|
|
||||||||
1


,¶

* Department of Virology, Haartman Institute, University of Helsinki and Helsinki University Central Hospital, Helsinki, Finland;
Biotechnology Centre, University of Oslo, Oslo, Norway;
Institute of Medical Technology, University of Tampere and Tampere University Hospital, Tampere, Finland;
Geneart, Regensburg, Germany; and
¶ Institute of Medical Microbiology and Hygiene, University of Regensburg, Regensburg, Germany
| Abstract |
|---|
|
|
|---|
. This screening identified Eps8L1 (epidermal growth factor receptor pathway substrate 8-like 1) together with the N-terminal SH3 domain of Nck1 and Nck2 as its preferred SH3 partners. Studies with recombinant proteins confirmed strong binding of CD3
to Eps8L1 and Nck SH3 domains. CD3
bound well also to Eps8 and Eps8L3, and modestly to Eps8L2, but not detectably to other SH3 domains tested. Interestingly, binding of Nck and Eps8L1 SH3 domains was mapped to a PxxDY motif that shared its tyrosine residue (Y166) with the ITAM of CD3
. Phosphorylation of this residue abolished binding of Eps/Nck SH3 domains in peptide spot filter assays, as well as in cells cotransfected with a dominantly active Lck kinase. TCR ligation-induced binding and phosphorylation-dependent loss of binding were also demonstrated between Eps8L1 and endogenous CD3
in Jurkat T cells. Thus, phosphorylation of Y166 serves as a molecular switch during T cell activation that determines the capacity of CD3
to interact with either SH3 or SH2 domain-containing proteins. | Introduction |
|---|
|
|
|---|

TCR heterodimer (or 
TCR in 
T cells) responsible for ligand binding and is associated with the signal-transducing CD3 complex composed of heterodimeric CD3
-CD3
and CD3
-CD3
and homodimer CD3
(see Ref. 1). The cytoplasmic tails of CD3 chains include tyrosine- and leucine-containing motifs called ITAM (YxxL/I(x6–8)YxxL/I) (2). CD3
, CD3
, and CD3
have one ITAM each, whereas CD3
contains three ITAM. These are phosphorylated upon TCR ligation by the Src family protein tyrosine kinase Lck (3), generating docking sites for Src homology (SH)3 2 domain-containing proteins. Zap70 is the principal CD3 ITAM-binding SH2 protein, but other interacting proteins have also been reported (2). Recruitment of Zap70 leads to its phosphorylation and activation, further tyrosine phosphorylation, and recruitment of other kinases and adapter proteins (4). These responses result in the activation of multiple signaling pathways, changes in actin cytoskeleton, and induction of numerous genes.
Although phosphorylation of ITAMs has been regarded as the earliest signaling event following TCR triggering, it has been shown that the TCR-CD3 complex undergoes a conformational change that occurs even earlier and independently of phosphorylation, which exposes a proline-rich region in the cytoplasmic tail of CD3
(5, 6, 7). This alteration enables binding of Nck via its first SH3 domain (in the following referred to as Nck(I/III)-SH3) (5). This conformational change has been proposed to be essential for T cell activation (5), and shown to correlate spatially and temporally with negative selection of T cells (8), but the functional importance of the proline-rich residues in CD3
has been recently challenged (9).
The SH3 domain is the most common modular protein binding domain in nature. It binds proline-rich sequences, which often contain the consensus sequence proline-x-x-proline (for reviews, see Refs. 10, 11). SH3 domains are typically found in proteins involved in signal transduction, membrane trafficking, and cytoskeletal organization. We have recently generated an essentially complete collection (n = 296) of human SH3 domains in the form of a phage display library, and used this system for identification of preferred SH3 partners for different ligand proteins (12). Because studies by Gil et al. (5) suggested an important role for SH3 binding by CD3
in TCR function, but did not exclude the possibility that SH3 proteins other than Nck(I/III) could be involved, we decided to carry out a comprehensive and unbiased characterization of SH3 binding preferences of CD3
.
| Materials and Methods |
|---|
|
|
|---|
The expression constructs for CD3
and Eps8L1 (epidermal growth factor receptor pathway substrate 8-like 1) were generated from cDNA clones purchased from Deutsches Resourcenzentrum für Genomforschung (CD3
(IRATp970D0474D) and Eps8L1 (IMAGp998E1911431Q and IRALp962L1134Q); RZPD). These cDNA clones and the GST constructs were cloned into pEBB (13), a mammalian expression vector with a strong EF-1 promoter. Plasmid pEBB-Nck-Myc was obtained from B. J. Mayer (University of Connecticut, Farmington, CT) and pLckY505F sfrom T. Mustelin (Burnham Institute, La Jolla, CA). The CD8/CD3
chimera consists of the ectodomain and transmembrane domain of human CD8
with two tandem copies of the Myc epitope inserted after the signal peptide cleavage site, fused to the cytoplasmic tail of human CD3
. In the Myc-TM-CD3
chimera, the ectodomain of CD8
was deleted, that is, the Myc epitopes are between the CD8 signal peptide and transmembrane domain. Details regarding all plasmid constructs are available upon request. 293FT cells were used for transfections; they were maintained in DMEM high glucose supplemented with 10% FBS and 2 mM glutamine. A standard calcium phosphate precipitation method was used for all transient transfections. Typically, 2 µg of pEBBGST plasmids, 3 µg of pLck-DA, and 6 µg of plasmid for CD3
were used per a 10-cm dish. Immunoprecipitations, electrophoresis, and immunoblotting were done by standard methods (14). Cells were lysed in 1% Nonidet P-40 (14) buffer containing 50 mM octylglucopyranoside (Sigma-Aldrich). The human SH3 phage library and the semiquantitative protein interaction assay have been described (12).
Abs used
Abs (with clone) were from the following sources: mouse anti-hemagglutinin (HA) (F-7), mouse anti-Myc (9E10), mouse anti-phosphotyrosine (PY20), and rabbit anti-CD3
(FL-207) from Santa Cruz Biotechnology; rabbit anti-HA (Sigma-Aldrich); mouse anti-GST (GE Healthcare Bio-Sciences); mouse anti-phosphotyrosine (4G10; Upstate Biotechnology) used in one experiment (see Fig. 8); and mouse anti-CD3
(OKT3; eBioscience). Streptavidin IRDye 800CW, goat anti-mouse IgG IRDye 800CW, and goat anti-rabbit IgG IRDye 680 were from LI-COR Biosciences. Secondary HRP-conjugated Abs were from DakoCytomation.
|
Peptide arrays were synthesized on cellulose paper by using MultiPep automated multiple peptide synthesizer (INTAVIS Bioanalytical Instruments) as described (15).
Overlays
Interaction of spotted peptides with GST-fusion proteins was tested by overlaying the membranes with 1 µg/ml recombinant protein in TBST. Bound recombinant proteins were detected with anti-GST using a protocol where the filters were blocked in 5% nonfat dry milk in TBST for 30 min at room temperature, incubated 1 h at room temperature or overnight at 4°C with primary Abs, washed four times 5 min in TBST with 0.1% Tween 20, and incubated with a HRP-conjugated secondary Ab. Blots were developed using Supersignal West Dura Extended Duration Substrate or Supersignal West Pico Chemiluminescent Substrate (Pierce).
Lentivirus production and transduction
The full-length Eps8L1 cDNA was fused with a biotin acceptor domain fragment (16) and cloned into pWPIneo, a lentiviral expression vector in which the GFP fragment of pWPI from D. Trono (The Swiss Federal Institute of Technology, Lausanne, Switzerland) was replaced with the G418 resistance gene, to generate pWPIneoEps8L1. This plasmid was cotransfected into 293FT cells with pDELTA-8.9 and pVSVg to generate infectious virus particles (17). Cell culture supernatant was used to infect Jurkat E-6 cells. Cells were grown in RPMI 1640 medium supplemented with 10% FBS and 2 mM L-glutamine in the presence of G418 at 600 µg/ml for 10 days to select for stable integrants.
Cell stimulation and lysis
Jurkat E-6 cells stably expressing Eps8L1 and control cells were grown in RPMI 1640 medium, harvested, incubated in serum-free medium buffered with 10 mM HEPES (pH 7.4) for 60 min, centrifuged, and suspended in the same medium at 108 cells/ml. Cells were stimulated with anti-CD3
Ab OKT3 at a concentration of 10 µg/ml. Freshly prepared pervanadate was added to a final concentration of 0.1 mM. Then, cells were diluted with 10 ml of ice-cold PBS and centrifuged. The 1 ml of lysis buffer (0.3% Brij 97, 20 mM Tris (pH 7.8), 2 mM orthovanadate, 1 mM NaF, and protease inhibitors; all from Sigma-Aldrich) was added per 108 cells. After 20 min on ice, samples were centrifuged and supernatants were subjected to avidin pulldown (TetraLink Tetrameric Avidin Resin; Promega) or anti-CD3
immunoprecipitation. Odyssey Infrared Imaging System (LI-COR Biosciences) was used for detection and quantification in Western blotting.
Analysis of mRNA expression
Total RNA was isolated from 107 cells using GenElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich). A total of 2.5-µg samples were first treated with RNase-free DNase I (Fermentas UAB) to remove any contaminating DNA, and then either reverse-transcribed using random hexamer primers (RevertAid H Minus First Strand cDNA Synthesis kit; Fermentas UAB) or mock-treated without reverse transcriptase. PCR primers were designed with Primer3 program (18) and had a melting temperature of 60°C. The primer sequences were as follows: Eps8 AGGACCAGGAGAGGGTGTTT, TGCCTGCACCACCATATTTA; Eps8L1 TCACTCCACGTGAAAACGAG, CTCCAAGTCTCGGTGACCAT; GAPDH GAGTCAACGGATTTGGTCGT, TTGATTTTGGAGGGATCTCG; and TATA-box binding protein (TBP) GAATATAATCCCAAGCGGTTTG, ACTTCACATCACAGCTCCCC. PCR was done using a LightCycler Instrument (Roche Molecular Biochemicals) with Qiagen QuantiTect SYBR Green PCR kit. After initial activation of DNA polymerase at 95°C for 15 min, 50 amplification cycles were conducted as follows: denaturation at 94°C for 13 s, annealing at 55°C for 20 s, and extension at 72°C for 12 s. The PCR products were verified by melting curve analysis as well as restriction digestion and gel electrophoresis.
| Results |
|---|
|
|
|---|
, we expressed its intracellular domain as a GST fusion protein in Escherichia coli (see Fig. 1), and used this recombinant protein for panning of our human SH3 proteome phage display library (12). The CD3
fusion protein was found to serve as excellent "bait" in this system. It bound 10- to 100-fold more SH3 phages than did plain GST, as judged by the number of ampicillin-resistant bacterial colonies obtained by infection of E. coli with phages associated with these proteins after washing (data not shown). The identity of the SH3 domains bound to GST-CD3
was determined by sequencing of the SH3 inserts of the selected phage clones. The 15 SH3 clones identified after a single round of phage selection all represented Eps8L1 (8/15), Nck1(I/III)-SH3 (1/15), or Nck2(I/III)-SH3 (6/15). Thus, these phage selection results supported the idea of Nck as an SH3 domain-containing CD3
-interacting protein as proposed by Gil et al. (5), but also indicated Eps8L1 as a preferred SH3-containing partner of CD3
.
|
in another system, they were produced as GST fusion proteins, and tested for binding to the CD3
intracellular tail fused to maltose-binding protein using a previously described multiwell assay (12). In addition to Eps8L1, Nck1(I/III), and Nck2(I/III), we also included in these studies the SH3 domains of the three other related Eps8 family proteins (Eps8, Eps8L2, and Eps8L3) as well as several unrelated SH3 domains.
Fig. 2 shows binding signals obtained with 2-fold dilutions ranging from 600 to 75 nM Nck(I/III) and Eps8 family SH3 domains, Hck-SH3, or plain GST. Apart from Eps8L2-SH3, which showed only weak binding under these conditions, all Nck(I/III)-SH3 and Eps8-SH3 domains bound well to CD3
, and gave a significant interaction signal even when tested at 75 nM. In accordance with our phage library screening data, however, Eps8L1-SH3 and Nck(I/III)-SH3 domains showed the highest apparent affinity for CD3
in this assay.
|
-PIX,
-PIX, Nck1(II/III), ArgBP2(III/III), and vinexin(III/III), showed significant binding to CD3
even when used at concentrations up to 40 µM (data not shown). Each of these SH3 proteins has previously been shown to be functional in the same assay format (12). In summary, these data show that the intracellular tail of CD3
is an avid and highly specific ligand for Nck(I/III) and Eps8 family (in particular Eps8L1) SH3 domains.
Because little was known about expression of the Eps8 family genes in T cells, we wanted to address this issue. We used the DU145 prostate carcinoma cell line as a source of control mRNA because Eps8 genes, including Eps8L1, have been shown to be expressed in various epithelial cells and in the prostate (19). Initial analysis indicated that specific PCR products for Eps8 and Eps8L1 could be amplified from cDNA prepared from DU145 cells as well as Jurkat and primary human CD3-positive T lymphocytes, but not from mock cDNA preparations prepared in parallel with these mRNAs without reverse transcriptase (data not shown). To get a better idea of the relative expression levels of these mRNAs we used quantitative real-time RT-PCR in which expression of two housekeeping genes, highly expressed GAPDH and low-abundance TBP, were analyzed as controls. Results from Jurkat and DU145 cells are shown in Fig. 3. As can be seen, Eps8L1 was expressed in similar amounts in both cell lines, whereas Eps8 was expressed at a higher level in DU145 cells. As judged by comparison with the GAPDH and TBP RT-PCR signals, expression of Eps8 and Eps8L1 mRNAs in Jurkat cells was not high but still easily detectable and possibly higher than that of TBP mRNA. All PCR signals from the primary human T cell cDNA were lower, but based on dilution of the cell line cDNA, the relative expression levels of Eps8 and Eps8L1 in Jurkat and primary human T cells were found to be very similar (data not shown). Thus, these analyses confirmed that mRNA for two members of the Eps8 family that showed strongest SH3-mediated binding to CD3
was indeed expressed in human T cells. Extension of these results to the protein level will require development of high quality Abs for immunological detection of these proteins.
|
of all Eps8 family proteins in the initial assays, we focused these studies on Eps8L1. As a control we used an expression vector for full-length Nck1, which has been shown to associate with CD3
in previous coprecipitation studies (5). The 293FT cells were transfected with expression vectors for HA-tagged CD3
together with Myc-tagged versions of Eps8L1, wild-type Nck, or a mutant form of Nck in which a functionally critical tryptophan residue in each SH3 domain had been changed to lysine (20). Lysates of the transfected cells were subjected to anti-Myc immunoprecipitations and analyzed by SDS-PAGE and immunoblotting. As shown in Fig. 4, CD3
was detectable in the immunoprecipitates in which Eps8L1 or wild-type Nck were present, but in none of the control samples (lacking CD3
or a Myc-tagged protein, or containing SH3-deficient Nck). Thus, the interaction required functional SH3 domains, and under these conditions Eps8L1 bound equally well or better than Nck, consistent with the in vitro binding assays.
|
protein was located at the plasma membrane and exposed to the extracellular space (data not shown). Moreover, we found that both CD3
biotinylation and coprecipitation with Eps8L1 were increased when an R183T change (21) was introduced to destroy the endoplasmic reticulum retention signal of the transfected CD3
. These data support the idea that the interaction of the transfected CD3
and Eps8L1 proteins indeed took place at least in part if not exclusively at the plasma membrane.
The Eps8 family of SH3 domains has been shown to bind to an atypical motif PxxDY instead of the classical PxxP consensus (23). Indeed, we noticed a PxxDY motif also in the proline-rich intracellular tail (aa 162–166) of CD3
(Fig. 1). To map the critical determinants in CD3
required for binding of Eps8-SH3 and Nck(I/III)-SH3 domains, progressive N- and C-terminal deletions (from residue 131 to 152 and from 187 to 169, respectively) were initially constructed and expressed as GST fusions in bacteria. Binding of Eps8L1-SH3 and Nck1(I/III)-SH3 domains to all these CD3
proteins was similar (data not shown). Although subtle effects on binding by the deleted regions could not be ruled out by this analysis, it indicated the core region 152–169 as the principal binding target for both SH3 domains.
Next we synthesized a peptide overlapping this region (residues 155–179) immobilized on cellulose paper together with derivatives substituted with an increasing number of alanine residues starting from the N terminus or the C terminus (Fig. 5A), or with overlapping dialanine substitutions (Fig. 5B). This deletion and substitution analysis revealed that both Nck and Eps8L1 relied on the sequence PNPDY for binding to CD3
. Furthermore, binding of Nck appeared somewhat more sensitive to substitutions N- and C-terminal to the PNPDY sequence, indicating that the Nck-SH3 domain requires additional determinants for high affinity binding.
|
was larger (PPVPNPDY) the same PxxDY motif residues were essential for Nck-SH3 binding as well.
|
was expressed as a CD8/CD3
chimera (consisting of a Myc-tagged ectodomain and transmembrane region of CD8 fused to the intracellular domain CD3
), together with similar constructs in which Y166 (FY) or Y177 (YF) was changed to phenylalanine. These vectors were transiently coexpressed with GST-tagged Nck1-SH3 or Eps8L1-SH3 domains in 293FT cells. Cells were lysed 44 h after transfection, and pulldowns were performed with glutathione-Sepharose beads, followed by SDS-PAGE and immunoblotting. Samples of unprocessed lysates of the transfected cells were analyzed in parallel. As shown in Fig. 6B, both Nck1-SH3 and Eps8L1-SH3 bound to the wild-type CD3
and CD3
-YF but not to the CD3
-FY. These data established that Y166, which is an essential component of a functional PxxDY motif, was indeed necessary for Nck/Eps8 binding also in living cells, whereas the following tyrosine residue (Y177) was dispensable.
The tyrosine residue of the PxxDY motif (Y166) is shared with the ITAM element of CD3
. This compact arrangement of binding motifs points to possible cross-regulation of CD3
tyrosine phosphorylation and SH3/SH2 domain binding during T cell activation. To address this issue experimentally, we coexpressed Nck1-SH3 and a CD8/CD3
chimera with or without a dominantly active form of Lck (Lck-Y505F) to phosphorylate the tyrosine residues of the CD3
ITAM. In these experiments we used a smaller CD8/CD3
chimera in which almost all of the CD8 ectodomain was substituted with a Myc tag (Myc-TM-CD3
) because this construct was more efficiently phosphorylated by Lck than the larger CD8/CD3 chimera used in the previous experiments. As shown in Fig. 7A, coexpression of Lck-Y505F resulted in strong tyrosine phosphorylation of Myc-TM-CD3
detected in the lysate (Fig. 7A, bottom panel), and abolished coprecipitation of Myc-TM-CD3
with Nck1-SH3 (Fig. 7A, compare two leftmost lanes). Because similar amounts of total Myc-TM-CD3
protein were expressed, and similar amounts of GST-tagged Nck1-SH3 were precipitated in both cases, we conclude that CD3
ITAM phosphorylation negatively regulates binding of Nck1-SH3.
|
in the presence, but not in the absence of coexpressed Lck-Y505F (Fig. 7A, compare two middle lanes). The coprecipitated Myc-TM-CD3
gave a strong signal when probed with an anti-phosphotyrosine Ab (Fig. 7A, bottom). As a negative control we used Hck-SH3 domain, which did not bind to the intracellular tail of CD3
in our in vitro protein-protein binding assay (see Fig. 2). No Myc-TM-CD3
could be coprecipitated with Hck-SH3 in the GST pulldown independent of whether or not the CD3
ITAM was phosphorylated by Lck-Y505F (Fig. 7A, compare two rightmost lanes). The observation of Nck-SH3 association with CD3
only in the absence of Lck phosphorylation was in agreement with our earlier data showing that introduction of a phenylalanine residue in place of Y166 in the CD3
PxxDY motif abolished binding of Nck1-SH3 and Eps8L1-SH3 domain. Indeed, in other experiments we could also show that phosphorylation of the tyrosine residue in CD3
PxxDY similarly prevented coprecipitation of Eps8L1-SH3 (data not shown).
To formally establish that phosphorylation of Y166 (rather than Y177) in the ITAM was critical, and to confirm that other possible effects of the coexpressed Lck-Y505F did not contribute to the loss of coprecipitation of Myc-TM-CD3
with Nck1-SH3 or Eps8L1-SH3 domains, peptides spanning the PxxDY-ITAM region of CD3
were synthesized either in unmodified form, or with Y166, Y177, or both substituted with a phosphotyrosine residue (Fig. 7B). Probing of filters containing these peptides with recombinant Nck1-SH3 and Eps8L1-SH3 proteins clearly showed that phosphorylation of Y166 alone or in combination with Y177 abolished all SH3 binding, whereas phosphorylation of Y177 alone had no effect. Thus, although ITAM phosphorylation created binding sites for SH2 domains of Zap70, the same phosphorylation event blocked binding of SH3 domains of Nck1 and Eps8L1, demonstrating that the PxxDY-ITAM region of CD3
binds SH3 and SH2 domains in a mutually exclusive and phosphotyrosine-regulated manner.
The studies described above as well as those reported by another group (5) have shown that CD3
expressed ectopically in non-T cells is constitutively competent for SH3 binding. However, binding of Nck to endogenous CD3
in T cells has been shown to require an activation-induced conformational change in the TCR-CD3 complex (5, 6, 24). Because TCR activation is also known to lead to ITAM phosphorylation (2, 3) it was of interest to study the overall effect of TCR ligation on SH3 binding to CD3
in the context of the native TCR-CD3 complex in T cells.
Because no Abs for immunological detection of native Eps8L1 were available, we generated Jurkat cell lines stably expressing a lentivirally transduced Eps8L1 tagged at its C terminus with a biotin acceptor domain (J/Eps8L1-biotin), which can be efficiently precipitated and detected with avidin-based reagents (16). These cells and control Jurkat cells were stimulated with anti-CD3
Ab (OKT3) in the absence or presence of the tyrosine phosphatase inhibitor pervanadate. Aliquots of lysates from these cells were examined for their total phosphotyrosine content, and the rest was used for precipitation of Ep8L1 with avidin-coated beads. As expected, TCR ligation in pervanadate-treated cells resulted in robust increase in phosphorylation of several substrate proteins of TCR-activated tyrosine kinases (Fig. 8, bottom). Anti-phosphotyrosine immunoblotting of anti-CD3 immunoprecipitates confirmed that CD3
was indeed one of these phosphorylated proteins (data not shown). In the absence of pervanadate treatment, OKT3 stimulation increased the amount of CD3
in the Eps8L1 (avidin) pulldown samples (Fig. 8). Typically, the increase was 4- to 8-fold, as determined using the Odyssey Infrared Imaging System. This observation was in good agreement with the earlier conclusion by Alarcón and colleagues (5) that an activation-induced conformational change is required to fully expose the SH3 binding site in CD3
. However, supporting our cotransfection experiments with a dominantly active Lck kinase (see Fig. 7), when pervanadate was included to enhance TCR-triggered protein tyrosine phosphorylation, OKT3 stimulation failed to increase the amount of CD3
that precipitated with Eps8L1. As expected, control precipitations with avidin-coated beads from lysates of Jurkat cells not expressing biotinylation domain-tagged Eps8L1 contained no detectable CD3
regardless of OKT3 or pervanadate treatment of these cells.
These results confirmed that transduced Eps8L1 can associate with endogenous CD3
in Jurkat T cells. Moreover, these results show that SH3 binding by CD3
is under dual regulation by TCR activation. TCR ligation, presumably via an activation-induced conformational change, promotes association of Eps8L1 with CD3
. However, activation-induced CD3
tyrosine phosphorylation inhibits CD3
binding to Eps8L1, thereby providing a possible negative feedback regulation mechanism.
| Discussion |
|---|
|
|
|---|
among human SH3 domains. Except for Eps8L2, other members of the Eps8 family (Eps8 and Eps8L3) also bound well to CD3
. These data support the results of Gil et al. (5) who identified Nck as an SH3 partner of CD3
in a yeast two-hybrid screening of a spleen cDNA library, but indicate the Eps8 family proteins as alternative or additional regulators of intracellular signaling by CD3
.
The selectivity of CD3
for Nck(I/III) and Eps8 was found to involve recruitment of these SH3 domains via an atypical PxxDY binding motif in CD3
. This motif has been previously characterized as the minimal consensus sequence for binding of the Eps8 family (23), but not known to serve as a docking site for Nck or other non-Eps8 SH3 domains. Previous studies on binding of Nck(I/III)-SH3 to CD3
(5, 9, 25) did not map the critical CD3
residues involved in this interaction, but implicated a PxxP sequence within a cluster of prolines in CD3
(see Fig. 1). Although our results show that the additional proline residues adjacent to the PxxDY motif do contribute to Nck(I/III)-SH3 binding, the absolute requirement of the residues D165 and Y166 in addition to P162 clearly define the PxxDY sequence as the primary docking motif.
Considering the unexpected PxxDY specificity of Nck(I/III), it is of interest to note that Cesareni and colleagues (26) have proposed that a positively charged amino acid at position –2 relative to the first highly conserved tryptophan of the WW motif present in most SH3 domains would be important for PxxDY recognition by the Eps8-SH3 domain. Indeed, we noted that in addition to the four members of the Eps8 family, the N-terminal SH3 of Nck1 and Nck2 also have a lysine or an arginine residue in this position. Although this feature is shared by 17 additional SH3 domains among the 296 that we have identified from the human genome (see Ref. 12), all of these differ from Eps8/Nck(I/III) in that they contain a negatively charged amino acid neighboring this Lys/Arg residue or lack the conserved WW motif (data not shown). Thus, the SH3 sequence X(K,R)XWW (where X can be any amino acid except for E or D) appears to be correlated with PxxDY recognition. Future structural studies will be required to test the relevance and possibly explain the molecular basis of this correlation. However, because some proteins that were reported to bind to Nck(I/III)-SH3, such as SAM68 (27), do not contain a PxxDY motif, binding of Nck(I/III)-SH3 may not be exclusively restricted to ligands with a PxxDY motif.
An intriguing aspect of the PxxDY motif of CD3
is that it overlaps with the ITAM of this TCR-CD3 complex subunit. Our data confirmed that phosphorylation of the tyrosine residue (Y166) shared by the ITAM and PxxDY motif of CD3
is required for recruitment of the tandem SH2 cassette of Zap70, which is a crucial early event in T cell activation (2, 3). Conversely, we found that tyrosine phosphorylation of the PxxDY motif abolishes Nck-SH3 or Eps8-SH3 binding to CD3
. Thus, phosphorylation of Y166 serves as molecular switch that determines whether CD3
is competent for SH2 or SH3 binding. There are several examples in which serine or tyrosine phosphorylation of an SH3 domain or its ligand negatively regulates binding (28, 29, 30), but to our knowledge, this example is the first of reciprocal regulation of SH3 and SH2 binding via phosphorylation of a common binding site.
This mutually exclusive binding of SH2 and SH3 proteins to CD3
has obvious implications for the currently unclear role of CD3
-SH3 interactions in T cell development and function. Gil et al. (5) suggested that Nck binding to CD3
immediately following TCR ligation would contribute to optimal signaling output by the TCR-CD3 complex. This conclusion has been criticized (31) because it was mainly based on ectopic overexpression of Nck(I/III)-SH3, which conceivably could interfere with many other later signaling events involved T cell activation. Also, it has been shown that at least the bulk of Nck recruitment to the TCR-CD3 complex does not occur in the absence of protein tyrosine kinase activity, and is instead mediated by binding of the Nck-SH2 domain to phosphorylated SLP-76 (32). In any case, assuming that early SH3 binding to CD3
is required for maximal TCR signaling, our results argue that the interaction with Nck and/or Eps8 proteins would have to be transient and lost before Zap70 (or Syk) binding could take place. Such transient binding of Nck or Eps8 could help to recruit Lck or Fyn or otherwise facilitate phosphorylation of Y166 to create a docking site for Zap70. However, our results could also be explained by involvement of Nck or Eps8 binding to CD3
in other aspects of TCR-CD3 function, which might take place only later after ITAM dephosphorylation, or in an alternative signaling pathway distinct from the canonical Lck/Zap70/LAT/SLP-76 cascade. In particular, if Eps8L1 or other members of this family turn out to be more relevant partners of CD3
than Nck, the lessons learned from studies on Eps8 in regulation of epidermal growth factor receptor signaling, internalization, and trafficking (33) might provide a framework for future investigations into this question. Also, the recently revealed actin capping activity of Eps8 (34, 35) could hint to alternative roles for the Eps8L1-CD3
interaction in regulation of T cell actin remodeling.
The transmembrane and ectodomains of CD3
are required for proper assembly of the TCR-CD3 complex, and are therefore critical for normal T cell development and function (reviewed in Ref. 1). By contrast, the function of the intracellular signal-transducing domain of CD3
appears to be highly redundant with signaling output of the three other CD3 subunits (CD3
, CD3
, and CD3
) (reviewed in Ref. 2), which complicates studies of signaling interactions by any individual CD3 subunit. All CD3 subunits contain one or more ITAMs, whereas only CD3
carries a hitherto known SH3 binding motif. Nevertheless, it is possible that the function provided to the TCR-CD3 complex via SH3 binding by CD3
may also be redundant with protein interactions mediated by other CD3 subunits.
The exact dissociation constants of the Eps8-Nck(I/III)-SH3-CD3
complexes remain to be determined, but our current data point to nanomolar KD values for the strongest ones of these interactions (see Fig. 2). This unusually tight SH3 binding together with the evolutionary conservation of the Eps8-Nck(I/III) target site in CD3
(see below) would seem to argue for an important role for this interaction. Yet, in an apparent conflict with this idea, Szymczak et al. (9) recently reported that the defects in T cell development and function of CD3
-deficient 
P mice (36) could be rescued using a mutant CD3
allele lacking the highly conserved proline residues, including the PxxDY-defining proline. However, considering that the region involved in Nck and Eps8 binding shows the highest degree of conservation among vertebrate CD3
orthologs and is identical in amino acid sequence from flounder to man (data not shown), we believe that the results by Szymczak et al. (9) are better explained by functional redundancy within the mouse TCR-CD3 complex than by irrelevance of the Eps8 or Nck(I/III) binding site of CD3
. Development of novel approaches, such as combined mutations in the intracellular signaling domains of different CD3 subunits to reduce this redundancy, are warranted to establish the role of SH3 binding by CD3
in T cell biology, and to identify the relative importance of Nck and Eps8 family proteins as cellular partners of CD3
.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from the Academy of Finland, Medical Research Council of Tampere University Hospital, Medical Research Council of Helsinki University Hospital, and Sigrid Juselius Foundation (to K.S.), and from the Functional Genomics Program (FUGE), The Research Council of Norway, Norwegian Cancer Society, and Novo Nordic Foundation Committee (to K.T.). ![]()
2 Address correspondence and reprint requests to Dr. Kalle Saksela, Department of Virology, Haartman Institute, University of Helsinki, Haartmaninkatu 3, FIN-0014 Helsinki, Finland. E-mail address: kalle.saksela{at}helsinki.fi ![]()
3 Abbreviations used in this paper: SH, Src homology domain; TBP, TATA-box binding protein; HA, hemagglutinin. ![]()
Received for publication April 17, 2007. Accepted for publication May 1, 2007.
| References |
|---|
|
|
|---|
reveals a ligand-induced conformational change essential for T cell receptor signaling and synapse formation. Cell 109: 901-912. [Medline]
proline-rich sequence, and its interaction with Nck, is not required for T cell development and function. J. Immunol. 175: 270-275.
and adopts a helix-turn structure. EMBO J. 14: 2257-2268. [Medline]
or CD3


. J. Immunol. 162: 88-94. This article has been cited by other articles:
![]() |
J.-F. Brodeur, S. Li, O. Damlaj, and V. P. Dave Expression of fully assembled TCR-CD3 complex on double positive thymocytes: synergistic role for the PRS and ER retention motifs in the intra-cytoplasmic tail of CD3{varepsilon} Int. Immunol., October 9, 2009; (2009) dxp098v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Brodeur, S. Li, M. d. S. Martins, L. Larose, and V. P. Dave Critical and Multiple Roles for the CD3{epsilon} Intracytoplasmic Tail in Double Negative to Double Positive Thymocyte Differentiation J. Immunol., April 15, 2009; 182(8): 4844 - 4853. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Tailor, S. Tsai, A. Shameli, P. Serra, J. Wang, S. Robbins, M. Nagata, A. L. Szymczak-Workman, D. A. A. Vignali, and P. Santamaria The Proline-Rich Sequence of CD3{epsilon} as an Amplifier of Low-Avidity TCR Signaling J. Immunol., July 1, 2008; 181(1): 243 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Heikkinen, A. Kazlauskas, K. Melen, R. Wagner, T. Ziegler, I. Julkunen, and K. Saksela Avian and 1918 Spanish Influenza A Virus NS1 Proteins Bind to Crk/CrkL Src Homology 3 Domains to Activate Host Cell Signaling J. Biol. Chem., February 29, 2008; 283(9): 5719 - 5727. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |