The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 878 -885
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kesti, T.
Right arrow Articles by Saksela, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kesti, T.
Right arrow Articles by Saksela, K.

Reciprocal Regulation of SH3 and SH2 Domain Binding via Tyrosine Phosphorylation of a Common Site in CD3{epsilon}1

Tapio Kesti*, Anja Ruppelt{dagger}, Jing-Huan Wang{ddagger}, Michael Liss§, Ralf Wagner§, Kjetil Taskén{dagger} and Kalle Saksela2,*,{ddagger}

* Department of Virology, Haartman Institute, University of Helsinki and Helsinki University Central Hospital, Helsinki, Finland; {dagger} Biotechnology Centre, University of Oslo, Oslo, Norway; {ddagger} Institute of Medical Technology, University of Tampere and Tampere University Hospital, Tampere, Finland; § Geneart, Regensburg, Germany; and Institute of Medical Microbiology and Hygiene, University of Regensburg, Regensburg, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Recruitment of cellular signaling proteins by the CD3 polypeptides of the TCR complex mediates T cell activation. We have screened a human Src homology 3 (SH3) domain phage display library for proteins that can bind to the proline-rich region of CD3{epsilon}. This screening identified Eps8L1 (epidermal growth factor receptor pathway substrate 8-like 1) together with the N-terminal SH3 domain of Nck1 and Nck2 as its preferred SH3 partners. Studies with recombinant proteins confirmed strong binding of CD3{epsilon} to Eps8L1 and Nck SH3 domains. CD3{epsilon} bound well also to Eps8 and Eps8L3, and modestly to Eps8L2, but not detectably to other SH3 domains tested. Interestingly, binding of Nck and Eps8L1 SH3 domains was mapped to a PxxDY motif that shared its tyrosine residue (Y166) with the ITAM of CD3{epsilon}. Phosphorylation of this residue abolished binding of Eps/Nck SH3 domains in peptide spot filter assays, as well as in cells cotransfected with a dominantly active Lck kinase. TCR ligation-induced binding and phosphorylation-dependent loss of binding were also demonstrated between Eps8L1 and endogenous CD3{epsilon} in Jurkat T cells. Thus, phosphorylation of Y166 serves as a molecular switch during T cell activation that determines the capacity of CD3{epsilon} to interact with either SH3 or SH2 domain-containing proteins.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
T cells recognize foreign peptides presented by MHC molecules of APCs. The TCR consists of a {alpha}beta TCR heterodimer (or {gamma}{delta} TCR in {gamma}{delta} T cells) responsible for ligand binding and is associated with the signal-transducing CD3 complex composed of heterodimeric CD3{gamma}-CD3{epsilon} and CD3{delta}-CD3{epsilon} and homodimer CD3{zeta} (see Ref. 1). The cytoplasmic tails of CD3 chains include tyrosine- and leucine-containing motifs called ITAM (YxxL/I(x6–8)YxxL/I) (2). CD3{gamma}, CD3{delta}, and CD3{epsilon} have one ITAM each, whereas CD3{zeta} contains three ITAM. These are phosphorylated upon TCR ligation by the Src family protein tyrosine kinase Lck (3), generating docking sites for Src homology (SH)3 2 domain-containing proteins. Zap70 is the principal CD3 ITAM-binding SH2 protein, but other interacting proteins have also been reported (2). Recruitment of Zap70 leads to its phosphorylation and activation, further tyrosine phosphorylation, and recruitment of other kinases and adapter proteins (4). These responses result in the activation of multiple signaling pathways, changes in actin cytoskeleton, and induction of numerous genes.

Although phosphorylation of ITAMs has been regarded as the earliest signaling event following TCR triggering, it has been shown that the TCR-CD3 complex undergoes a conformational change that occurs even earlier and independently of phosphorylation, which exposes a proline-rich region in the cytoplasmic tail of CD3{epsilon} (5, 6, 7). This alteration enables binding of Nck via its first SH3 domain (in the following referred to as Nck(I/III)-SH3) (5). This conformational change has been proposed to be essential for T cell activation (5), and shown to correlate spatially and temporally with negative selection of T cells (8), but the functional importance of the proline-rich residues in CD3{epsilon} has been recently challenged (9).

The SH3 domain is the most common modular protein binding domain in nature. It binds proline-rich sequences, which often contain the consensus sequence proline-x-x-proline (for reviews, see Refs. 10, 11). SH3 domains are typically found in proteins involved in signal transduction, membrane trafficking, and cytoskeletal organization. We have recently generated an essentially complete collection (n = 296) of human SH3 domains in the form of a phage display library, and used this system for identification of preferred SH3 partners for different ligand proteins (12). Because studies by Gil et al. (5) suggested an important role for SH3 binding by CD3{epsilon} in TCR function, but did not exclude the possibility that SH3 proteins other than Nck(I/III) could be involved, we decided to carry out a comprehensive and unbiased characterization of SH3 binding preferences of CD3{epsilon}.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Reagents and cell culture

The expression constructs for CD3{epsilon} and Eps8L1 (epidermal growth factor receptor pathway substrate 8-like 1) were generated from cDNA clones purchased from Deutsches Resourcenzentrum für Genomforschung (CD3{epsilon} (IRATp970D0474D) and Eps8L1 (IMAGp998E1911431Q and IRALp962L1134Q); RZPD). These cDNA clones and the GST constructs were cloned into pEBB (13), a mammalian expression vector with a strong EF-1 promoter. Plasmid pEBB-Nck-Myc was obtained from B. J. Mayer (University of Connecticut, Farmington, CT) and pLckY505F sfrom T. Mustelin (Burnham Institute, La Jolla, CA). The CD8/CD3{epsilon} chimera consists of the ectodomain and transmembrane domain of human CD8{alpha} with two tandem copies of the Myc epitope inserted after the signal peptide cleavage site, fused to the cytoplasmic tail of human CD3{epsilon}. In the Myc-TM-CD3{epsilon} chimera, the ectodomain of CD8{alpha} was deleted, that is, the Myc epitopes are between the CD8 signal peptide and transmembrane domain. Details regarding all plasmid constructs are available upon request. 293FT cells were used for transfections; they were maintained in DMEM high glucose supplemented with 10% FBS and 2 mM glutamine. A standard calcium phosphate precipitation method was used for all transient transfections. Typically, 2 µg of pEBBGST plasmids, 3 µg of pLck-DA, and 6 µg of plasmid for CD3{epsilon} were used per a 10-cm dish. Immunoprecipitations, electrophoresis, and immunoblotting were done by standard methods (14). Cells were lysed in 1% Nonidet P-40 (14) buffer containing 50 mM octylglucopyranoside (Sigma-Aldrich). The human SH3 phage library and the semiquantitative protein interaction assay have been described (12).

Abs used

Abs (with clone) were from the following sources: mouse anti-hemagglutinin (HA) (F-7), mouse anti-Myc (9E10), mouse anti-phosphotyrosine (PY20), and rabbit anti-CD3{epsilon} (FL-207) from Santa Cruz Biotechnology; rabbit anti-HA (Sigma-Aldrich); mouse anti-GST (GE Healthcare Bio-Sciences); mouse anti-phosphotyrosine (4G10; Upstate Biotechnology) used in one experiment (see Fig. 8); and mouse anti-CD3{epsilon} (OKT3; eBioscience). Streptavidin IRDye 800CW, goat anti-mouse IgG IRDye 800CW, and goat anti-rabbit IgG IRDye 680 were from LI-COR Biosciences. Secondary HRP-conjugated Abs were from DakoCytomation.


Figure 8
View larger version (82K):
[in this window]
[in a new window]

 
FIGURE 8. TCR activation-regulated binding of Eps8L1 to endogenous CD3{epsilon}. Lentivirally transduced Jurkat cells expressing Eps8L1 tagged at the C terminus with a biotin acceptor domain (J/Eps8L1-biotin) and control Jurkat cells were stimulated with anti-CD3{epsilon} Ab OKT3 in the absence or presence of the phosphatase inhibitor pervanadate. Lysates of these cells were precipitated with avidin-coated beads and the amounts of Eps8L1 and associated CD3{epsilon} were determined by Western blotting (WB). Total lysates were blotted with Abs against CD3{epsilon} and phosphotyrosine. Odyssey Infrared Imaging System was used for detection.

 
Autospot peptide array

Peptide arrays were synthesized on cellulose paper by using MultiPep automated multiple peptide synthesizer (INTAVIS Bioanalytical Instruments) as described (15).

Overlays

Interaction of spotted peptides with GST-fusion proteins was tested by overlaying the membranes with 1 µg/ml recombinant protein in TBST. Bound recombinant proteins were detected with anti-GST using a protocol where the filters were blocked in 5% nonfat dry milk in TBST for 30 min at room temperature, incubated 1 h at room temperature or overnight at 4°C with primary Abs, washed four times 5 min in TBST with 0.1% Tween 20, and incubated with a HRP-conjugated secondary Ab. Blots were developed using Supersignal West Dura Extended Duration Substrate or Supersignal West Pico Chemiluminescent Substrate (Pierce).

Lentivirus production and transduction

The full-length Eps8L1 cDNA was fused with a biotin acceptor domain fragment (16) and cloned into pWPIneo, a lentiviral expression vector in which the GFP fragment of pWPI from D. Trono (The Swiss Federal Institute of Technology, Lausanne, Switzerland) was replaced with the G418 resistance gene, to generate pWPIneoEps8L1. This plasmid was cotransfected into 293FT cells with pDELTA-8.9 and pVSVg to generate infectious virus particles (17). Cell culture supernatant was used to infect Jurkat E-6 cells. Cells were grown in RPMI 1640 medium supplemented with 10% FBS and 2 mM L-glutamine in the presence of G418 at 600 µg/ml for 10 days to select for stable integrants.

Cell stimulation and lysis

Jurkat E-6 cells stably expressing Eps8L1 and control cells were grown in RPMI 1640 medium, harvested, incubated in serum-free medium buffered with 10 mM HEPES (pH 7.4) for 60 min, centrifuged, and suspended in the same medium at 108 cells/ml. Cells were stimulated with anti-CD3{epsilon} Ab OKT3 at a concentration of 10 µg/ml. Freshly prepared pervanadate was added to a final concentration of 0.1 mM. Then, cells were diluted with 10 ml of ice-cold PBS and centrifuged. The 1 ml of lysis buffer (0.3% Brij 97, 20 mM Tris (pH 7.8), 2 mM orthovanadate, 1 mM NaF, and protease inhibitors; all from Sigma-Aldrich) was added per 108 cells. After 20 min on ice, samples were centrifuged and supernatants were subjected to avidin pulldown (TetraLink Tetrameric Avidin Resin; Promega) or anti-CD3{epsilon} immunoprecipitation. Odyssey Infrared Imaging System (LI-COR Biosciences) was used for detection and quantification in Western blotting.

Analysis of mRNA expression

Total RNA was isolated from 107 cells using GenElute Mammalian Total RNA Miniprep kit (Sigma-Aldrich). A total of 2.5-µg samples were first treated with RNase-free DNase I (Fermentas UAB) to remove any contaminating DNA, and then either reverse-transcribed using random hexamer primers (RevertAid H Minus First Strand cDNA Synthesis kit; Fermentas UAB) or mock-treated without reverse transcriptase. PCR primers were designed with Primer3 program (18) and had a melting temperature of 60°C. The primer sequences were as follows: Eps8 AGGACCAGGAGAGGGTGTTT, TGCCTGCACCACCATATTTA; Eps8L1 TCACTCCACGTGAAAACGAG, CTCCAAGTCTCGGTGACCAT; GAPDH GAGTCAACGGATTTGGTCGT, TTGATTTTGGAGGGATCTCG; and TATA-box binding protein (TBP) GAATATAATCCCAAGCGGTTTG, ACTTCACATCACAGCTCCCC. PCR was done using a LightCycler Instrument (Roche Molecular Biochemicals) with Qiagen QuantiTect SYBR Green PCR kit. After initial activation of DNA polymerase at 95°C for 15 min, 50 amplification cycles were conducted as follows: denaturation at 94°C for 13 s, annealing at 55°C for 20 s, and extension at 72°C for 12 s. The PCR products were verified by melting curve analysis as well as restriction digestion and gel electrophoresis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
To identify SH3 domain-containing proteins that preferentially bind to human CD3{epsilon}, we expressed its intracellular domain as a GST fusion protein in Escherichia coli (see Fig. 1), and used this recombinant protein for panning of our human SH3 proteome phage display library (12). The CD3{epsilon} fusion protein was found to serve as excellent "bait" in this system. It bound 10- to 100-fold more SH3 phages than did plain GST, as judged by the number of ampicillin-resistant bacterial colonies obtained by infection of E. coli with phages associated with these proteins after washing (data not shown). The identity of the SH3 domains bound to GST-CD3{epsilon} was determined by sequencing of the SH3 inserts of the selected phage clones. The 15 SH3 clones identified after a single round of phage selection all represented Eps8L1 (8/15), Nck1(I/III)-SH3 (1/15), or Nck2(I/III)-SH3 (6/15). Thus, these phage selection results supported the idea of Nck as an SH3 domain-containing CD3{epsilon}-interacting protein as proposed by Gil et al. (5), but also indicated Eps8L1 as a preferred SH3-containing partner of CD3{epsilon}.


Figure 1
View larger version (8K):
[in this window]
[in a new window]

 
FIGURE 1. Amino acid sequence of the cytoplasmic tail of human CD3{epsilon}. These residues were expressed as a GST-fusion protein as indicated, or similarly fused to maltose-binding protein or the transmembrane and ectodomains of CD8. The PxxDY motif is underlined and the ITAM tyrosine residues are in boldface type.

 
To verify the interactions of these SH3 domains with CD3{epsilon} in another system, they were produced as GST fusion proteins, and tested for binding to the CD3{epsilon} intracellular tail fused to maltose-binding protein using a previously described multiwell assay (12). In addition to Eps8L1, Nck1(I/III), and Nck2(I/III), we also included in these studies the SH3 domains of the three other related Eps8 family proteins (Eps8, Eps8L2, and Eps8L3) as well as several unrelated SH3 domains.

Fig. 2 shows binding signals obtained with 2-fold dilutions ranging from 600 to 75 nM Nck(I/III) and Eps8 family SH3 domains, Hck-SH3, or plain GST. Apart from Eps8L2-SH3, which showed only weak binding under these conditions, all Nck(I/III)-SH3 and Eps8-SH3 domains bound well to CD3{epsilon}, and gave a significant interaction signal even when tested at 75 nM. In accordance with our phage library screening data, however, Eps8L1-SH3 and Nck(I/III)-SH3 domains showed the highest apparent affinity for CD3{epsilon} in this assay.


Figure 2
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 2. Relative binding of CD3{epsilon} to selected SH3 domains. CD3{epsilon} (fused to maltose-binding protein) was immobilized to the bottom of multiwell plates and probed with 2-fold dilutions of different GST-SH3 domain proteins or plain GST as indicated. Specific binding was measured based on absorbance at 405 nm (y-axis) of a chromogenic reaction generated by a glutathione-HRP conjugate. Nck1 and Nck2 refer to the first of the three SH3 domains in these proteins.

 
In contrast to Nck(I/III) and the Eps8 family, none of the other SH3 domains that we tested, including Hck, Lck, Src, Lyn, Fyn, Yes, nephrocystin, sorting nexins 9 and 30, endophilin1, Pacsin3, Grb2(I/II), {alpha}-PIX, beta-PIX, Nck1(II/III), ArgBP2(III/III), and vinexin(III/III), showed significant binding to CD3{epsilon} even when used at concentrations up to 40 µM (data not shown). Each of these SH3 proteins has previously been shown to be functional in the same assay format (12). In summary, these data show that the intracellular tail of CD3{epsilon} is an avid and highly specific ligand for Nck(I/III) and Eps8 family (in particular Eps8L1) SH3 domains.

Because little was known about expression of the Eps8 family genes in T cells, we wanted to address this issue. We used the DU145 prostate carcinoma cell line as a source of control mRNA because Eps8 genes, including Eps8L1, have been shown to be expressed in various epithelial cells and in the prostate (19). Initial analysis indicated that specific PCR products for Eps8 and Eps8L1 could be amplified from cDNA prepared from DU145 cells as well as Jurkat and primary human CD3-positive T lymphocytes, but not from mock cDNA preparations prepared in parallel with these mRNAs without reverse transcriptase (data not shown). To get a better idea of the relative expression levels of these mRNAs we used quantitative real-time RT-PCR in which expression of two housekeeping genes, highly expressed GAPDH and low-abundance TBP, were analyzed as controls. Results from Jurkat and DU145 cells are shown in Fig. 3. As can be seen, Eps8L1 was expressed in similar amounts in both cell lines, whereas Eps8 was expressed at a higher level in DU145 cells. As judged by comparison with the GAPDH and TBP RT-PCR signals, expression of Eps8 and Eps8L1 mRNAs in Jurkat cells was not high but still easily detectable and possibly higher than that of TBP mRNA. All PCR signals from the primary human T cell cDNA were lower, but based on dilution of the cell line cDNA, the relative expression levels of Eps8 and Eps8L1 in Jurkat and primary human T cells were found to be very similar (data not shown). Thus, these analyses confirmed that mRNA for two members of the Eps8 family that showed strongest SH3-mediated binding to CD3{epsilon} was indeed expressed in human T cells. Extension of these results to the protein level will require development of high quality Abs for immunological detection of these proteins.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 3. Real-time RT-PCR analysis of expression of Eps8 family genes in Jurkat cells. Total RNA purified from Jurkat T cells and DU145 prostate carcinoma cells was reverse transcribed into cDNA. Then, mRNA expression of Eps8, Eps8L1, and housekeeping genes GAPDH and TBP was measured using a LightCycler. J, Jurkat cDNA; DU, DU145 cDNA; L1, Eps8L1; –RT, no reverse transcriptase.

 
Next we wanted to verify that interactions involving the corresponding full-length proteins could be observed in live cells. Because Eps8L1 showed the highest affinity to CD3{epsilon} of all Eps8 family proteins in the initial assays, we focused these studies on Eps8L1. As a control we used an expression vector for full-length Nck1, which has been shown to associate with CD3{epsilon} in previous coprecipitation studies (5). The 293FT cells were transfected with expression vectors for HA-tagged CD3{epsilon} together with Myc-tagged versions of Eps8L1, wild-type Nck, or a mutant form of Nck in which a functionally critical tryptophan residue in each SH3 domain had been changed to lysine (20). Lysates of the transfected cells were subjected to anti-Myc immunoprecipitations and analyzed by SDS-PAGE and immunoblotting. As shown in Fig. 4, CD3{epsilon} was detectable in the immunoprecipitates in which Eps8L1 or wild-type Nck were present, but in none of the control samples (lacking CD3{epsilon} or a Myc-tagged protein, or containing SH3-deficient Nck). Thus, the interaction required functional SH3 domains, and under these conditions Eps8L1 bound equally well or better than Nck, consistent with the in vitro binding assays.


Figure 4
View larger version (66K):
[in this window]
[in a new window]

 
FIGURE 4. Binding of full-length CD3{epsilon} to full-length Eps8L1 and Nck1 proteins in transfected cells. Expression vectors for Myc- and HA-tagged proteins were introduced into 293FT cells as indicated. Transfected cells were lysed and proteins associated with anti-Myc immunocomplexes were analyzed by SDS-PAGE and immunoblotting as indicated (top and middle panels). Uniform expression of CD3{epsilon} in all cells transfected with CD3{epsilon}-HA was confirmed by probing the total lysates with anti-HA Abs (bottom panel). Nckmut is a mutant of Nck1 in which all three SH3 domains have been rendered nonfunctional by changing a critical tryptophan residue to lysine (W38K/W143K/W229K, (20 )).

 
It is known that singly expressed CD3 chains are not efficiently translocated to the plasma membrane due to exposed endoplasmic reticulum retention signals (21). However, using a total cell surface protein biotinylation approach (22) we have confirmed that at least part of the transfected CD3{epsilon} protein was located at the plasma membrane and exposed to the extracellular space (data not shown). Moreover, we found that both CD3{epsilon} biotinylation and coprecipitation with Eps8L1 were increased when an R183T change (21) was introduced to destroy the endoplasmic reticulum retention signal of the transfected CD3{epsilon}. These data support the idea that the interaction of the transfected CD3{epsilon} and Eps8L1 proteins indeed took place at least in part if not exclusively at the plasma membrane.

The Eps8 family of SH3 domains has been shown to bind to an atypical motif PxxDY instead of the classical PxxP consensus (23). Indeed, we noticed a PxxDY motif also in the proline-rich intracellular tail (aa 162–166) of CD3{epsilon} (Fig. 1). To map the critical determinants in CD3{epsilon} required for binding of Eps8-SH3 and Nck(I/III)-SH3 domains, progressive N- and C-terminal deletions (from residue 131 to 152 and from 187 to 169, respectively) were initially constructed and expressed as GST fusions in bacteria. Binding of Eps8L1-SH3 and Nck1(I/III)-SH3 domains to all these CD3{epsilon} proteins was similar (data not shown). Although subtle effects on binding by the deleted regions could not be ruled out by this analysis, it indicated the core region 152–169 as the principal binding target for both SH3 domains.

Next we synthesized a peptide overlapping this region (residues 155–179) immobilized on cellulose paper together with derivatives substituted with an increasing number of alanine residues starting from the N terminus or the C terminus (Fig. 5A), or with overlapping dialanine substitutions (Fig. 5B). This deletion and substitution analysis revealed that both Nck and Eps8L1 relied on the sequence PNPDY for binding to CD3{epsilon}. Furthermore, binding of Nck appeared somewhat more sensitive to substitutions N- and C-terminal to the PNPDY sequence, indicating that the Nck-SH3 domain requires additional determinants for high affinity binding.


Figure 5
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 5. Minimal regions in CD3{epsilon} required for binding of Nck1(I/III)-SH3 and Eps8L1-SH3 domains. A, Membrane-immobilized peptides corresponding to residues 155–179 of CD3{epsilon}, or variants of it with progressive N- or C-terminal alanine substitutions, were probed with GST-fusion proteins containing Nck1(I/III)-SH3 or Eps8L1-SH3 domains as indicated. B, Residues 155–174 of CD3{epsilon} were subjected to overlapping dialanine substitutions as indicated, and probed with Nck1(I/III)-SH3 or Eps8L1-SH3 as in A.

 
A peptide matrix was also made of the region 159–170 in which all natural amino acids were tested at each position, as shown in Fig. 6A. Probing of these peptide arrays with Eps8L1-SH3 identified the peptide VPNPDY as the core binding site, and confirmed the critical role of the residues that form the PxxDY motif. Strikingly, probing of the same filters with Nck1(I/III)-SH3 showed a similar absolute dependence in binding for the PxxDY residues. Although the "footprint" of the Nck1(I/III)-SH3 on CD3{epsilon} was larger (PPVPNPDY) the same PxxDY motif residues were essential for Nck-SH3 binding as well.


Figure 6
View larger version (82K):
[in this window]
[in a new window]

 
FIGURE 6. Mutation analysis of CD3{epsilon} residues critical for SH3 binding. A, Essential role of a PxxDY motif for binding in vitro. A filter containing a synthetic peptide corresponding to CD3{epsilon} residues 159–170 (single-letter code on top of the filter) and its variants in which all natural amino acids (left of the filter) were systematically tested at each position was probed with Nck1(I/III)-SH3 or Eps8L1-SH3 as in Fig. 4. B, An intact PxxDY motif is required for coprecipitation from cells. The 293FT cells were transfected with vectors for GST-tagged Nck1(I/III)-SH3 or Eps8L1-SH3 domains together with a Myc-tagged CD8/CD3{epsilon} fusion protein (WT), or mutants of it in which the PxxDY-defining (Y166, FY) or the other tyrosine of the CD3{epsilon} ITAM (Y177, YF) had been replaced by a phenylalanine. Lysates of transfected cells were subjected to gluthathione-agarose precipitation, and the associated GST- and Myc-tagged proteins were analyzed by SDS-PAGE and immunoblotting as indicated (top and middle panels). Whole cell extracts (WCE) were analyzed in parallel for expression of Myc-tagged CD8/CD3{epsilon} to confirm uniform expression in all transfected cells (bottom panel).

 
To confirm the apparent requirement of the PxxDY motif for Nck/Eps8L1 binding in vivo, the cytoplasmic tail of CD3{epsilon} was expressed as a CD8/CD3{epsilon} chimera (consisting of a Myc-tagged ectodomain and transmembrane region of CD8 fused to the intracellular domain CD3{epsilon}), together with similar constructs in which Y166 (FY) or Y177 (YF) was changed to phenylalanine. These vectors were transiently coexpressed with GST-tagged Nck1-SH3 or Eps8L1-SH3 domains in 293FT cells. Cells were lysed 44 h after transfection, and pulldowns were performed with glutathione-Sepharose beads, followed by SDS-PAGE and immunoblotting. Samples of unprocessed lysates of the transfected cells were analyzed in parallel. As shown in Fig. 6B, both Nck1-SH3 and Eps8L1-SH3 bound to the wild-type CD3{epsilon} and CD3{epsilon}-YF but not to the CD3{epsilon}-FY. These data established that Y166, which is an essential component of a functional PxxDY motif, was indeed necessary for Nck/Eps8 binding also in living cells, whereas the following tyrosine residue (Y177) was dispensable.

The tyrosine residue of the PxxDY motif (Y166) is shared with the ITAM element of CD3{epsilon}. This compact arrangement of binding motifs points to possible cross-regulation of CD3{epsilon} tyrosine phosphorylation and SH3/SH2 domain binding during T cell activation. To address this issue experimentally, we coexpressed Nck1-SH3 and a CD8/CD3{epsilon} chimera with or without a dominantly active form of Lck (Lck-Y505F) to phosphorylate the tyrosine residues of the CD3{epsilon} ITAM. In these experiments we used a smaller CD8/CD3{epsilon} chimera in which almost all of the CD8 ectodomain was substituted with a Myc tag (Myc-TM-CD3{epsilon}) because this construct was more efficiently phosphorylated by Lck than the larger CD8/CD3 chimera used in the previous experiments. As shown in Fig. 7A, coexpression of Lck-Y505F resulted in strong tyrosine phosphorylation of Myc-TM-CD3{epsilon} detected in the lysate (Fig. 7A, bottom panel), and abolished coprecipitation of Myc-TM-CD3{epsilon} with Nck1-SH3 (Fig. 7A, compare two leftmost lanes). Because similar amounts of total Myc-TM-CD3{epsilon} protein were expressed, and similar amounts of GST-tagged Nck1-SH3 were precipitated in both cases, we conclude that CD3{epsilon} ITAM phosphorylation negatively regulates binding of Nck1-SH3.


Figure 7
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 7. Tyrosine phosphorylation blocks PxxDY-mediated SH3 binding to CD3{epsilon}. A, Lck-dependent phosphorylation of CD3{epsilon} ITAM prevents Nck1(I/III)-SH3 binding while enabling Zap70 SH2 binding. CD3{epsilon} was expressed in 293FT cells as a Myc-TM-CD3{epsilon} chimera together with a GST-tagged protein containing Nck1(I/III)-SH3, Hck-SH3, or tandem Zap70 SH2 domains, with or without a cotransfected dominantly active Lck kinase (Lck-DA). Following lysis of the cells proteins precipitated by gluthathione-agarose beads were analyzed by Western blotting with anti-GST, anti-Myc, or anti-phosphotyrosine Abs, as indicated. Uniform expression of Myc-TM-CD3{epsilon} in all transfected cells, and its tyrosine phosphorylation in cells transfected with Lck-DA was confirmed by probing total lysates with the corresponding Abs. B, Phosphorylation of tyrosine residue 166 accounts for the loss of SH3 binding to CD3{epsilon}. Peptides spanning the PxxDY/ITAM region of CD3{epsilon} were synthesized either in unmodified form or with Y166, Y177, or both substituted with a phosphotyrosine residue. Filters were probed with Nck1(I/III)-SH3 and Eps8L1-SH3 domains as in Fig. 4.

 
ITAM binding of Zap70 is known to be phosphotyrosine-dependent. Therefore, we also did precipitations with a GST-tagged fragment of Zap70 containing its two tandem SH2 domains. As expected, and in a striking contrast to the behavior of Nck1-SH3, the Zap70-SH2 protein associated strongly with Myc-TM-CD3{epsilon} in the presence, but not in the absence of coexpressed Lck-Y505F (Fig. 7A, compare two middle lanes). The coprecipitated Myc-TM-CD3{epsilon} gave a strong signal when probed with an anti-phosphotyrosine Ab (Fig. 7A, bottom). As a negative control we used Hck-SH3 domain, which did not bind to the intracellular tail of CD3{epsilon} in our in vitro protein-protein binding assay (see Fig. 2). No Myc-TM-CD3{epsilon} could be coprecipitated with Hck-SH3 in the GST pulldown independent of whether or not the CD3{epsilon} ITAM was phosphorylated by Lck-Y505F (Fig. 7A, compare two rightmost lanes). The observation of Nck-SH3 association with CD3{epsilon} only in the absence of Lck phosphorylation was in agreement with our earlier data showing that introduction of a phenylalanine residue in place of Y166 in the CD3{epsilon} PxxDY motif abolished binding of Nck1-SH3 and Eps8L1-SH3 domain. Indeed, in other experiments we could also show that phosphorylation of the tyrosine residue in CD3{epsilon} PxxDY similarly prevented coprecipitation of Eps8L1-SH3 (data not shown).

To formally establish that phosphorylation of Y166 (rather than Y177) in the ITAM was critical, and to confirm that other possible effects of the coexpressed Lck-Y505F did not contribute to the loss of coprecipitation of Myc-TM-CD3{epsilon} with Nck1-SH3 or Eps8L1-SH3 domains, peptides spanning the PxxDY-ITAM region of CD3{epsilon} were synthesized either in unmodified form, or with Y166, Y177, or both substituted with a phosphotyrosine residue (Fig. 7B). Probing of filters containing these peptides with recombinant Nck1-SH3 and Eps8L1-SH3 proteins clearly showed that phosphorylation of Y166 alone or in combination with Y177 abolished all SH3 binding, whereas phosphorylation of Y177 alone had no effect. Thus, although ITAM phosphorylation created binding sites for SH2 domains of Zap70, the same phosphorylation event blocked binding of SH3 domains of Nck1 and Eps8L1, demonstrating that the PxxDY-ITAM region of CD3{epsilon} binds SH3 and SH2 domains in a mutually exclusive and phosphotyrosine-regulated manner.

The studies described above as well as those reported by another group (5) have shown that CD3{epsilon} expressed ectopically in non-T cells is constitutively competent for SH3 binding. However, binding of Nck to endogenous CD3{epsilon} in T cells has been shown to require an activation-induced conformational change in the TCR-CD3 complex (5, 6, 24). Because TCR activation is also known to lead to ITAM phosphorylation (2, 3) it was of interest to study the overall effect of TCR ligation on SH3 binding to CD3{epsilon} in the context of the native TCR-CD3 complex in T cells.

Because no Abs for immunological detection of native Eps8L1 were available, we generated Jurkat cell lines stably expressing a lentivirally transduced Eps8L1 tagged at its C terminus with a biotin acceptor domain (J/Eps8L1-biotin), which can be efficiently precipitated and detected with avidin-based reagents (16). These cells and control Jurkat cells were stimulated with anti-CD3{epsilon} Ab (OKT3) in the absence or presence of the tyrosine phosphatase inhibitor pervanadate. Aliquots of lysates from these cells were examined for their total phosphotyrosine content, and the rest was used for precipitation of Ep8L1 with avidin-coated beads. As expected, TCR ligation in pervanadate-treated cells resulted in robust increase in phosphorylation of several substrate proteins of TCR-activated tyrosine kinases (Fig. 8, bottom). Anti-phosphotyrosine immunoblotting of anti-CD3 immunoprecipitates confirmed that CD3{epsilon} was indeed one of these phosphorylated proteins (data not shown). In the absence of pervanadate treatment, OKT3 stimulation increased the amount of CD3{epsilon} in the Eps8L1 (avidin) pulldown samples (Fig. 8). Typically, the increase was 4- to 8-fold, as determined using the Odyssey Infrared Imaging System. This observation was in good agreement with the earlier conclusion by Alarcón and colleagues (5) that an activation-induced conformational change is required to fully expose the SH3 binding site in CD3{epsilon}. However, supporting our cotransfection experiments with a dominantly active Lck kinase (see Fig. 7), when pervanadate was included to enhance TCR-triggered protein tyrosine phosphorylation, OKT3 stimulation failed to increase the amount of CD3{epsilon} that precipitated with Eps8L1. As expected, control precipitations with avidin-coated beads from lysates of Jurkat cells not expressing biotinylation domain-tagged Eps8L1 contained no detectable CD3{epsilon} regardless of OKT3 or pervanadate treatment of these cells.

These results confirmed that transduced Eps8L1 can associate with endogenous CD3{epsilon} in Jurkat T cells. Moreover, these results show that SH3 binding by CD3{epsilon} is under dual regulation by TCR activation. TCR ligation, presumably via an activation-induced conformational change, promotes association of Eps8L1 with CD3{epsilon}. However, activation-induced CD3{epsilon} tyrosine phosphorylation inhibits CD3{epsilon} binding to Eps8L1, thereby providing a possible negative feedback regulation mechanism.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Our phage display screens and in vitro binding assays shows that Eps8L1 and Nck1(I/III) and Nck2(I/III) are the preferred interaction partners for CD3{epsilon} among human SH3 domains. Except for Eps8L2, other members of the Eps8 family (Eps8 and Eps8L3) also bound well to CD3{epsilon}. These data support the results of Gil et al. (5) who identified Nck as an SH3 partner of CD3{epsilon} in a yeast two-hybrid screening of a spleen cDNA library, but indicate the Eps8 family proteins as alternative or additional regulators of intracellular signaling by CD3{epsilon}.

The selectivity of CD3{epsilon} for Nck(I/III) and Eps8 was found to involve recruitment of these SH3 domains via an atypical PxxDY binding motif in CD3{epsilon}. This motif has been previously characterized as the minimal consensus sequence for binding of the Eps8 family (23), but not known to serve as a docking site for Nck or other non-Eps8 SH3 domains. Previous studies on binding of Nck(I/III)-SH3 to CD3{epsilon} (5, 9, 25) did not map the critical CD3{epsilon} residues involved in this interaction, but implicated a PxxP sequence within a cluster of prolines in CD3{epsilon} (see Fig. 1). Although our results show that the additional proline residues adjacent to the PxxDY motif do contribute to Nck(I/III)-SH3 binding, the absolute requirement of the residues D165 and Y166 in addition to P162 clearly define the PxxDY sequence as the primary docking motif.

Considering the unexpected PxxDY specificity of Nck(I/III), it is of interest to note that Cesareni and colleagues (26) have proposed that a positively charged amino acid at position –2 relative to the first highly conserved tryptophan of the WW motif present in most SH3 domains would be important for PxxDY recognition by the Eps8-SH3 domain. Indeed, we noted that in addition to the four members of the Eps8 family, the N-terminal SH3 of Nck1 and Nck2 also have a lysine or an arginine residue in this position. Although this feature is shared by 17 additional SH3 domains among the 296 that we have identified from the human genome (see Ref. 12), all of these differ from Eps8/Nck(I/III) in that they contain a negatively charged amino acid neighboring this Lys/Arg residue or lack the conserved WW motif (data not shown). Thus, the SH3 sequence X(K,R)XWW (where X can be any amino acid except for E or D) appears to be correlated with PxxDY recognition. Future structural studies will be required to test the relevance and possibly explain the molecular basis of this correlation. However, because some proteins that were reported to bind to Nck(I/III)-SH3, such as SAM68 (27), do not contain a PxxDY motif, binding of Nck(I/III)-SH3 may not be exclusively restricted to ligands with a PxxDY motif.

An intriguing aspect of the PxxDY motif of CD3{epsilon} is that it overlaps with the ITAM of this TCR-CD3 complex subunit. Our data confirmed that phosphorylation of the tyrosine residue (Y166) shared by the ITAM and PxxDY motif of CD3{epsilon} is required for recruitment of the tandem SH2 cassette of Zap70, which is a crucial early event in T cell activation (2, 3). Conversely, we found that tyrosine phosphorylation of the PxxDY motif abolishes Nck-SH3 or Eps8-SH3 binding to CD3{epsilon}. Thus, phosphorylation of Y166 serves as molecular switch that determines whether CD3{epsilon} is competent for SH2 or SH3 binding. There are several examples in which serine or tyrosine phosphorylation of an SH3 domain or its ligand negatively regulates binding (28, 29, 30), but to our knowledge, this example is the first of reciprocal regulation of SH3 and SH2 binding via phosphorylation of a common binding site.

This mutually exclusive binding of SH2 and SH3 proteins to CD3{epsilon} has obvious implications for the currently unclear role of CD3{epsilon}-SH3 interactions in T cell development and function. Gil et al. (5) suggested that Nck binding to CD3{epsilon} immediately following TCR ligation would contribute to optimal signaling output by the TCR-CD3 complex. This conclusion has been criticized (31) because it was mainly based on ectopic overexpression of Nck(I/III)-SH3, which conceivably could interfere with many other later signaling events involved T cell activation. Also, it has been shown that at least the bulk of Nck recruitment to the TCR-CD3 complex does not occur in the absence of protein tyrosine kinase activity, and is instead mediated by binding of the Nck-SH2 domain to phosphorylated SLP-76 (32). In any case, assuming that early SH3 binding to CD3{epsilon} is required for maximal TCR signaling, our results argue that the interaction with Nck and/or Eps8 proteins would have to be transient and lost before Zap70 (or Syk) binding could take place. Such transient binding of Nck or Eps8 could help to recruit Lck or Fyn or otherwise facilitate phosphorylation of Y166 to create a docking site for Zap70. However, our results could also be explained by involvement of Nck or Eps8 binding to CD3{epsilon} in other aspects of TCR-CD3 function, which might take place only later after ITAM dephosphorylation, or in an alternative signaling pathway distinct from the canonical Lck/Zap70/LAT/SLP-76 cascade. In particular, if Eps8L1 or other members of this family turn out to be more relevant partners of CD3{epsilon} than Nck, the lessons learned from studies on Eps8 in regulation of epidermal growth factor receptor signaling, internalization, and trafficking (33) might provide a framework for future investigations into this question. Also, the recently revealed actin capping activity of Eps8 (34, 35) could hint to alternative roles for the Eps8L1-CD3{epsilon} interaction in regulation of T cell actin remodeling.

The transmembrane and ectodomains of CD3{epsilon} are required for proper assembly of the TCR-CD3 complex, and are therefore critical for normal T cell development and function (reviewed in Ref. 1). By contrast, the function of the intracellular signal-transducing domain of CD3{epsilon} appears to be highly redundant with signaling output of the three other CD3 subunits (CD3{delta}, CD3{gamma}, and CD3{zeta}) (reviewed in Ref. 2), which complicates studies of signaling interactions by any individual CD3 subunit. All CD3 subunits contain one or more ITAMs, whereas only CD3{epsilon} carries a hitherto known SH3 binding motif. Nevertheless, it is possible that the function provided to the TCR-CD3 complex via SH3 binding by CD3{epsilon} may also be redundant with protein interactions mediated by other CD3 subunits.

The exact dissociation constants of the Eps8-Nck(I/III)-SH3-CD3{epsilon} complexes remain to be determined, but our current data point to nanomolar KD values for the strongest ones of these interactions (see Fig. 2). This unusually tight SH3 binding together with the evolutionary conservation of the Eps8-Nck(I/III) target site in CD3{epsilon} (see below) would seem to argue for an important role for this interaction. Yet, in an apparent conflict with this idea, Szymczak et al. (9) recently reported that the defects in T cell development and function of CD3{epsilon}-deficient {epsilon}{Delta}P mice (36) could be rescued using a mutant CD3{epsilon} allele lacking the highly conserved proline residues, including the PxxDY-defining proline. However, considering that the region involved in Nck and Eps8 binding shows the highest degree of conservation among vertebrate CD3{epsilon} orthologs and is identical in amino acid sequence from flounder to man (data not shown), we believe that the results by Szymczak et al. (9) are better explained by functional redundancy within the mouse TCR-CD3 complex than by irrelevance of the Eps8 or Nck(I/III) binding site of CD3{epsilon}. Development of novel approaches, such as combined mutations in the intracellular signaling domains of different CD3 subunits to reduce this redundancy, are warranted to establish the role of SH3 binding by CD3{epsilon} in T cell biology, and to identify the relative importance of Nck and Eps8 family proteins as cellular partners of CD3{epsilon}.


    Acknowledgments
 
We thank Marika Vähä-Jaakkola, Marita Hiipakka, Satu Kärkkäinen, and Herma Renkema for assistance and advice at different phases of this project, Sampsa Matikainen for T cell cDNA samples, Aldo Borroto and Balbino Alarcón for technical advice and discussions, and Didier Trono for the pWPI vector.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the Academy of Finland, Medical Research Council of Tampere University Hospital, Medical Research Council of Helsinki University Hospital, and Sigrid Juselius Foundation (to K.S.), and from the Functional Genomics Program (FUGE), The Research Council of Norway, Norwegian Cancer Society, and Novo Nordic Foundation Committee (to K.T.). Back

2 Address correspondence and reprint requests to Dr. Kalle Saksela, Department of Virology, Haartman Institute, University of Helsinki, Haartmaninkatu 3, FIN-0014 Helsinki, Finland. E-mail address: kalle.saksela{at}helsinki.fi Back

3 Abbreviations used in this paper: SH, Src homology domain; TBP, TATA-box binding protein; HA, hemagglutinin. Back

Received for publication April 17, 2007. Accepted for publication May 1, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Call, M. E., K. W. Wucherpfennig. 2005. The T cell receptor: critical role of the membrane environment in receptor assembly and function. Annu. Rev. Immunol. 23: 101-125. [Medline]
  2. Pitcher, L. A., N. S. van Oers. 2003. T-cell receptor signal transmission: who gives an ITAM?. Trends Immunol. 24: 554-560. [Medline]
  3. Mustelin, T., K. Tasken. 2003. Positive and negative regulation of T-cell activation through kinases and phosphatases. Biochem J. 371: 15-27. [Medline]
  4. Jordan, M. S., A. L. Singer, G. A. Koretzky. 2003. Adaptors as central mediators of signal transduction in immune cells. Nat. Immunol. 4: 110-116. [Medline]
  5. Gil, D., W. W. Schamel, M. Montoya, F. Sánchez-Madrid, B. Alarcón. 2002. Recruitment of Nck by CD3{epsilon} reveals a ligand-induced conformational change essential for T cell receptor signaling and synapse formation. Cell 109: 901-912. [Medline]
  6. Gil, D., A. G. Schrum, B. Alarcón, E. Palmer. 2005. T cell receptor engagement by peptide-MHC ligands induces a conformational change in the CD3 complex of thymocytes. J. Exp. Med. 201: 517-522. [Abstract/Free Full Text]
  7. Risueño, R. M., D. Gil, E. Fernández, F. Sánchez-Madrid, B. Alarcón. 2005. Ligand-induced conformational change in the T-cell receptor associated with productive immune synapses. Blood 106: 601-608. [Abstract/Free Full Text]
  8. Risueño, R. M., H. M. van Santen, B. Alarcón. 2006. A conformational change senses the strength of T cell receptor-ligand interaction during thymic selection. Proc. Natl. Acad. Sci. USA 103: 9625-9630. [Abstract/Free Full Text]
  9. Szymczak, A. L., C. J. Workman, D. Gil, S. Dilioglou, K. M. Vignali, E. Palmer, D. A. Vignali. 2005. The CD3{epsilon} proline-rich sequence, and its interaction with Nck, is not required for T cell development and function. J. Immunol. 175: 270-275. [Abstract/Free Full Text]
  10. Mayer, B. J., K. Saksela. 2004. SH3 domains. G. Cesareni, and M. Gimona, and M. Sudol, and M. Yaffe, eds. Structure and Function of Modular Protein Domains 37-58. Wiley-VCH, Weinheim.
  11. Li, S. S.. 2005. Specificity and versatility of SH3 and other proline-recognition domains: structural basis and implications for cellular signal transduction. Biochem. J. 390: 641-653. [Medline]
  12. Kärkkäinen, S., M. Hiipakka, J. H. Wang, I. Kleino, M. Vähä-Jaakkola, G. H. Renkema, M. Liss, R. Wagner, K. Saksela. 2006. Identification of preferred protein interactions by phage-display of the human Src homology-3 proteome. EMBO Rep. 7: 186-191. [Medline]
  13. Mizushima, S., S. Nagata. 1990. pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res. 18: 5322[Free Full Text]
  14. Sambrook, J., D. W. Russell. 2001. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
  15. Frank, R.. 1992. Spot-synthesis: an easy technique for the positionally addressable, parallel chemical synthesis on a membrane support. Tetrahedron 48: 9217-9232.
  16. Cronan, J. E., Jr. 1990. Biotination of proteins in vivo: a post-translational modification to label, purify, and study proteins. J. Biol. Chem. 265: 10327-10333. [Abstract/Free Full Text]
  17. Zufferey, R., D. Nagy, R. J. Mandel, L. Naldini, D. Trono. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15: 871-875. [Medline]
  18. Rozen, S., H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132: 365-386. [Medline]
  19. Tocchetti, A., S. Confalonieri, G. Scita, P. P. Di Fiore, C. Betsholtz. 2003. In silico analysis of the EPS8 gene family: genomic organization, expression profile, and protein structure. Genomics 81: 234-244. [Medline]
  20. Tanaka, M., W. Lu, R. Gupta, B. J. Mayer. 1997. Expression of mutated Nck SH2/SH3 adaptor respecifies mesodermal cell fate in Xenopus laevis development. Proc. Natl. Acad. Sci. USA 94: 4493-4498. [Abstract/Free Full Text]
  21. Mallabiabarrena, A., M. A. Jiménez, M. Rico, B. Alarcón. 1995. A tyrosine-containing motif mediates ER retention of CD3-{epsilon} and adopts a helix-turn structure. EMBO J. 14: 2257-2268. [Medline]
  22. La Gruta, N. L., H. Liu, S. Dilioglou, M. Rhodes, D. L. Wiest, D. A. Vignali. 2004. Architectural changes in the TCR:CD3 complex induced by MHC:peptide ligation. J. Immunol. 172: 3662-3669. [Abstract/Free Full Text]
  23. Mongiovi, A. M., P. R. Romano, S. Panni, M. Mendoza, W. T. Wong, A. Musacchio, G. Cesareni, P. P. Di Fiore. 1999. A novel peptide-SH3 interaction. EMBO J. 18: 5300-5309. [Medline]
  24. Minguet, S., M. Swamy, B. Alarcón, I. F. Luescher, W. W. Schamel. 2007. Full activation of the T cell receptor requires both clustering and conformational changes at CD3. Immunity 26: 43-54. [Medline]
  25. Park, S., K. Takeuchi, G. Wagner. 2006. Solution structure of the first Src homology 3 domain of human Nck2. J. Biomol. NMR 34: 203-208. [Medline]
  26. Castagnoli, L., A. Costantini, C. Dall’Armi, S. Gonfloni, L. Montecchi-Palazzi, S. Panni, S. Paoluzi, E. Santonico, G. Cesareni. 2004. Selectivity and promiscuity in the interaction network mediated by protein recognition modules. FEBS Lett. 567: 74-79. [Medline]
  27. Lawe, D. C., C. Hahn, A. J. Wong. 1997. The Nck SH2/SH3 adaptor protein is present in the nucleus and associates with the nuclear protein SAM68. Oncogene 14: 223-231. [Medline]
  28. Duke-Cohan, J. S., H. Kang, H. Liu, C. E. Rudd. 2006. Regulation and function of SKAP-55 non-canonical motif binding to the SH3c domain of adhesion and degranulation-promoting adaptor protein. J. Biol. Chem. 281: 13743-13750. [Abstract/Free Full Text]
  29. Zhao, Z. S., E. Manser, L. Lim. 2000. Interaction between PAK and Nck: a template for Nck targets and role of PAK autophosphorylation. Mol. Cell Biol. 20: 3906-3917. [Abstract/Free Full Text]
  30. Park, H., M. I. Wahl, D. E. Afar, C. W. Turck, D. J. Rawlings, C. Tam, A. M. Scharenberg, J. P. Kinet, O. N. Witte. 1996. Regulation of Btk function by a major autophosphorylation site within the SH3 domain. Immunity 4: 515-525. [Medline]
  31. Levin, S. E., A. Weiss. 2005. Twisting tails exposed: the evidence for TCR conformational change. J. Exp. Med. 201: 489-492. [Abstract/Free Full Text]
  32. Barda-Saad, M., A. Braiman, R. Titerence, S. C. Bunnell, V. A. Barr, L. E. Samelson. 2005. Dynamic molecular interactions linking the T cell antigen receptor to the actin cytoskeleton. Nat. Immunol. 6: 80-89. [Medline]
  33. Lanzetti, L., V. Rybin, M. G. Malabarba, S. Christoforidis, G. Scita, M. Zerial, P. P. Di Fiore. 2000. The Eps8 protein coordinates EGF receptor signalling through Rac and trafficking through Rab5. Nature 408: 374-377. [Medline]
  34. Croce, A., G. Cassata, A. Disanza, M. C. Gagliani, C. Tacchetti, M. G. Malabarba, M. F. Carlier, G. Scita, R. Baumeister, P. P. Di Fiore. 2004. A novel actin barbed-end-capping activity in EPS-8 regulates apical morphogenesis in intestinal cells of Caenorhabditis elegans. Nat. Cell Biol. 6: 1173-1179. [Medline]
  35. Disanza, A., M. F. Carlier, T. E. Stradal, D. Didry, E. Frittoli, S. Confalonieri, A. Croce, J. Wehland, P. P. Di Fiore, G. Scita. 2004. Eps8 controls actin-based motility by capping the barbed ends of actin filaments. Nat. Cell Biol. 6: 1180-1188. [Medline]
  36. Wang, B., N. Wang, C. E. Whitehurst, J. She, J. Chen, C. Terhorst. 1999. T lymphocyte development in the absence of CD3{epsilon} or CD3{gamma}{delta}{epsilon}{zeta}. J. Immunol. 162: 88-94. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Int ImmunolHome page
J.-F. Brodeur, S. Li, O. Damlaj, and V. P. Dave
Expression of fully assembled TCR-CD3 complex on double positive thymocytes: synergistic role for the PRS and ER retention motifs in the intra-cytoplasmic tail of CD3{varepsilon}
Int. Immunol., October 9, 2009; (2009) dxp098v1.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-F. Brodeur, S. Li, M. d. S. Martins, L. Larose, and V. P. Dave
Critical and Multiple Roles for the CD3{epsilon} Intracytoplasmic Tail in Double Negative to Double Positive Thymocyte Differentiation
J. Immunol., April 15, 2009; 182(8): 4844 - 4853.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Tailor, S. Tsai, A. Shameli, P. Serra, J. Wang, S. Robbins, M. Nagata, A. L. Szymczak-Workman, D. A. A. Vignali, and P. Santamaria
The Proline-Rich Sequence of CD3{epsilon} as an Amplifier of Low-Avidity TCR Signaling
J. Immunol., July 1, 2008; 181(1): 243 - 255.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. S. Heikkinen, A. Kazlauskas, K. Melen, R. Wagner, T. Ziegler, I. Julkunen, and K. Saksela
Avian and 1918 Spanish Influenza A Virus NS1 Proteins Bind to Crk/CrkL Src Homology 3 Domains to Activate Host Cell Signaling
J. Biol. Chem., February 29, 2008; 283(9): 5719 - 5727.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kesti, T.
Right arrow Articles by Saksela, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kesti, T.
Right arrow Articles by Saksela, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS