panel), illustrating the fidelity of lineage-fate choice of LN3 thymocytes is accurate and indicating that the CD4⁺ T cells that do arise in the LN3 mice must undergo secondary TCR gene rearrangements. The thymic cellularity of the LN3 mice was 4-fold reduced as compared with wt (Table I). This reduction in cellularity could be attributed to the decrease in the thymic DP population, which makes up 83% of the normal thymus, but only 16% of the LN3 thymus (Fig. 1B, left column).

View this table: [in this window] [in a new window]   Table I. Quantitative analysis of thymic and splenic T cell populations in wt, LN3, and LN3 micea

An almost complete absence of T cells in the LN3 and LN3 mice (Fig. 1B, second column) supports previous studies that showed pairing of a functional transgenic TCR with preT drives DN thymocytes to develop down the lineage and prevents development of lineage cells (17). In contrast, T cells are present in normal numbers in the LN3 mice, despite the fact that one TCR locus has been deleted in these animals due to the LN3 TCR rearrangement, suggesting that the developmental pathway is not altered by early expression of the LN3 TCR gene or by the low cellularity of the LN3 thymus (Table I).

One striking abnormality in the LN3 thymus is the presence of a large population of DN cells that are CD3⁺ (Fig. 1B, second column). CD3 surface expression is concomitant with TCR expression, because the TCR-CD3 complex can only reach the cell surface when both CD3 and TCR subunits are coexpressed. In a normal thymus, the DN CD3⁺ population of cells is a minor population and contains roughly 20% T cells and 80% T cells (Fig. 1B, second column, and Table I), and these emigrate into the periphery as functional mature cells (18). In the LN3 thymus, however, the DN CD3⁺ population contains virtually no T cells (Fig. 1B). This population instead is entirely TCR positive, because it stains with the anti-TCR Ab H57 (data not shown). This large DN CD3⁺ population also predominates in LN3 mice, but not the LN3 mice, indicating that this population results from expression of the prerearranged TCR gene (Fig. 1B, second column, and Table I). The DN CD3⁺ population is also abundant in the spleens of LN3 mice, suggesting that this population of cells can exit the thymus and accumulate in the periphery similar to other mature T cell lineages (Fig. 1B, third column, and Table I). In contrast, in the spleens of LN3 mice, the DN CD3⁺ population is rare (Fig. 1B and Table I), indicating a qualitative difference in the nature of the DN CD3⁺ T cells in the thymi of LN3 and LN3 mice. This difference could be caused either from the different nature of the TCRs generated in the LN3 progenitors, because they require rearrangement of the TCR gene. The requirement for TCR rearrangement in the LN3 thymocytes may also result in a later developmental expression of a mature TCR, which could affect the development and maturation of the DN CD3⁺ cells.

The less mature, CD3^–CD4^–/lowCD8^–/low (DN) populations in the LN3 mice are also dramatically altered, with many fewer thymocytes at the DN3 stage (Fig. 1B, third column). This is consistent with the expression of a prerearranged TCR gene at the DN2–DN3 stage, which drives the immediate differentiation to the DN4 stage and beyond. Similarly, the DN3 population is also diminished in LN3 mice, but not in LN3 mice. Thus, expression of a prerearranged TCR gene drives differentiation rapidly through the DN3 stage.

Early TCR expression in LN3 mice

The prevalence of the DN CD3⁺ population in the LN3 mice was reminiscent of previous studies using TCR-transgenic mice that found early TCR expression drove formation of a DN CD3⁺ population that shared similarities with T cells (4, 5, 6). Therefore, we suspected that the LN3 TCR gene might also be expressed earlier than normal, despite its proper genomic context. To determine the precise timing of surface TCR expression in LN3 mice, we first analyzed CD4^–CD8^– thymocyte populations for surface expression of CD3 as a surrogate marker for expression of TCR. More than 50% of LN3 thymocytes at the DN3 stage express high levels of surface CD3, indicating that both the LN3-derived TCR and TCR genes are expressed at this early stage (Fig. 2). In addition, the DN4 population of LN3 mice contains >90% CD3⁺ cells. In contrast, only 3% of wt DN3 cells are CD3⁺ and 27% of DN4 cells express surface TCR. Thus, both the prerearranged TCR and TCR genes are expressed at the DN3 and DN4 stages. Because TCR expression normally begins at the DP stage, these data indicate that the prerearranged TCR gene is prematurely expressed, despite its proper genomic localization.

View larger version (29K): [in this window] [in a new window]   FIGURE 2. CD3 expression on the surface of DN thymocyte populations from LN3 mice. CD4–/low, CD8–/low, and TCR– thymocytes from wt (top) and LN3 (bottom) were stained with Abs and gated into the normal DN1–4 populations using the markers shown above each plot. These subpopulations were then analyzed for the expression of surface CD3. These results are representative of at least five mice per group.

View larger version (43K): [in this window] [in a new window]   FIGURE 3. Intracellular TCR expression occurs early in lymphoid development in LN3 mice. A, Thymocytes stained for lineage (CD3, CD4, CD8, B220, Mac-1, and Gr-1), c-Kit, and CD25. They were subsequently fixed and permeabilized and then stained with an Ab to TCR. Left panels, Lineage-negative/low cells and the gates used to define the populations DN1–4, and the histograms show the level of TCR staining (surface plus intracellular) of each population for either wt (top panel) or LN3 thymocytes (bottom panel). B, Expression of intracellular TCR in bone marrow progenitors. Bone marrow cells depleted of mature lineages were stained for c-Kit, Sca-1, Flk-2, Thy1.1, and IL-7R to distinguish LT-HSC, ST-HSC, MPP, and CLP, as marked on the plots. Histograms show the level of TCR expression. C, Transcript levels of V1 (left column) and V3-1 (middle column), as well as germline transcription of D1 (right column) were measured in both wt (top) and LN3 (bottom) populations by real-time quantitative RT-PCR. Cells were sorted from pools of five mice for each genotype. Primers for V1and V3-1 anneal within their respective V exons. Primers to detect germline transcripts initiating from the D1 promoter anneal between the D1 and J1 gene segment. Transcript levels of each sample are shown relative to levels in unsorted LN3 thymocytes. All samples were normalized internally to -actin expression. Note the differences in scale for each graph. Relative V10 expression (bottom right) was similarly measured from DN1 and DN2 cells from both wt () and LN3 () mice. The RT-PCR was performed in triplicate wells and the average from one experiment is shown. Results are representative of RT-PCR using three separate sorts of cells.

It was possible that the precocious expression of the LN3 TCR gene was a manifestation of normally occurring sterile transcription of a TCR V1 region gene, which, in the case of the LN3 mice, would encode a full-length TCR protein. Alternatively, it was possible that early expression of the LN3 V1 gene was the result of an abnormally active V1 promoter.

To distinguish these possibilities, we compared the levels of transcripts of the V1 and V3-1 gene segments in the LN3 and wt mice. Both prerearranged TCR genes in LN3 mice were detected far earlier in development and at much higher levels than their unrearranged wt counterparts (Fig. 3C, note differences in axis scales between wt and LN3). Consistent with the intracellular staining of TCR protein, transcripts of V1 in LN3 mice were first detected at the MPP stage and then at higher levels in the CLP and DN1 populations. In contrast, there was little or no detectable transcription of the unrearranged V1 locus in wt mice either in MPP, CLP, or DN1 progenitors, indicating that sterile transcripts from this locus are rare. Wild-type V1 transcripts were detected beginning at the DN3 stage, but at a much lower level than was observed in DN3 cells from LN3. This indicated that prerearranged TCR genes are not properly regulated, being more actively transcribed earlier in development than their unrearranged counterparts.

Transcripts of the prerearranged V3-1 gene were also detected much earlier than in the wt progenitors; HSC, MPP, and CLP from LN3 mice all show robust transcription of the V3-1 gene (Fig. 3C, note difference in the axis scales between wt and LN3). Transcript levels of V3-1 appear to decrease in the DN1 and DN2 stages and then ramp back up at the DN3 stage, suggesting complex regulation of this promoter during these early stages. In contrast to the LN3 V3-1 locus, transcripts of the wt V3-1 locus are practically undetectable in bone marrow progenitors, and are robustly detected beginning at the DP stage, when the V genes are being actively rearranged (Fig. 3C).

Because the LN3 TCR transcripts encode full-length TCRs and the unrearranged counterparts encode only incomplete sterile transcripts, it was possible that the differences in transcript levels we detected were due to differential stability of the two transcripts, rather than the actual rates of transcription. To evaluate whether the prerearranged locus is more transcriptionally active, we measured transcript levels of the V10 gene, which is 1.7 kb distal to the V1 gene in the TCR locus, and unrearranged in both the wt and LN3 progenitors. We found that transcript levels V10 are increased in DN1 and DN2 cells from LN3 mice, relative to their wt counterparts (Fig. 3C, bottom right panel). Because V10 genes are unrearrranged in both wt and LN3 progenitors, the increased V10 transcript levels in LN3 progenitors likely reflects an increased rate of transcription. Thus, the LN3 TCR genes are transcribed abnormally early in hemopoietic development.

TCR gene rearrangement moves the V regions several hundred kb closer to the 3' E enhancer, which is essential for controlling TCR expression and rearrangement (26, 27). Therefore, it was possible that transcription of the prerearranged V1 gene was under greater influence of the now proximal E enhancer, because it had moved from 490 kb away to only 20 kb away in the LN3 mice, and that the timing of activation of the E enhancer drove the early expression of the LN3 TCR gene. To address whether timing of activation by the E enhancer might cause the early TCR expression in LN3 mice, we measured levels of germline transcription from the pD1 promoter, which is located 20 kb from the E enhancer, and requires E for its activity (28). We found that while wt DN1 cells contained high levels of D1 transcripts, CLP contained very low levels, and D1 transcripts were absent in MPP (Fig. 3C). Thus, because prerearranged TCR transcripts are present at relatively high levels in both CLP and MPP in LN3 mice, transcriptional timing driven by E may partially account for the early transcription of the LN3 TRV1 gene, but other factors, including the strength of the V1 promoter, as well as synergistic effects between 5' and 3' elements, probably also contribute.

Thymic output in LN3 mice

It was clear from this analysis that the prerearranged LN3 TCR genes had profound effects on T cell development, partly due to the nature of the positively selecting receptor and partly due to early TCR expression. We next addressed whether expression of the prerearranged TCR genes affected T cell production in the LN3 thymus. TCR-transgenic mice have been used previously to measure the efficiency of T cell production, and results have been mixed, possibly reflecting variability in the nature of the TCRs, abundance of selecting ligands, or possibly reflecting the variations in expression due to idiosyncrasies of transgenic insertions (29, 30, 31). The LN3 mice provided a unique model to measure the effect of prerearranged TCR genes on T cell production, because expression of the TCR was uniform and at normal levels in cells undergoing selection, although the early timing of expression may strongly influence T cell production.

To quantify thymic output of the LN3 mice, we used the method of intrathymic injection FITC, which covalently labels >95% of thymocytes and has been used to quantify the rate of mature T cell export from the thymus by counting FITC-labeled cells that appear in the periphery in the days following injection (1). The toxicity of this treatment is mostly limited to a fraction of the DP thymocytes, and because the contribution of DP cells to the single-positive T cell pool takes several days, this assay closely approximates the thymic output of the unmanipulated thymus over short time periods (32). We measured thymic output of the LN3 mice over a 3-day period and found that rates of T cell output from LN3 and wt thymi were roughly equivalent at 1–2 x 10⁶ cells exported per day (Fig. 4). Expression of CD24, a marker of recent thymic emigrants, on the FITC-labeled T cells in the periphery confirmed that the FITC-labeled cells were recent emigrants to the periphery (Fig. 4 and Ref. 33). Thus, despite having prerearranged TCR and TCR genes, the thymic output of LN3 mice is similar to that of wt.

View larger version (34K): [in this window] [in a new window]   FIGURE 4. T cell production is normal in LN3 mice. Mice were injected intrathymically with FITC into both thymic lobes. At 24 and 72 h postinjection, the percentage of FITC+CD3+ cells in blood, lymph nodes, and spleen was determined by flow cytometry, and the total number of cells was calculated using the total cellularity of each tissue. A, Top left plot shows a representative FITC-injected wt thymus after 72 h, indicating nearly complete labeling of thymocytes. Top middle plot shows the pooled lymph nodes from the same mouse, indicating 8% of the total lymph node cells were new emigrants at 72 h and that very few non-T lineage cells emigrate from the thymus. Top right plot shows the expression of the recent thymic emigrant marker, CD24, on FITC+ and FITC– lymph node T cells 72 h after intrathymic injection of FITC. Consistent with FITC+ cells being recent thymic emigrants, they express high levels of CD24. CD3+ thymocytes are shown for comparison. B, Quantification of the FITC+ cells in blood, spleen, and lymph nodes at 24- and 72-h time points. Each data point represents the sum of FITC+ T cells in the spleen, blood, and lymph nodes of one mouse.

Failure of LN3 thymocytes to effectively compete in mixed bone marrow chimeras

The fact that LN3 mice and wt mice produced similar numbers of mature T cells suggested that the rate of thymic T cell production is controlled by factors other than the efficiency of TCR gene rearrangement. Therefore, to compare the efficiency of T cell development between wt and LN3 mice, we transplanted lethally irradiated recipient mice with equal numbers of lineage-depleted bone marrow cells from both LN3 and wt donors and measured the contribution of each donor to various hemopoietic populations in both spleen and thymus tissues by flow cytometry 12 wk after transplantation, using congenic Ly5 markers that differed between host (Ly5.1⁺Ly5.2⁺), LN3 donor (Ly5.1⁺), and competitor (Ly5.2⁺). The spleens of chimeric mice contained an excess of B cells and granulocytes from the LN3 donor, most likely reflecting a slightly greater contribution at the level of HSC, perhaps due to a greater number of HSC in the depleted bone marrow preparations (Fig. 5A). Despite the greater overall chimerism from the LN3 donor, 80% of splenic T cells were derived from the wt donor. Wild-type donor cells contributed 50% of CD8⁺ T cells and >90% of the CD4⁺ T cells in the recipient mice. The increased contribution of the CD4⁺ T cells from the wt donor might be expected because the LN3 TCR drives cells to the CD8⁺ lineage. However, the fact that the wt cells contributed 50% of the CD8⁺ cells as well suggested that the LN3-derived T lineage cells had a disadvantage in the competitive setting. The diminished LN3 T cell contribution occurred similarly at low (5%) chimerism levels, suggesting that limiting levels of positively selecting ligands had little to do with the failure of LN3 to compete with wt cells (data not shown).

View larger version (42K): [in this window] [in a new window]   FIGURE 5. LN3 thymocytes are developmentally blocked in competitive mixed chimeras. Lethally irradiated Ly5.1+/5.2+ mice were reconstituted with equal numbers of lineage-depleted bone marrow cells from LN3 (Ly5.1) and wt (Ly5.2) bone marrow. Donor contributions to spleen and thymus were evaluated at 12 wk after transplantation by flow cytometry. A, FACS plots show donor contributions from a representative chimera (left plot). The B and T cell contributions from LN3 (middle plot) and wt (right plot) donors show that LN3 development is relatively skewed to the B lineage. Bar graphs representing flow cytometry data show the contribution of LN3 () and wt cells () to each of the indicated hemopoietic populations as a total percentage of splenocytes. B, The contribution of cells from each donor to the chimeric thymi was measured. Total chimerism was measured (left panel) and CD4 vs CD8 plots of LN3 and wt donors (second and third panels) show the lack of LN3 contribution to populations beyond the DN stage. Thymic chimerism of a noncompetitive bone marrow chimera transplanted with 100% LN3 bone marrow is shown as a control (fourth plot). Plots are representative of four mixed chimeras. Bar graphs show the average abundance of each major thymocyte population within the chimeras from both wt () and LN3 () donors. C, Left panel shows the contribution of wt and LN3 donors to the CD3–CD4–/lowCD8–/low population of cells. The distribution of the DN populations is shown for LN3 (middle panel) and wt cells (right panel). Quantification of the DN subsets from five chimeras is shown in the bottom panels.

We further analyzed the mixed chimeras at the specific DN (CD3^–, CD4^–, CD8^–) stages to determine the precise stage at which LN3 thymocytes were blocked. The mixed chimeras contained roughly equivalent numbers of wt and LN3 cells at the DN1 and DN2 stages, indicating that thymic seeding, early proliferation, and differentiation from these two donors was equal (Fig. 5C). The DN3 stage was significantly underrepresented by the LN3 donor cells. This is consistent with the rapid progression of LN3 thymocytes from the DN3 stage to DN4 and is also observed in the unmanipulated LN3 mice (Fig. 1B). There also appeared to be normal numbers of LN3-derived DN4 cells (Fig. 5C). However, as mentioned above, there is a striking absence of LN3-derived CD8 intermediate single-positive and DP cells as well as single-positive cells (Fig. 5B). Thus, competition with wt thymocytes reveals a striking deficiency in the development of LN3 thymocytes that was not apparent in the absence of competition and manifests as a failure of LN3 thymocytes to progress normally beyond the DN4 stage.

Increased intrathymic growth-promoting signals in LN3 mice

The normal thymic output of LN3 mice in combination with their inability to develop efficiently in a competitive setting suggested that the LN3 thymus might have higher levels of compensatory growth-promoting signals than wt mice to drive the production of LN3 thymocytes. To test whether such a compensatory mechanism was active in the LN3 mice, we intrathymically injected wt thymic progenitors into thymi of unirradiated LN3 and wt mice and measured the proliferation and development of the donor cells after 10 days. We found that wt DN1 cells, when injected into unirradiated wt recipients, proliferated 8.5-fold over 10 days and differentiated to the DP stage (Fig. 6). In contrast, wt cells injected into LN3^RAG thymi proliferated 140-fold, a 16-fold increase in total proliferation, while developing at a similar rate. These data support the hypothesis that LN3 mice compensate for defective thymocytes by having higher levels of growth-promoting signals. In contrast, LN3 DN1 cells failed to proliferate when intrathymically injected into wt mice, consistent with their developmental deficiency observed in the competitive bone marrow transplantation experiments and consistent with their dependence on a higher availability of growth-promoting signals to develop. Thus, LN3 thymocytes are developmentally deficient in a competitive setting, and this deficiency is modulated in the noncompetitive setting by increased availability of growth-promoting signals in the LN3 thymus.

View larger version (33K): [in this window] [in a new window]   FIGURE 6. LN3 thymi contain increased growth-promoting signals. Nonirradiated wt (top panels) or LN3RAG mice (middle panels) were injected intrathymically with sorted DN1 cells from wt, Ly5-congenic donor mice. Alternatively, DN1 cells from an LN3 donor were injected into a wt recipient (bottom panels). After 10 days, recipient thymi were analyzed for donor contributions by flow cytometry. Middle column, The CD4 and CD8 profiles of donor cells; right column, recipient thymocytes. The plots shown are representative of 6 LN3 recipients and 12 wt recipients accumulated from three separate experiments. The increase in expansion of wt thymocytes in LN3 recipients averaged 30-fold.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

The LN3-derived TCR gene is prematurely expressed in HSC, the most primitive stage of hemopoietic development, as well as its immediate downstream progeny, while the LN3-derived TCR gene is expressed prematurely in a subset of MPP, possibly revealing one of the very earliest lymphoid-primed progenitors. This contrasts strongly with the normal developmental timing of robust transcription of these same TCR and TCR genes in wt mice, which occurs at the DP and DN3 stages in the thymus, respectively.

What is the cause of this early TCR expression? It is formally possible that the active epigenetic status of TCR and TCR loci have been maintained from the original T cell nucleus that was cloned and that this is driving the early expression of the TCR genes. Studies of epigenetically active genes in cloned mice, sheep, and pigs have shown that although cloned animals can maintain the epigenetic status of genes from the original transferred nucleus, epigenetic states became restored to normal in the offspring of cloned animals, likely through the epigenetic reprogramming that occurs during gametogenesis and early embryogenesis (12, 13, 14). This strongly suggests that, because the LN3 mice used in this study were at least seven generations removed from the original cloned mice, epigenetic mechanisms are unlikely to account for the early TCR gene expression.

Rather, we think that it is most likely that the genetic rearrangements of the LN3 TCR loci are responsible for the early expression of these genes. Recent evidence for the formation of a holocomplex containing the E enhancer, the D1 promoter, and associated factors suggest a cooperative mechanism for control of TCR transcription (34). This type of control would likely be strongly influenced by the proximity of the prerearranged TCR V region to the enhancer. In the TCR locus of LN3 mice, the entire TCR locus that normally separates the V and J segments is deleted, eliminating any insulating effect of this large region on V transcription. Similarly, in the TCR locus, the V1segment is normally 490 kb away from the E enhancer, but in the LN3 mouse, this prerearranged gene is only 20 kb away. This relocation of the V subunits closer to the enhancer elements may account for the severalfold increase in levels of mRNA of the prerearranged LN3 TCR gene compared with the unrearranged sterile transcripts in hemopoietic progenitors. Consistent with this model, LN3 progenitors also contain increased levels of V10 transcripts, which is the unrearranged segment 1.7 kb distal to the prerearranged V1 gene (Fig. 3C). Thus, our data implicate the timing of RAG-mediated recombination as the key regulatory step controlling the initiation of robust transcription of TCR genes. Our data also indicate that all transcription factors necessary for high levels of TCR transcription are present and active even at very early stages of hematopoiesis, and these may poise cells for rapid and productive TCR rearrangement and expression upon commitment to the T lineage. Furthermore, these data offer an explanation as to why mice that contain TCR transgenes with endogenous TCR promoters consistently express the TCR too early during T cell development: proper timing of expression of such transgenes is simply not feasible because robust expression from these promoters is limited only by RAG-mediated recombination.

Despite the early expression of TCR genes, unmanipulated LN3 mice produced and exported normal numbers of T cells from the thymus. In contrast, in mixed chimeras containing both LN3 and wt precursors, LN3 thymocytes failed to effectively compete and were largely developmentally blocked at the DN4 stage. Such a block at the DN4 stage in thymic development is unusual, because most TCR-related defects in mice either cause a failure at the preTCR checkpoint leading to a block at the DN3 stage (e.g., RAG^–/–, lck^–/–, or preT^–/– mice) (35, 36, 37) or impair positive selection leading to a block at the DP stage of development (e.g., TCR^–/–) (38). It is possible that these cells may only resemble DN4 by surface phenotype and instead may represent a developmental intermediate of the DN TCR⁺ population, which is common in the LN3 mice. In either case, the LN3 thymocytes fail to develop to the DP stage or beyond when forced to compete with wt thymocytes.

The failure to efficiently advance beyond the DN4 stage and the apparent failure of the DN-DP proliferative burst both suggest that LN3 thymocytes fail to compete effectively for the normal thymic proliferative and differentiation signals. Correlating with the inability of LN3 thymocytes to efficiently respond to thymic proliferative signals, there is an increase in availability of such proliferative signals within the LN3 thymus, as demonstrated by the excessive proliferation of wt DN1 cells when injected into LN3^RAG thymi. The molecular identity of the factor or factors driving this proliferation is not currently known, but available space, soluble, matrix, or cell-bound factors are all possibilities. The short time course of the intrathymic injection experiments (10 days) only allowed donor cells to develop to the DP stage, suggesting that most, if not all, of the proliferation occurred before positive selection. Therefore, it is unlikely that MHC-bound ligands drive the hyperproliferation of wt cells in the LN3 environment. One candidate for this homeostatic factor could be Notch ligands, because previous work has shown that Notch signaling, in addition to preTCR signaling, is required for the DN-DP transition (39, 40). In addition, it has been shown recently that Notch ligands can be subject to competition within the thymus and that this competition may regulate the size of the DP population (41). Another possible reason for the heightened proliferative signals may be the lack of DN3 cells in the LN3 thymus, because previous studies have shown that DN3 cells are key regulators of thymocyte expansion (42). It will be important to know the identity of the factor or factors that contribute to the increased proliferative environment in the LN3 thymus. This study suggests that the factor is available in limited quantities, it is subject to competition, it requires cells to have normal timing of TCR gene expression to efficiently compete for it, and it can act strongly to drive proliferation and differentiation at the DN-DP stages. These traits do not exclude soluble factors or simply physical space, but they do suggest that non-cell autonomous growth-promoting signals in the thymus are an essential component at the DN-DP transition.

The hyperproliferative environment of LN3 thymus provides a mechanism that compensates for the defects of the LN3 thymocytes. Given the importance of a functional immunocompetence for survival, homeostatic regulators of thymocyte development might be important for consistently generating a useful T cell repertoire in individuals whose thymocytes have moderate differences in proliferative capacities. However, a large increase in such thymic proliferative signals, while beneficial in terms of generation of a T cell repertoire, may have some costs. Approximately 50% of LN3 mice develop thymic T cell lymphomas (T. Serwold, unpublished observations). Similarly, in TCR-transgenic mice, which are likely to have similar increases in thymic proliferative signals, a high incidence of lymphomas is also observed (43). It is possible that the increased availability of growth-promoting signals within a setting of defective T cell development may be an important component of T cell lymphomagenesis.

	Acknowledgments

 
We thank Holger Karsunky and Emmanuelle Passegue for personal communications and helpful discussions. We thank Amy Wagers and Lauren Ehrlich for critical comments on this manuscript. We thank Christina Richter for Ab conjugations. We thank Libuse Jerabek for laboratory management and training in the animal protocols.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by Ruth L. Kirschstein National Research Service Award 1F 32 AI 58521 (to T.S.), by National Institutes of Health Grants R01-AI047458 and R01-AI047457 (to I.W.), and by National Institutes of Health Grants R37-CA84198, R01-HD0445022, and R01-CA87869 (to R.J.).

² Address correspondence and reprint requests to Dr. Thomas Serwold and Dr. Irving Weissman, Department of Pathology, B259 Beckman Center, Stanford University, Stanford, CA 94305. E-mail addresses: tserwold{at}stanford.edu or irv{at}stanford.edu

³ Abbreviations used in this paper: wt, wild type; DN, double negative; DP, double positive; NT, nuclear transfer; int, intermediate; CLP, common lymphoid progenitor; LT-HSC, long-term hemopoietic stem cell; ST-HSC, short-term HSC; MPP, multipotent progenitor.

Received for publication October 30, 2006. Accepted for publication May 8, 2007.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Scollay, R. G., E. C. Butcher, I. L. Weissman. 1980. Thymus cell migration: quantitative aspects of cellular traffic from the thymus to the periphery in mice. Eur. J. Immunol. 10: 210-218. [Medline]
2. Akashi, K., I. L. Weissman. 1996. The c-Kit⁺ maturation pathway in mouse thymic T cell development: lineages and selection. Immunity 5: 147-161. [Medline]
3. Guidos, C. J., J. S. Danska, C. G. Fathman, I. L. Weissman. 1990. T cell receptor-mediated negative selection of autoreactive T lymphocyte precursors occurs after commitment to the CD4 or CD8 lineages. J. Exp. Med. 172: 835-845. [Abstract/Free Full Text]
4. Trop, S., M. Rhodes, D. L. Wiest, P. Hugo, J. C. Zuniga-Pflucker. 2000. Competitive displacement of pT by TCR- during TCR assembly prevents surface coexpression of pre-TCR and TCR. J. Immunol. 165: 5566-5572. [Abstract/Free Full Text]
5. Lacorazza, H. D., C. Tucek-Szabo, L. V. Vasovic, K. Remus, J. Nikolich-Zugich. 2001. Premature TCR expression and signaling in early thymocytes impair thymocyte expansion and partially block their development. J. Immunol. 166: 3184-3193. [Abstract/Free Full Text]
6. Terrence, K., C. P. Pavlovich, E. O. Matechak, B. J. Fowlkes. 2000. Premature expression of T cell receptor (TCR) suppresses TCR gene rearrangement but permits development of lineage T cells. J. Exp. Med. 192: 537-548. [Abstract/Free Full Text]
7. Baldwin, T. A., M. M. Sandau, S. C. Jameson, K. A. Hogquist. 2005. The timing of TCR expression critically influences T cell development and selection. J. Exp. Med. 202: 111-121. [Abstract/Free Full Text]
8. Kouskoff, V., K. Signorelli, C. Benoist, D. Mathis. 1995. Cassette vectors directing expression of T cell receptor genes in transgenic mice. J. Immunol. Methods 180: 273-280. [Medline]
9. Jaenisch, R., K. Hochedlinger, R. Blelloch, Y. Yamada, K. Baldwin, K. Eggan. 2004. Nuclear cloning, epigenetic reprogramming, and cellular differentiation. Cold Spring Harbor Symp. Quant. Biol. 69: 19-27. [Medline]
10. Hochedlinger, K., R. Jaenisch. 2002. Monoclonal mice generated by nuclear transfer from mature B and T donor cells. Nature 415: 1035-1038. [Medline]
11. Humpherys, D., K. Eggan, H. Akutsu, A. Friedman, K. Hochedlinger, R. Yanagimachi, E. S. Lander, T. R. Golub, R. Jaenisch. 2002. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc. Natl. Acad. Sci. USA 99: 12889-12894. [Abstract/Free Full Text]
12. Mir, B., G. Zaunbrecher, G. S. Archer, T. H. Friend, J. A. Piedrahita. 2005. Progeny of somatic cell nuclear transfer (SCNT) pig clones are phenotypically similar to non-cloned pigs. Cloning Stem Cells 7: 119-125. [Medline]
13. Shimozawa, N., Y. Ono, S. Kimoto, K. Hioki, Y. Araki, Y. Shinkai, T. Kono, M. Ito. 2002. Abnormalities in cloned mice are not transmitted to the progeny. Genesis 34: 203-207. [Medline]
14. Tamashiro, K. L., T. Wakayama, H. Akutsu, Y. Yamazaki, J. L. Lachey, M. D. Wortman, R. J. Seeley, D. A. D’Alessio, S. C. Woods, R. Yanagimachi, R. R. Sakai. 2002. Cloned mice have an obese phenotype not transmitted to their offspring. Nat. Med. 8: 262-267. [Medline]
15. Jerabek, L., I. L. Weissman. 2002. Intrathymic injection for analysis of T cell progenitor activity. C. A. Klug, and C. T. Gordon, eds. Hematopoietic Stem Cell Protocols 161-165. Humana, Totowa, NJ.
16. Brugnera, E., A. Bhandoola, R. Cibotti, Q. Yu, T. I. Guinter, Y. Yamashita, S. O. Sharrow, A. Singer. 2000. Coreceptor reversal in the thymus: signaled CD4⁺8⁺ thymocytes initially terminate CD8 transcription even when differentiating into CD8⁺ T cells. Immunity 13: 59-71. [Medline]
17. Hayday, A. C., D. F. Barber, N. Douglas, E. S. Hoffman. 1999. Signals involved in / T cell versus / T cell lineage commitment. Semin. Immunol. 11: 239-249. [Medline]
18. Guidos, C. J., I. L. Weissman, B. Adkins. 1989. Developmental potential of CD4^–8^– thymocytes: peripheral progeny include mature CD4^–8^– T cells bearing T cell receptor. J. Immunol. 142: 3773-3780. [Abstract]
19. Karsunky, H., M. Merad, A. Cozzio, I. L. Weissman, M. G. Manz. 2003. Flt3 ligand regulates dendritic cell development from Flt3⁺ lymphoid and myeloid-committed progenitors to Flt3⁺ dendritic cells in vivo. J. Exp. Med. 198: 305-313. [Abstract/Free Full Text]
20. Kondo, M., I. L. Weissman, K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91: 661-672. [Medline]
21. Christensen, J. L., I. L. Weissman. 2001. Flk-2 is a marker in hematopoietic stem cell differentiation: a simple method to isolate long-term stem cells. Proc. Natl. Acad. Sci. USA 98: 14541-14546. [Abstract/Free Full Text]
22. Forsberg, E. C., T. Serwold, S. Kogan, I. L. Weissman, E. Passegue. 2006. Megakaryocyte-erythroid potential of hematopoietic stem and progenitor cells: fully multipotent Flk2/Flt3-positive early progenitors. Cell 126: 415-426. [Medline]
23. Igarashi, H., S. C. Gregory, T. Yokota, N. Sakaguchi, P. W. Kincade. 2002. Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in bone marrow. Immunity 17: 117-130. [Medline]
24. Lai, A. Y., S. M. Lin, M. Kondo. 2005. Heterogeneity of Flt3-expressing multipotent progenitors in mouse bone marrow. J. Immunol. 175: 5016-5023. [Abstract/Free Full Text]
25. Adolfsson, J., R. Mansson, N. Buza-Vidas, A. Hultquist, K. Liuba, C. T. Jensen, D. Bryder, L. Yang, O. J. Borge, L. A. Thoren, et al 2005. Identification of Flt3⁺ lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell 121: 295-306. [Medline]
26. Bories, J. C., J. Demengeot, L. Davidson, F. W. Alt. 1996. Gene-targeted deletion and replacement mutations of the T-cell receptor -chain enhancer: the role of enhancer elements in controlling V(D)J recombination accessibility. Proc. Natl. Acad. Sci. USA 93: 7871-7876. [Abstract/Free Full Text]
27. Bouvier, G., F. Watrin, M. Naspetti, C. Verthuy, P. Naquet, P. Ferrier. 1996. Deletion of the mouse T-cell receptor gene enhancer blocks alpha T-cell development. Proc. Natl. Acad. Sci. USA 93: 7877-7881. [Abstract/Free Full Text]
28. Mathieu, N., W. M. Hempel, S. Spicuglia, C. Verthuy, P. Ferrier. 2000. Chromatin remodeling by the T cell receptor (TCR)- gene enhancer during early T cell development: implications for the control of TCR- locus recombination. J. Exp. Med. 192: 625-636. [Abstract/Free Full Text]
29. Huesmann, M., B. Scott, P. Kisielow, H. von Boehmer. 1991. Kinetics and efficacy of positive selection in the thymus of normal and T cell receptor transgenic mice. Cell 66: 533-540. [Medline]
30. Itano, A., E. Robey. 2000. Highly efficient selection of CD4 and CD8 lineage thymocytes supports an instructive model of lineage commitment. Immunity 12: 383-389. [Medline]
31. Kelly, K. A., H. Pircher, H. von Boehmer, M. M. Davis, R. Scollay. 1993. Regulation of T cell production in T cell receptor transgenic mice. Eur. J. Immunol. 23: 1922-1928. [Medline]
32. Egerton, M., R. Scollay, K. Shortman. 1990. Kinetics of mature T-cell development in the thymus. Proc. Natl. Acad. Sci. USA 87: 2579-2582. [Abstract/Free Full Text]
33. Boursalian, T. E., J. Golob, D. M. Soper, C. J. Cooper, P. J. Fink. 2004. Continued maturation of thymic emigrants in the periphery. Nat. Immunol. 5: 418-425. [Medline]
34. Oestreich, K. J., R. M. Cobb, S. Pierce, J. Chen, P. Ferrier, E. M. Oltz. 2006. Regulation of TCR gene assembly by a promoter/enhancer holocomplex. Immunity 24: 381-391. [Medline]
35. Molina, T. J., K. Kishihara, D. P. Siderovski, W. van Ewijk, A. Narendran, E. Timms, A. Wakeham, C. J. Paige, K. U. Hartmann, A. Veillette, et al 1992. Profound block in thymocyte development in mice lacking p56^lck. Nature 357: 161-164. [Medline]
36. Fehling, H. J., A. Krotkova, C. Saint-Ruf, H. von Boehmer. 1995. Crucial role of the pre-T-cell receptor gene in development of but not T cells. Nature 375: 795-798. [Medline]
37. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, et al 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68: 855-867. [Medline]
38. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara, J. J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, et al 1992. Mutations in T-cell antigen receptor genes and block thymocyte development at different stages. Nature 360: 225-231. [Medline]
39. Huang, E. Y., A. M. Gallegos, S. M. Richards, S. M. Lehar, M. J. Bevan. 2003. Surface expression of Notch1 on thymocytes: correlation with the double-negative to double-positive transition. J. Immunol. 171: 2296-2304. [Abstract/Free Full Text]
40. Ciofani, M., J. C. Zuniga-Pflucker. 2005. Notch promotes survival of pre-T cells at the -selection checkpoint by regulating cellular metabolism. Nat. Immunol. 6: 881-888. [Medline]
41. Visan, I., J. B. Tan, J. S. Yuan, J. A. Harper, U. Koch, C. J. Guidos. 2006. Regulation of T lymphopoiesis by Notch1 and lunatic fringe-mediated competition for intrathymic niches. Nat. Immunol. 7: 634-643. [Medline]
42. Prockop, S. E., H. T. Petrie. 2004. Regulation of thymus size by competition for stromal niches among early T cell progenitors. J. Immunol. 173: 1604-1611. [Abstract/Free Full Text]
43. Brabb, T., R. Rubicz, V. Mannikko, J. Goverman. 1997. Separately expressed T cell receptor and chain transgenes exert opposite effects on T cell differentiation and neoplastic transformation. Eur. J. Immunol. 27: 3039-3048. [Medline]

This article has been cited by other articles:

				L. Boding, C. M. Bonefeld, B. L. Nielsen, J. P. H. Lauritsen, M. R. von Essen, A. K. Hansen, J. M. Larsen, M. M. Nielsen, N. Odum, and C. Geisler TCR Down-Regulation Controls T Cell Homeostasis J. Immunol., October 15, 2009; 183(8): 4994 - 5005. [Abstract] [Full Text] [PDF]

				A. C. Carpenter, K. S. Yang-Iott, L. H. Chao, B. Nuskey, S. Whitlow, F. W. Alt, and C. H. Bassing Assembled DJ{beta} Complexes Influence TCR{beta} Chain Selection and Peripheral V{beta} Repertoire J. Immunol., May 1, 2009; 182(9): 5586 - 5595. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Serwold, T. Articles by Weissman, I. L. Search for Related Content PubMed PubMed Citation Articles by Serwold, T. Articles by Weissman, I. L.