The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1292 -1302
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Chen, Y.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Chen, Y.-F.
Right arrowPubmed/NCBI databases
*Substance via MeSH

Leptin-Induced IL-6 Production Is Mediated by Leptin Receptor, Insulin Receptor Substrate-1, Phosphatidylinositol 3-Kinase, Akt, NF-{kappa}B, and p300 Pathway in Microglia1

Chih-Hsin Tang2,*, Da-Yuu Lu2,{ddagger}, Rong-Sen Yang2,§, Huei-Yann Tsai*, Ming-Ching Kao{dagger}, Wen-Mei Fu3,{ddagger} and Yuh-Fung Chen3,*

* Department of Pharmacology, {dagger} Graduate Institute of Medical Science, College of Medicine, China Medical University, Taichung, Taiwan; and {ddagger} Department of Pharmacology and § Department of Orthopaedics, College of Medicine, National Taiwan University, Taipei, Taiwan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Leptin, the adipocyte-secreted hormone that centrally regulates weight control, is known to function as an immunomodulatory regulator. We investigated the signaling pathway involved in IL-6 production caused by leptin in microglia. Microglia expressed the long (OBRl) and short (OBRs) isoforms of the leptin receptor. Leptin caused concentration- and time-dependent increases in IL-6 production. Leptin-mediated IL-6 production was attenuated by OBRl receptor antisense oligonucleotide, PI3K inhibitor (Ly294002 and wortmannin), Akt inhibitor (1L-6-hydroxymethyl-chiro-inositol-2-((R)-2-O-methyl-3-O-octadecylcarbonate)), NF-{kappa}B inhibitor (pyrrolidine dithiocarbamate), I{kappa}B protease inhibitor (L-1-tosylamido-2-phenylenylethyl chloromethyl ketone), I{kappa}B{alpha} phosphorylation inhibitor (Bay 117082), or NF-{kappa}B inhibitor peptide. Transfection with insulin receptor substrate (IRS)-1 small-interference RNA or the dominant-negative mutant of p85 and Akt also inhibited the potentiating action of leptin. Stimulation of microglia with leptin activated I{kappa}B kinase {alpha}/I{kappa}B kinase beta, I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, p65 phosphorylation at Ser276, p65 and p50 translocation from the cytosol to the nucleus, and {kappa}B-luciferase activity. Leptin-mediated an increase of I{kappa}B kinase {alpha}/I{kappa}B kinase beta activity, {kappa}B-luciferase activity, and p65 and p50 binding to the NF-{kappa}B element was inhibited by wortmannin, Akt inhibitor, and IRS-1 small-interference RNA. The binding of p65 and p50 to the NF-{kappa}B elements, as well as the recruitment of p300 and the enhancement of histone H3 and H4 acetylation on the IL-6 promoter was enhanced by leptin. Our results suggest that leptin increased IL-6 production in microglia via the leptin receptor/IRS-1/PI3K/Akt/NF-{kappa}B and p300 signaling pathway.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Leptin, the 16-kDa protein encoded by the ob gene, is known to be an important regulator of energy balance through its actions in the brain on appetite and energy expenditure (1, 2). Leptin is mainly secreted by adipose tissue and released into circulation to act both in the peripherally and the brain. Leptin enters the brain via a saturable transport mechanism (3) and is believed to activate primarily on the hypothalamic centers. Leptin receptors (OBR)4 are found in many tissues in several alternatively spliced forms (4, 5). One form of the receptor, long form (OBRl), is highly expressed in the hypothalamus, and a short form (OBRs), is highly expressed in microvessels of the blood-brain barrier (4, 6). Upon binding to OBRl, leptin activates JAK2, which then initiates downstream signaling including members of the STAT family of transcription factors (7). The leptin receptor, through the activation of JAK2, is able to phosphorylate insulin receptor substrate (IRS) proteins and induce the IRS-PI3K signaling pathway (8, 9).

IL-6 is a multifunctional cytokine that plays a central role in both innate and acquired immune responses. IL-6 is the predominant mediator of the acute phase response, an innate immune mechanism which is triggered by infection and inflammation (10, 11). IL-6 also plays multiple roles during the subsequent development of acquired immunity against incoming pathogens, including regulation of the expressions of cytokine and chemokine, stimulation of Ab production by B cells, regulation of macrophage and dendritic cell differentiation, and the response of regulatory T cells to microbial infection (10, 11). In addition to these roles in pathogen-specific inflammation and immunity, IL-6 levels are elevated in chronic inflammatory conditions, such as rheumatoid arthritis (12, 13). Several consensus sequences, including those for NF-{kappa}B, CREB, NF-IL-6, and AP-1 in the 5' promoter region of the IL-6 gene, have been identified as regulatory sequences that induce IL-6 in response to various stimuli (14, 15). NF-{kappa}B, a key transcription factor that regulates IL-6 expression, is a dimer of either transcription factor p65 or transcription factor p50 (16). In a resting state, this dimer is associated with I{kappa}Bs to retain NF-{kappa}B in the cytosol (17). I{kappa}B kinase (IKK), which is activated through stimulation by cytokines and bacterial products, phosphorylates I{kappa}B{alpha} at Ser32 and Ser36 and I{kappa}Bbeta at Ser19 and Ser23 (18, 19), to produce ubiquitination of I{kappa}B{alpha}/I{kappa}Bbeta at lysine residues and degradation by the 26S proteasome (20). This process releases active NF-{kappa}B, which is then translocated from the cytosol to the nucleus, to bind specific DNA enhancer sequences and induce gene transcription (16). Regulation of I{kappa}B degradation and the subsequent release of NF-{kappa}B constitute a critical control point in the pathway. However, recent results suggest that an additional I{kappa}B-independent pathway is activated, which causes the enhanced transactivation potential of NF-{kappa}B once it is bound to its consensus sequence (21, 22). Activation of the pathway has been shown to result in increased phosphorylation of the p65 subunit of NF-{kappa}B and to promote interaction of p65 with the coactivator protein, p300/CREB-binding protein (23, 24).

Leptin is involved in host response to infection and inflammation. LPS administration, a well-characterized model of infection, induces severe decreases in food intake and body weight. Peripheral administration of LPS or cytokines such as IL-1beta or TNF-{alpha} has been shown to increase leptin mRNA expression in adipose tissue and serum leptin concentration in rodents (25, 26). Conversely, exogenous leptin has been shown to up-regulate both phagocytosis and the production of proinflammatory cytokines (TNF-{alpha}, IL-6, and IL-12) in macrophages (27). However, the effect of leptin on IL-6 production in microglia is mostly unknown. In the present study, we explored the intracellular signaling pathway involved in leptin-induced IL-6 production in BV-2 microglia cells. The results show that leptin activates leptin receptor and results in the activation of IRS-1, PI3K, Akt, NF-{kappa}B, and p300, leading to up-regulation of IL-6 expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Materials

Protein A/G beads, anti-mouse, and anti-rabbit IgG-conjugated HRP, rabbit polyclonal Abs specific for phosphotyrosine residues (PY20), p85, Akt, phospho-Akt (Ser473), IRS-1, IRS-2, IRS-3, IRS-4, OBR, I{kappa}B{alpha}, IKK{alpha}/IKKbeta, p65, p50 and p300, GST-I{kappa}B{alpha} fusion protein and COLO320DM cell lysate were purchased from Santa Cruz Biotechnology. Rabbit polyclonal Ab specific for acetylated-H3, acetylated-H4, and RNA polymerase II and small-interference RNA (siRNA) directed against IRS-1 were purchased from Upstate Biotechnology. Rabbit polyclonal Ab specific for IKK{alpha}/IKKbeta phosphorylated at Ser180/181 and p65 phosphorylated at Ser276 were purchased from Cell Signaling and Neuroscience. Rabbit polyclonal Abs specific for phosphor-STAT3 and STAT3 were purchased from New England Biolabs. The NF-{kappa}B inhibitor peptide (in a cell-permeable form) was purchased from BioMol. The IL-6 Enzyme Immunoassay kit was purchased from Cayman Chemical. [{gamma}-32P]ATP was purchased from Amersham Biosciences. The NF-{kappa}B luciferase plasmid was purchased from Stratagene. The p85 ({triangleup}p85; deletion of 35 aa from residues 479–513 of p85) and Akt (Akt K179A) dominant-negative mutants were gifts from Dr. R. H. Chen (Institute of Molecular Medicine, National Taiwan University, Taipei, Taiwan). The IKK{alpha}(KM) and IKKbeta(KM) mutants were gifts from Dr. H. Nakano (Juntendo University, Tokyo, Japan). The pSV-beta-galactosidase vector, luciferase assay kit was purchased from Promega. All other chemicals were obtained from Sigma-Aldrich.

Microglia culture

The murine BV-2 cell line was cultured in DMEM (Invitrogen Life Technologies) with 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in a humidified incubator under 5% CO2 and 95% air. Confluent cultures were passaged by trypsinization.

Primary microglia cells were prepared by the method as described previously (28). Rat primary microglia cells were isolated from the glial cultures that were prepared from neonatal rats. Glial cells were cultured in 75 cm2 flasks for 14 days in DMEM/F12 (Invitrogen Life Technologies) supplemented with 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin. To separate microglia, flasks were shaken for 2 h at 180 rpm in a rotary shaker at 37°C. Detached cells were then plated into 24-well plates at a density of 2 x 105 cells/well. The purity of microglia cultures was assessed using CD11b Ab and >90% of cells stained positively. Cells were cultured for 2 days before treatment.

Measurements of IL-6 production

BV-2 microglia cells were cultured in 24-well culture plates. After reaching confluence, cells were treated with various stimulators or pretreated with specific inhibitors as indicated, followed by leptin, and then incubated in a humidified incubator at 37°C for 24 h. After incubation, the medium was removed and stored at –80°C until assay. IL-6 in the medium was assayed using the IL-6 enzyme immunoassay kits, according to the procedure described by the manufacturer.

Quantification of OBR expression using flow cytometry

Microglia cells were plated in 6-well dishes. The cells were then washed with PBS and detached with trypsin at 37°C. Cells were fixed for 10 min in PBS containing 1% paraformaldehyde. After rinsing in PBS, the cells were incubated with rabbit anti-mouse OBR Ab (1:100) for 1 h at 4°C. Cells were then washed again, incubated with FITC-conjugated secondary IgG for 45 min, and analyzed by flow cytometry using FACSCalibur.

mRNA analysis by RT-PCR

Total RNA was extracted from microglia using a TRIzol kit (MDBio). The reverse transcription reaction was performed using 2 µg of total RNA that was reverse transcribed into cDNA using oligo(dT) primer, then amplified for 33 cycles using two oligonucleotide primers: IL-6 (614 bp): CAAGAGACTTCCATCCAGTTGC and TTGCCGAGTAGATCTCAAAGTGAC; OBRl (446 bp): ACACTGTTAATTTCACACCAGAG and TGGATAAACCCTTGCTCTTCA; OBRs (237 bp): ACACTGTTAATTTCACACCAGAG and AGTCATTCAAACCATAGTTTAGG; GAPDH (361 bp): AAGCCCATCACCATCTTCCAG and AGGGGCCATCCACAGTCTT CT (29, 30).

Each PCR cycle was conducted for 30 s at 94°C, 30 s at 55°C, and 1 min at 68°C. PCR products were then separated electrophoretically in a 2% agarose DNA gel and stained with ethidium bromide.

Western blot analysis

The cellular lysates were prepared as described previously (31). Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinyldifluoride membranes. The blots were blocked with 4% BSA for 1 h at room temperature and then probed with rabbit anti-mouse Abs against IRS-1, I{kappa}B{alpha}, IKK{alpha}beta, or p-Akt (1:1000) for 1 h at room temperature. After three washes, the blots were subsequently incubated with a donkey anti-rabbit peroxidase-conjugated secondary Ab (1:1000) for 1 h at room temperature. The blots were visualized by ECL using Kodak X-OMAT LS film (Eastman Kodak). Quantitative data were obtained using a computing densitometer and ImageQuant software (Molecular Dynamics).

Transfection and reporter gene assay

BV-2 microglia cells were cotransfected with 0.8 µg of {kappa}B-luciferase plasmid, 0.4 µg of beta-galactosidase expression vector. The cells were grown to 80% confluent in 6-well plates and were transfected on the following day by Lipofectamine 2000 (LF2000; Invitrogen Life Technologies). DNA and LF2000 were premixed for 20 min and then applied to the cells. DMEM containing 20% FCS was added 4 h later. After 24 h transfection, the cells were then incubated with the indicated agents. After further 24 h of incubation, the medium was removed and cells were washed once with cold PBS. To prepare lysates, 100 µl of reporter lysis buffer (Promega) was added to each well and cells were scraped from dishes. The supernatant was collected after centrifugation at 13,000 rpm for 2 min. Aliquots of cell lysates (20 µl) containing equal amounts of protein (20–30 µg) were placed into wells of an opaque black 96-well microplate. An equal volume of luciferase substrate was added to all samples and luminescence was measured in a microplate luminometer. The value of luciferase activity was normalized to transfection efficiency monitored by the cotransfected beta-galactosidase expression vector.

Preparation of nuclear extracts

The nuclear extracts were prepared as described previously (32). Cells were harvested and suspended in hypotonic buffer A (10 mM HEPES (pH 7.6), 10 mM KCl, 1 mM DTT, 0.1 mM EDTA, and 0.5 mM PMSF) for 10 min on ice and vortexed for 10 s. Nuclei were pelleted by centrifugation at 12,000 x g for 20 s. The supernatants containing cytosolic proteins were collected. A pellet containing nuclei was suspended in buffer C (20 mM HEPES, (pH 7.6), 1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 25% glycerol, and 0.4 M NaCl) for 30 min on ice. The supernatants containing nuclei proteins were collected by centrifugation at 12,000 x g for 20 min and stored at –70°C.

Protein kinase assay

The cellular lysates were prepared as described previously (32). Equal amounts of protein were incubated with specific Ab immobilized onto protein A/G-agarose beads for 12 h at 4°C with gentle rotation. The beads were washed three times with lysis buffer and two times with kinase buffer (20 mM HEPES (pH 7.4), 20 mM MgCl2, and 2 mM DTT). The kinase reactions were performed by incubating immunoprecipitated beads with 20 µl of kinase buffer (20 mM ATP and 3 µCi [{gamma}-32P]ATP) at 30°C for 30 min. To assess IKK{alpha}/IKKbeta activities, 0.5 µg of GST-I{kappa}B{alpha} protein was added as the substrate. The reaction mixtures were analyzed by SDS-PAGE followed by autoradiography.

Oligonucleotide (ODN) transfection

BV-2 microglia cells were cultured to confluence; the complete medium was replaced with OPTI-MEM containing the antisense phosphorothioate oligonucleotides (5 µg/ml) that had been preincubated with Lipofectamine 2000 (10 µg/ml) for 30 min. OPTI-MEM containing 20% FCS was added 4 h later. The cells were washed after 24 h of incubation at 37°C. All ODNs were synthesized and HPLC purified by MDBio. The sequences used are as follows: OBRl antisense ODN (AS-ODN), AGAAAGCGACGTTGTCAG and missense ODN (MM-ODN), CGCACGCAACATTTTAAG (GenBank accession no. U46135).

DNA affinity protein-binding assay (DAPA)

Binding of transcription factors to the IL-6 promoter DNA sequences was assayed, as described (15). Following treatment with leptin, nuclear extracts were prepared. Biotin-labeled double-stranded oligonucleotides (2 µg) synthesized based on the IL-6 promoter sequence, were mixed at room temperature for 1 h shaking with 200 µg of nuclear extract proteins, and 20 µl of streptavidin agarose beads in a 70% slurry. Beads were pelleted and washed three times with cold PBS, then the bound proteins were separated by SDS-PAGE, followed by Western blot analysis with specific Abs.

Chromatin immunoprecipitation (ChIP) assay

ChIP analysis was performed as described previously (32). DNA immunoprecipitated by anti-p65 or anti-p50 Ab was purified. The DNA was then extracted with phenol-chloroform. The purified DNA pellet was subjected to PCR. PCR products were then resolved by 1.5% agarose gel electrophoresis and visualized by UV. The primers: 5'-TGCTCAAGTGCTGAGTCACT-3' and 5'-AGACTCATGGGAAAATCCCA-3' were used to amplify across the mouse IL-6 promoter region (–287 to –54) (33).

Statistics

The values given are means ± SEM. The significance of difference between the experimental groups and control was assessed by Student’s t test. The difference is significant if the p value is <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Leptin induces IL-6 production in microglia

Murine BV-2 microglia was chosen to investigate the signal pathways of leptin in the production of IL-6, an inflammatory response gene. Treatment with leptin (30–3000 nM) for 24 h induced IL-6 production in a concentration-dependent manner (Fig. 1A); this induction occurred in a time-dependent manner (Fig. 1B). After leptin (1 µM) treatment for 24 h, the amount of IL-6 released had increased by ~931 ± 81% (Fig. 1B). To further confirm this stimulation-specific mediation by leptin without LPS contamination, polymyxin B, an LPS inhibitor, was used. We found that polymyxin B (1 µM) completely inhibited LPS (100 ng/ml)-induced IL-6 release. However, it had no effect on leptin (1 µM)-induced IL-6 release (Fig. 1C). Leptin (1 µM) also induced IL-6 production in rat primary cultured microglia cells (control: 73 ± 9 pg/ml; leptin: 558 ± 43 pg/ml, n = 4, p < 0.01).


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 1. Concentration- and time-dependent increase in IL-6 production by leptin. Microglia cells were incubated with various concentrations of leptin for 24 h (A) or with 1 µM leptin for 2, 4, 8, 12, 18, or 24 h (B). Media were collected to measure IL-6. Results are expressed as the mean ± SEM of four independent experiments performed in triplicate. *, p ≤ 0.05 as compared with basal level. C, Cells were pretreated with polymyxin B (poly B, 1 µM) for 30 min followed by stimulation with LPS (100 ng/ml) or leptin (1 µM) for 24 h. Media were collected to measure IL-6. Results are expressed as the mean ± SEM of four independent experiments performed in triplicate. *, p ≤ 0.05 as compared with basal level. #, p < 0.05 as compared with LPS alone-treated group.

 
Involvement of leptin receptor in leptin-mediated increase of IL-6 production

It has been reported that mouse primary cultured glial cells express OBRs (29). Western blot and flow cytometry analysis show that BV2 microglia cells also express OBRs (COLO320DM cell lysate (human colon cancer cell) was used as positive control (34)) (Fig. 2, A and B). Leptin exerts their effects through interaction with specific leptin receptors (OBRl and OBRs) (4). To investigate the role of leptin receptors in the leptin-mediated increase of IL-6 production, we assessed the distribution of these leptin receptors in BV-2 microglia cells by RT-PCR analysis. The mRNAs of OBRl and OBRs receptors could be detected in BV-2 microglia cells (Fig. 2C). After leptin treatment for 12 h, the mRNA levels of IL-6 and OBRl were significantly increased, whereas OBRs receptor mRNA remained unchanged (Fig. 2C). We next examined whether leptin receptors are involved in the leptin-mediated increase of IL-6 production. Transfection with OBR1 antisense oligonucleotide (AS-ODN) but not OBR1 missense (MM)-ODN specifically inhibited OBR1 expression and STAT-3 phosphorylation (Fig. 2, D and E). In addition, OBRl AS-ODN but not MM-ODN attenuated leptin-induced IL-6 production (Fig. 2F). These data suggest that leptin increases IL-6 release via the activation of OBRl receptor signaling.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 2. Involvement of leptin receptor in leptin-mediated IL-6 production in microglia. A, Total protein was isolated from BV-2 microglia cells and subjected to immunoblotting using specific Ab for OBR receptor; 30 µg of COLO320DM cell lysate (Santa Cruz Biotechnology) was used as positive control. B, Microglia cells were cultured for 2 days and the cell-surface expression of OBR was analyzed by flow cytometry. C, Total RNA was extracted from BV-2 microglia cells and subjected to RT-PCR for IL-6, OBRl, and OBRs mRNAs using the respective primers. Note that BV-2 microglia cells express IL-6, OBRl, and OBRs receptor mRNA. Both IL-6 and OBRl mRNA increased in response to leptin (1 µM) application for 12 h. D, BV-2 microglia cells were transfected with either OBR1 AS-ODN or OBR1 MM-ODN and the mRNA level of OBRl, OBRs, and GAPDH was analyzed by RT-PCR. E, Microglia cells were transfected with either OBR1 AS-ODN or OBR1 MM-ODN, and phosphor-STAT3 and STAT3 were analyzed by Western blot. F, Cells were transfected with OBR1 AS-ODN or OBR1 MM-ODN for 24 h, and then stimulated with leptin (1 µM) for 24 h. Media were collected to measure IL-6. Results are expressed as the mean ± SEM of four independent experiments performed in triplicate. *, p ≤ 0.05 as compared with no drug treatment control. #, p < 0.05 as compared with leptin-treated control group.

 
The signaling pathways of IRS-1, PI3K, and Akt are involved in the potentiating action of leptin stimulation

The OBR receptor, widely expressed in the human brain including regions not directly associated with energy homeostasis (4), mediates leptin action by signaling via JAK2 and phosphorylation of STAT3 or other pathways such as the IRS-1 and PI3K (9). Fig. 3A shows that leptin enhanced STAT-3 phosphorylation in a time-dependent manner. To examine whether IRS-1 activation is involved in the signal transduction pathway leading to IL-6 production by leptin, the IRS-1 siRNA was used. IRS-1 siRNA specifically inhibited the expression of IRS-1 but not IRS-2, -3, and -4 (Fig. 3B). Fig. 3C also shows that leptin-induced IL-6 production was inhibited by IRS-1 siRNA. It has been reported that leptin induces the activation of IRS-1 and IRS-2 (35). We then directly measured the phosphorylation of IRS-1 and IRS-2 in response to leptin application by the analysis of phosphotyrosine level of IRS-1 or IRS-2 immunoprecipitated with IRS-1 or IRS-2 Ab. Fig. 3, D and E, shows that treatment of microglia cells with leptin induced an increase of phosphorylation of IRS-1 but not IRS-2 in a time-dependent manner, beginning from 8 min after treatment. Therefore, IRS-1 is much more important in leptin-induced IL-6 release. We next examined whether leptin is able to activate PI3K, a critical downstream target of IRS-1 (8). Treatment of microglia with leptin 15–120 min increased the phosphorylation of p85 subunit of PI3K, as assessed by the measurement of phosphotyrosine from immunoprecipitated lysates using p85 (Fig. 4A). Akt phosphorylation in response to leptin was then measured. As shown in Fig. 4B, treatment of microglia with leptin resulted in a time-dependent phosphorylation of Akt. Furthermore, the leptin-induced increase in Akt phosphorylation was markedly inhibited by the pretreatment of cells for 30 min with PI3K inhibitor Ly294002 and wortmannin or Akt inhibitor (1L-6-hydroxymethyl-chiro-inositol-2-((R)-2-O-methyl-3-O-octadecylcarbonate)) or transfection with IRS-1 siRNA for 24 h (Fig. 4C). In addition, pretreatment of microglia for 30 min with Ly294002, wortmannin, or Akt inhibitor or transfection with p85 and Akt mutant for 24 h markedly attenuated the leptin-induced IL-6 production (Fig. 4, D and E). In addition, treatment of cells with Ly294002 (10 µM), wortmannin (30 nM), and Akt inhibitor (10 µM) did not affect cell viability, which was assessed by the MTT assay (data not shown). Taken together, these results indicate that the IRS-1/PI3K/Akt pathway is involved in leptin-induced IL-6 production.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 3. IRS-1 is involved in leptin-induced IL-6 production. A, BV-2 cells were incubated with leptin (1 µM) for indicated time intervals, and STAT3 phosphorylation was determined by immunoblotting using phospho-STAT3-specific Ab. B, Microglia cells were transfected with control of IRS-1 siRNA and protein levels of IRS-1, IRS-2, IRS-3 and IRS-4 were analyzed by Western blot. C, Cells were transfected with control or IRS-1 siRNA for 24 h and then stimulated with leptin (1 µM) for 24 h. Media were collected for the measurement of IL-6. D and E, Cells were incubated with leptin (1 µM) for indicated time intervals and cell lysates were immunoprecipitated (IP) with anti-IRS-1 or IRS-2 Ab. Immunoprecipitated proteins were separated by SDS-PAGE and immunoblotted (WB) with anti-phosphotyrosine (PY). Results are expressed as the mean ± SEM of four independent experiments performed in triplicate. *, p ≤ 0.05 as compared with no drug treatment control. #, p < 0.05 as compared with leptin-treated control group.

 

Figure 4
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 4. PI3K and Akt are involved in leptin-mediated IL-6 production in microglia. A, Cells were incubated with leptin (1 µM) for various time intervals and cell lysates were immunoprecipitated (IP) with anti-p85 Ab. Immunoprecipitated proteins were separated by SDS-PAGE and immunoblotted (WB) with anti-phosphotyrosine (PY). B and C, Microglia cells were incubated with leptin (1 µM) for indicated time intervals, or pretreated with Ly294002 (10 µM), wortmannin (WM; 30 nM), and Akt inhibitor (10 µM) for 30 min or transfected with IRS-1 siRNA for 24 h followed by stimulation with leptin for 120 min, and Akt phosphorylation was determined by immunoblotting using phospho-Akt specific Ab. D and E, Cells were pretreated for 30 min with Ly294002 (10 µM), wortmannin (30 nM), and Akt inhibitor (10 µM) or transfected with p85, Akt mutant or vector (control) for 24 h followed by stimulation with leptin for 24 h (D and E). Media were collected for the measurement of IL-6. Results are expressed as the mean ± SEM of four independent experiments performed in triplicate. *, p ≤ 0.05 as compared with no drug treatment control. #, p < 0.05 as compared with leptin-treated control group.

 
Involvement of NF-{kappa}B in leptin-induced IL-6 production

NF-{kappa}B activation has been reported to be necessary for IL-6 induction in macrophages (36). To examine whether NF-{kappa}B activation is involved in the signal transduction pathway leading to IL-6 expression caused by leptin, the NF-{kappa}B inhibitor pyrrolidine dithiocarbamate (PDTC) was used. Fig. 5A shows that PDTC (30 µM) inhibited the enhancement of IL-6 production induced by leptin. Furthermore, pretreatment of microglias with an I{kappa}B protease inhibitor (L-1-tosylamido-2-phenylenylethyl chloromethyl ketone (TPCK, 3 µM)), I{kappa}B{alpha} phosphorylation inhibitor (Bay 117082, 3 µM), and NF-{kappa}B inhibitor peptide (10 µg/ml) (37) also antagonized the potentiating action of IL-6 (Fig. 5A). In addition, treatment of cells with PDTC (30 µM), TPCK (3 µM), Bay 117082 (3 µM), and NF-{kappa}B inhibitor peptide (10 µg/ml) did not affect cell viability, which was assessed by the MTT assay (data not shown). It has been reported that the NF-{kappa}B-binding site between –72 and –63 is important for the activation of the IL-6 gene (14, 15). NF-{kappa}B activation was further evaluated by analyzing the translocation of NF-{kappa}B from cytosol to nucleus, as well as by DAPA and ChIP assay. Treatment of cells with leptin resulted in a marked translocation of p65 and p50 NF-{kappa}B from cytosol to nucleus (Fig. 5B). DAPA experiments showed a time-dependent increase in the binding of p65 and p50 to NF-{kappa}B element on the IL-6 promoter after leptin treatment (Fig. 5C). The in vivo recruitment of p65 and p50 to the IL-6 promoter (–287 to –54) was assessed by ChIP assay. In vivo binding of p65 and p50 to the NF-{kappa}B element of IL-6 promoter occurred as early as 15 min and sustained to 120 min after leptin stimulation (Fig. 5D). The binding of p65 and p50 to NF-{kappa}B element by leptin stimulation was attenuated by wortmannin, Akt inhibitor, and IRS-1 siRNA (Fig. 5E). To further confirm the NF-{kappa}B element involved in the action of leptin-induced IL-6 expression, transient transfection was performed using the {kappa}B promoter-luciferase constructs. Microglias incubated with leptin (1 µM) led to a 3.1-fold increase in {kappa}B promoter activity. The increase of {kappa}B activity by leptin was antagonized by Ly294002, wortmannin, and Akt inhibitor (Fig. 5F). These results suggest that NF-{kappa}B activation is necessary for leptin-induced IL-6 production in microglia.


Figure 5
View larger version (61K):
[in this window]
[in a new window]

 
FIGURE 5. NF-{kappa}B is involved in the potentiation of IL-6 production by leptin. A, Cells were pretreated for 30 min with PDTC (60 µM), TPCK (3 µM), Bay 117082 (3 µM), and NF-{kappa}B inhibitor peptide (10 µg/ml) followed by stimulation with leptin for 24 h. Media were collected for the measurement of IL-6. B, Cells were treated with leptin (1 µM) for indicated time intervals, and the levels of cytosolic and nuclear p65 or p50 were determined by immunoblotting with p65- or p50-specific Abs, respectively. C, The upper schematic illustration represents the consensus sequences of NF-{kappa}B site on the IL-6 promoter labeled with biotin. Cells were treated with leptin (1 µM) for indicated time intervals and nuclear extracts were prepared and incubated with biotinylated NF-{kappa}B probe. The complexes were precipitated by streptavidin-agarose beads as described in Materials and Methods and p65 or p50 in the complexes was detected by Western blot. The equal amount of input nuclear protein was examined by the PCNA protein level. D and E, Cells were treated with leptin (1 µM) for the indicated time intervals, or pretreated with wortmannin (30 nM) and Akt inhibitor (10 µM) or transfected with control or IRS-1 siRNA for 24 h followed by stimulation with leptin for 120 min, and ChIP assay was then performed. Chromatin was immunoprecipitated with anti-p65 or anti-p50 Ab. One percent of the precipitated chromatin was assayed to verify equal loading (Input). F, Cells were transfected with {kappa}B-luciferase expression vector and then pretreated with Ly294002 (10 µM), wortmannin (30 nM), or Akt inhibitor (10 µM) for 30 min before incubation with leptin (1 µM) for 24 h. Luciferase activity was then assayed. Results are expressed as the mean ± SEM (n = 4). *, p ≤ 0.05 as compared with no drug treatment control. #, p < 0.05 as compared with leptin-treated control group.

 
Leptin causes an increase in IKK{alpha}/IKKbeta phosphorylation, I{kappa}B{alpha} phosphorylation, and I{kappa}B{alpha} degradation

We further examined the upstream molecules involved in leptin-induced NF-{kappa}B activation. Stimulation of cells with leptin induced IKK{alpha}/IKKbeta phosphorylation and activity in a time-dependent manner (Fig. 6, A and C). Pretreatment of cells with wortmannin or Akt inhibitor or transfection with IRS-1 siRNA attenuated leptin-induced IKK{alpha}/IKKbeta phosphorylation and activity (Fig. 6, B and D). Furthermore, transfection with IKK{alpha} or IKKbeta mutant markedly inhibited the leptin-induced IL-6 production (Fig. 6E). These data suggest that IKK{alpha}/IKKbeta activation is involved in leptin-induced IL-6 production in microglia. Treatment of microglia with leptin also caused I{kappa}B{alpha} phosphorylation and I{kappa}B{alpha} degradation in a time-dependent manner (Fig. 6F). We further examined p65 phosphorylation at Ser276 by leptin in microglia. Treatment of cells with leptin induced p65 phosphorylation at Ser276 in a time-dependent manner (Fig. 6G).


Figure 6
View larger version (48K):
[in this window]
[in a new window]

 
FIGURE 6. Leptin induces IKK{alpha}/IKKbeta activation, I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, and p65 Ser276 phosphorylation in microglia. A and B, Microglia cells were incubated with leptin (1 µM) for indicated time intervals, or pretreated with wortmannin (WM; 30 nM) and Akt inhibitor (10 µM) for 30 min or transfected with IRS-1 siRNA for 24 h followed by stimulation with leptin for 120 min, and IKK{alpha}/IKKbeta phosphorylation was determined by immunoblotting using phospho-IKK{alpha}/IKKbeta-specific Ab. C and D, Microglia cells were incubated with leptin (1 µM) for indicated time intervals, or pretreated with wortmannin (WM; 30 nM) and Akt inhibitor (10 µM) for 30 min or transfected with IRS-1 siRNA for 24 h followed by stimulation with leptin for 120 min, and cell lysates were then immunoprecipitated with Ab specific for IKK{alpha}/IKKbeta. One set of immunoprecipitates was subjected to the kinase assay (KA) as described in Materials and Methods using the GST-I{kappa}B{alpha} fusion protein as a substrate (upper panel). The other set of immunoprecipitates was subjected to 10% SDS-PAGE and analyzed by immunoblotting (WB) with the anti-IKK{alpha}/IKKbeta Ab (lower panel). Equal amounts of the immunoprecipitated kinase complex present in each kinase assay were confirmed by immunoblotting for IKK{alpha}/IKKbeta. E, Cells were transfected with IKK{alpha}, IKKbeta mutant, or empty vector for 24 h followed by stimulation with leptin for 24 h. Media were collected for the measurement of IL-6. Results are expressed as the mean ± SEM of four independent experiments performed in triplicate. *, p ≤ 0.05 as compared with no drug treatment control. #, p < 0.05 as compared with leptin-treated control group. F and G, Microglia cells were incubated with leptin (1 µM) for indicated time intervals and cytosolic levels of I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, and p65 Ser276 phosphorylation were determined by immunoblotting using phospho-I{kappa}B{alpha}, I{kappa}B{alpha}-specific, and p65 phosphorylated at Ser276 Abs, respectively.

 
Leptin increases the recruitment of p300 with NF-{kappa}B in microglia

NF-{kappa}B transcriptional competence requires interaction with the transcription coactivator p300 (38). Chromatin was immunoprecipitated with anti-p300 Ab, which contained the essential binding sites for transcriptional activators and was amplified by PCR. As shown in Fig. 7A, in vivo binding of p300 to the IL-6 promoter was increased after treatment with leptin in a time-dependent manner. To examine whether p65 interacts with p300 in vivo, reciprocal immunoprecipitation of nuclear lysates, followed by immunoblot analysis using anti-p65 or anti-p300 Ab, was performed. As shown in Fig. 7B, p300 formed a tight complex with p65 after leptin stimulation. It has been shown that p300, after recruitment to target gene promoters, can acetylate lysine residues within the core histone tails to facilitate the binding of nuclear factors to chromatin by destabilizing the promoter-bound nucleosomes; it then complexes with RNA polymerase II holoenzyme to form enhanceosome, initiating gene transcription (39). As shown in Fig. 7, C and D, the acetylation of histones H3 and H4 and the assembly of RNA polymerase II on the IL-6 promoter were increased in response to leptin, and these effects were attenuated by wortmannin, Akt inhibitor, and IRS-1 siRNA. These results imply that p65 modulates the promoter recruitment of p300, as well as its histone acetyltransferase activity, leading to the acetylation of core histones and association with basal transcriptional machinery to form enhanceosome.


Figure 7
View larger version (59K):
[in this window]
[in a new window]

 
FIGURE 7. Leptin increases the recruitment of p300 with NF-{kappa}B in microglia. A, Cells were treated with leptin (1 µM) for the indicated time intervals, and ChIP assay was then performed. Chromatin was immunoprecipitated with anti-p300 Ab. One percent of the precipitated chromatin was assayed to verify equal loading (Input). B, Cells were treated with leptin (1 µM) for the indicated time intervals. Equal amounts (1 mg) of nuclear extracts were immunoprecipitated (IP) with anti-p65 or anti-p300 then separated by SDS-PAGE on a 7.5% gel and immunoblotted with anti-p65 or anti-p300 Ab as indicated. C and D, Cells were treated with leptin (1 µM) for the indicated time intervals, or pretreated with wortmannin (30 nM) and Akt inhibitor (10 µM) or transfected with IRS-1 siRNA for 24 h followed by stimulation with leptin for 120 min, and ChIP assay was then performed. Chromatin was immunoprecipitated with anti-p300, anti-acetylated histone H3, anti-acetylated histone H4, or anti-RNA polymerase II Ab. One percent of the precipitated chromatin was assayed to verify equal loading (Input).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Leptin, an adipocyte-derived hormone, is implicated in the regulation of feeding behavior. Leptin levels correlate with adiposity, decreasing acutely with caloric restriction and increasing with refeeding. The brain is an established critical site for leptin function. There is a strong association between plasma leptin and cerebrospinal fluid dopamine levels (40). Brunetti et al. (41) noted that leptin does not modify basal ganglia but does inhibit depolarization-induced norepinephrine and dopamine release from perfused hypothalamic neuronal endings. Leptin concentration affects some pathophysiological functions including immunity, obesity, and diabetes (42). Obesity is associated with an increased risk of diabetes, heart disease, orthopedic problems, and other chronic disease (43). Overweight and obese children and adults have elevated serum levels of C-reactive protein, TNF-{alpha}, and leptin, which are known markers of inflammation and closely associated with atherosclerosis, hyperlipidemia, and insulin resistance (42). It has been reported that administration of LPS to animals up-regulates leptin gene expression and serum protein levels (44). Leptin-deficient mice that possess a defective leptin receptor exhibited attenuated levels of TNF-{alpha} and IL-6 in response to LPS (45). In the present study, we found that leptin increased IL-6 production in primary cultured microglia cells and BV-2 cell line. Leptin is synthesized and released into circulation from peripheral adipose tissue and circulating leptin is able to enter the brain by a saturable transport mechanism (3). These reports suggest that leptin can act directly in the brain. Our findings indicate that leptin induces IL-6 release in microglia cells, which may play an important role during obesity and associate with brain inflammation.

The leptin receptor belongs to the cytokine receptor superfamily (6). It has been reported that glial cells (mixed astrocyte and microglia) express OBRl and OBRs leptin receptors using RT-PCR analysis (29). Using Western blot and flow cytometry analysis we show that BV-2 microglia cells express OBR receptor. However, the expression of the leptin receptor isoform in microglia is mostly unknown. In this study, we found that BV-2 microglia cells express both OBR1 and OBRs leptin receptor isoforms by RT-PCR analysis. In addition, leptin increases the expression of OBRl and IL-6 but not OBRs. Furthermore, transfection with OBRl AS-ODN but not MM-ODN antagonized the leptin-induced IL-6 production. These results suggest that OBRl is an upstream receptor in leptin-induced IL-6 release.

Upon leptin binding, the OBR1 activates JAK2, which in turn phosphorylates tyrosine residues in the receptor tails, leading to the recruitment and activation of STAT-3 (7). The leptin receptor, through the activation of JAK2, is also able to phosphorylate IRS proteins and stimulate the IRS-PI3K signaling pathway (8, 9). Here, we used the IRS-1 siRNA to determine the role of IRS-1 and found that it inhibited leptin-induced IL-6 production, indicating the possible involvement of IRS-1 in leptin-induced IL-6 release in microglia. It has been reported that leptin increases the association of tyrosine-phosphorylated IRS-1 with p85, the regulatory subunit of PI3K, via its Src homology 2 domains (46). Pretreatment of microglia with PI3K inhibitor Ly294002 and wortmannin antagonized the increase of IL-6 expression by leptin. This was further confirmed by the result that the dominant-negative mutant of p85 inhibited the enhancement of IL-6 production by leptin. PI3K activation leads to phosphorylation of phosphatidyl inositides and then activates the downstream main target, Akt, which is important in regulating cell growth, differentiation, adhesion, and inflammatory reactions (47). In this study, we demonstrate that the leptin-induced expression of IL-6 was inhibited by 1L-6-hydroxymethyl-chiro-inositol2-((R)-2-O-methyl-3-O-octadecylcarbonate) (an Akt inhibitor). Furthermore, the leptin-induced increase in IL-6 production was also blocked by a dominant-negative Akt mutant. The cytoplasmic serine kinase Akt was found to be activated by leptin in microglia cells. These effects were inhibited by Ly294002, wortmannin or IRS-1 siRNA, indicating the involvement of IRS-1/PI3K-dependent Akt activation in leptin-mediated induction of IL-6.

There are several binding sites for a number of transcription factors including NF-{kappa}B, CREB, NF-IL-6, and AP-1 box in the 5' region of the IL-6 gene (14, 15). Recent studies on the IL-6 promoter have demonstrated that IL-6 induction by several transcription factors occurs in a highly stimulus-specific or cell-specific manner. For example, NF-{kappa}B has been shown to control the induced transcription of IL-6 in mouse macrophages (36). In osteoblasts, vasoactive intestinal peptide-induced IL-6 expression is mediated by AP-1 and CREB (48). The results of this study show that NF-{kappa}B activation contributes to leptin-induced IL-6 production in microglia, and that the inhibitors of the NF-{kappa}B-dependent signaling pathway, including PDTC, TPCK, Bay 117082, or NF-{kappa}B inhibitor peptide antagonized leptin-induced IL-6 expression. In an inactivated state, NF-{kappa}B is normally held in the cytoplasm by the inhibitor protein I{kappa}B. Upon stimulation, such as by TNF-{alpha}, I{kappa}B proteins become phosphorylated by the multisubunit IKK complex, which subsequently targets I{kappa}B for ubiquitination, and then are degraded by the 26S proteasome. Finally, the free NF-{kappa}B translocates to the nucleus, where it activates the responsive gene (39). Here, we found that treatment of BV-2 microglia cells with leptin resulted in an increase in IKK{alpha}/IKKbeta phosphorylation and activity, p65 and p50 translocation from the cytosol to the nucleus, and the binding of p65 and p50 to NF-{kappa}B element on the IL-6 promoter. Using transient transfection with {kappa}B-luciferase as an indicator of NF-{kappa}B activity, we also found that leptin increased NF-{kappa}B activity. A previous report also shows that NF-{kappa}B activation is mediated via the IRS-1/PI3K/Akt signaling pathway in lung epithelial cells (49). In addition, Romashkova and Makarov (50) also demonstrated that platelet-derived growth factor may induce NF-{kappa}B activation via the PI3K/Akt/IKK pathway in human skin fibroblasts. We also found that leptin-induced IKK{alpha}/IKKbeta phosphorylation and activity was inhibited by wortmannin, Akt inhibitor, or IRS-1 siRNA. Furthermore, the leptin-mediated increase in {kappa}B-luciferase activity was also inhibited by wortmannin, Ly294002, and Akt inhibitor. These results indicate that leptin may act through the pathways of IRS-1 and PI3K/Akt to induce IKK{alpha}/IKKbeta and NF-{kappa}B activation in microglia.

Maximal NF-{kappa}B transcriptional activity requires interaction with other components of transcriptional machinery, such as p300/CREB-binding protein (38). Phosphorylation of p65 at Ser276 is critical for its interaction with p300 (23), and mutation at Ser276 completely abolished the recruitment of p300. Here, we found that leptin induces p65 phosphorylation at Ser276 in BV-2 microglia cells. The interaction between p65 and p300 was critical for the induction of IL-6 gene expression. We revealed that leptin enhanced recruitment of p300 to the IL-6 promoter containing the NF-{kappa}B site. The acetylations of histone H3 and H4 on the IL-6 promoter were increased as well. Therefore, p300-dependent acetylation of histones and recruitment of basal transcription machinery may be involved in the leptin-induced IL-6 gene transcription. It has been reported that acetylation of histone H3 and H4 is a prerequisite for TNF-{alpha} production in monocytes and macrophages (51), and acetylation of histone H4-mediated oxidative stress-regulated proinflammatory gene, such as IL-8 expression in human pulmonary epithelial cells (52). The recruitment of transcriptional coactivators accompanied with histone acetylation may be also necessary for the IL-6 gene expression. Here, we also found that treatment with leptin for 24 h caused TNF-{alpha} and IL-1beta release in BV2 microglia from 98 ± 16 to 215 ± 35 pg/ml (n = 4, p < 0.05) and 415 ± 48 to 637 ± 62 pg/ml (n = 4, p < 0.05), respectively. Whether the similar signaling pathways are involved needs further investigation.

In conclusion, the signaling pathway involved in leptin-induced IL-6 expression in BV-2 microglia cells has been explored. Leptin increases IL-6 expression by binding to the leptin receptor (OBRl) and activation of IRS-1, PI3K, Akt, which enhances binding of p65 and p50 to the NF-{kappa}B site. This coordinated with the recruitment of p300 and enhanced the acetylation of histone H3 and H4, resulting in the transactivation of IL-6 production (Fig. 8).


Figure 8
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 8. Schematic diagram of the signaling pathways involved in leptin-induced IL-6 production in microglia. Leptin increases IL-6 expression by binding to the leptin receptor (OBRl) and activation of IRS-1, PI3K, Akt, which then enhances binding of p65 and p50 to the NF-{kappa}B site. This coordinates with the recruitment of p300 and enhances the acetylation of histone H3 and H4, resulting in the transactivation of IL-6 expression.

 

    Acknowledgments
 
We thank Dr. R. H. Chen for providing p85 and Akt mutants and Dr. H. Hakano for providing IKK{alpha} and IKKbeta mutants.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the National Science Council of Taiwan (NSC 95-2314-B-039-045) and China Medical University (CMU 95-208). Back

2 C.-H.T., D.-Y.L., and R.-S.Y. contributed equally to this study. Back

3 Address correspondence and reprint requests to Dr. Chen Yuh-Fung, Department of Pharmacology, College of Medicine, China Medical University, No. 91, Hsueh-Shih Road, Taichung, Taiwan; E-mail address: yfchen{at}mail.cmu.edu.tw or Dr. Fu Wen-Mei, Department of Pharmacology, College of Medicine, National Taiwan University, Taipei, Taiwan; E-mail address: wenmei{at}ntu.edu.tw Back

4 Abbreviations used in this paper: OBR, lectin receptor; IRS-1, insulin receptor substrate-1; IKK, I{kappa}B kinase; siRNA, small-interference RNA; ODN, oligonucleotide; DAPA, DNA affinity protein-binding assay; ChIP, chromatin immunoprecipitation; AS, antisense; MM, missense; PDTC, pyrrolidine dithiocarbamate; TPCK, L-1-tosylamido-2-phenylenylethyl chloromethyl ketone. Back

Received for publication January 11, 2007. Accepted for publication May 13, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Campfield, L. A., F. J. Smith, Y. Guisez, R. Devos, P. Burn. 1995. Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269: 546-549. [Abstract/Free Full Text]
  2. Pelleymounter, M. A., M. J. Cullen, M. B. Baker, R. Hecht, D. Winters, T. Boone, F. Collins. 1995. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269: 540-543. [Abstract/Free Full Text]
  3. Banks, W. A., A. J. Kastin, W. Huang, J. B. Jaspan, L. M. Maness. 1996. Leptin enters the brain by a saturable system independent of insulin. Peptides 17: 305-311. [Medline]
  4. Tartaglia, L. A., M. Dembski, X. Weng, N. Deng, J. Culpepper, R. Devos, G. J. Richards, L. A. Campfield, F. T. Clark, J. Deeds, et al 1995. Identification and expression cloning of a leptin receptor, OB-R. Cell 83: 1263-1271. [Medline]
  5. Fei, H., H. J. Okano, C. Li, G. H. Lee, C. Zhao, R. Darnell, J. M. Friedman. 1997. Anatomic localization of alternatively spliced leptin receptors (Ob-R) in mouse brain and other tissues. Proc. Natl. Acad. Sci. USA 94: 7001-7005. [Abstract/Free Full Text]
  6. Bjorbaeck, C., J. K. Elmquist, P. Michel, R. S. Ahima, A. Vanbveren, A. L. McCall, J. S. Flier. 1998. Expression of leptin receptor isoforms in rat brain microvessels. Endocrinology 139: 3485-3491. [Abstract/Free Full Text]
  7. Kloek, C., A. K. Haq, S. L. Dunn. 2002. Regulation of JAK kinases by intracellular leptin receptor sequences. J. Biol. Chem. 277: 41547-41555. [Abstract/Free Full Text]
  8. Niswender, K. D., G. J. Morton, W. H. Steams. 2001. Intracellular signaling key enzyme in leptin-induced anorexia. Nature 413: 794-795. [Medline]
  9. Szanto, I., C. R. Khan. 2000. Selective interaction between leptin and insulin signaling pathways in a hepatic cell line. Proc. Natl. Acad. Sci. USA 97: 2355-2360. [Abstract/Free Full Text]
  10. Graeve, L., M. Baumann, P. C. Heinrich. 1993. Interleukin-6 in autoimmune disease: role of IL-6 in physiology and pathology of the immune defense. Clin. Invest. 71: 664-671. [Medline]
  11. Grimble, R. F.. 1998. Nutritional modulation of cytokine biology. Nutrition 14: 634-640. [Medline]
  12. Jones, S. A.. 2005. Directing transition from innate to acquired immunity: defining a role for IL-6. J. Immunol. 175: 3463-3468. [Abstract/Free Full Text]
  13. Yokota, K., T. Miyazaki, M. Hirano, Y. Akiyama, T. Mimura. 2006. Simvastatin inhibits production of interleukin 6 (IL-6) and IL-8 and cell proliferation induced by tumor necrosis factor-{alpha} in fibroblast-like synoviocytes from patients with rheumatoid arthritis. J. Rheumatol. 33: 463-471. [Abstract/Free Full Text]
  14. Grassl, C., B. Luckow, D. Schlondorff, U. Dendorfer. 1999. Transcriptional regulation of the interleukin-6 gene in mesangial cells. J. Am. Soc. Nephrol. 10: 1466-1477. [Abstract/Free Full Text]
  15. Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto, S. Akira. 1993. Transcription factors NF-IL6 and NF-{kappa}B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90: 10193-10197. [Abstract/Free Full Text]
  16. Baldwin, A. S.. 1996. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14: 649-683. [Medline]
  17. Thompson, J. E., R. J. Phillips, H. Erdjument-Bromage, P. Tempst, S. Ghosh. 1995. I{kappa}B-{alpha} regulates the persistent response in a biphasic activation of NF-{kappa}B. Cell 80: 573-582. [Medline]
  18. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, M. Karin. 1997. A cytokine-responsive I{kappa}B kinase that activates the transcription factor NF-{kappa}B. Nature 388: 548-554. [Medline]
  19. Maniatis, T.. 1997. Catalysis by a multiprotein I{kappa}B kinase complex. Science 278: 818-819. [Free Full Text]
  20. Chen, Z., J. Hagler, V. J. Palombella, F. Melandri, D. Scherer, D. Ballard, T. Maniatis. 1995. Signal-induced site-specific phosphorylation targets I{kappa}B{alpha} to the ubiquitin-proteasome pathway. Genes Dev. 9: 1586-1597. [Abstract/Free Full Text]
  21. Vanden, B., W. S. Plaisance, E. Boone, K. D. Bosscher, M. L. Schmitz, W. Fiers, G. Haegeman. 1998. p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways are required for nuclear factor-{kappa}B p65 transactivation mediated by tumor necrosis factor. J. Biol. Chem. 273: 3285-3290. [Abstract/Free Full Text]
  22. Bergmann, M., L. Hart, M. Lindsay, P. J. Barnes, R. Newton. 1998. I{kappa}B{alpha} degradation and nuclear factor-{kappa}B DNA binding are insufficient for interleukin-1beta and tumor necrosis factor-{alpha}-induced {kappa}B-dependent transcription: requirement for an additional activation pathway. J. Biol. Chem. 273: 6607-6610. [Abstract/Free Full Text]
  23. Zhong, H., M. J. May, E. Jimi, S. Ghosh. 2002. The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol. Cell 9: 625-636. [Medline]
  24. Wang, D., A. S. Baldwin. 1998. Activation of nuclear factor-{kappa}B-dependent transcription by tumor necrosis factor-{alpha} is mediated through phosphorylation of RelA/p65 on serine 529. J. Biol. Chem. 273: 29411-29416. [Abstract/Free Full Text]
  25. Grunfeld, C., C. Zhao, J. Fuller, A. Pollack, A. Moser, J. Friedman, K. R. Feingold. 1996. Endotoxin and cytokines induce expression of leptin, the ob gene product, in hamsters. J. Clin. Invest. 97: 2152-2157. [Medline]
  26. Sarraf, P., R. C. Frederich, E. M. Turner, G. Ma, N. T. Jaskowiak, D. J. Rivet, J. S. Flier, B. B. Lowell, D. L. Fraker, H. R. Alexander. 1997. Multiple cytokines and acute inflammation raise mouse leptin levels: potential role in inflammatory anorexia. J. Exp. Med. 185: 171-175. [Abstract/Free Full Text]
  27. Loffreda, S., S. Q. Yang, H. Z. Lin, C. L. Karp, M. L. Brengman, D. J. Wang, A. S. Klein, G. B. Bulkley, C. Bao, P. W. Noble, et al 1998. Leptin regulates proinflammatory immune responses. FASEB J. 12: 57-65. [Abstract/Free Full Text]
  28. Lu, D. Y., H. C. Liou, C. H. Tang, W. M. Fu. 2006. Hypoxia-induced iNOS expression in microglia is regulated by the PI3-kinase/Akt/mTOR signaling pathway and activation of hypoxia inducible factor-1{alpha}. Biochem. Pharmacol. 72: 992-1000. [Medline]
  29. Hosoi, T., Y. Okuma, Y. Nomura. 2000. Expression of leptin receptors and induction of IL-1beta transcript in glial cells. Biochem. Biophys. Res. Commun. 273: 312-315. [Medline]
  30. Obara, Y., H. Kurose, N. Nakahata. 2005. Thromboxane A2 promotes interleukin-6 biosynthesis mediated by an activation of cyclic AMP-response element-binding protein in 1321N1 human astrocytoma cells. Mol. Pharmacol. 68: 670-679. [Abstract/Free Full Text]
  31. Tang, C. H., R. S. Yang, W. M. Fu. 2005. Prostaglandin E2 stimulates fibronectin expression through EP1 receptor, phospholipase C, protein kinase C{alpha}, and c-Src pathway in primary cultured rat osteoblasts. J. Biol. Chem. 280: 22907-22916. [Abstract/Free Full Text]
  32. Tang, C. H., R. S. Yang, Y. F. Chen, W. M. Fu. 2007. Fibronectin expression through phospholipase C ({gamma}), protein kinase C ({alpha}), c-Src, NF-{kappa}B and p300 pathway in osteoblasts. J. Cell. Physiol. 221: 45-55.
  33. Gilchrist, M., V. Thorsson, B. Li, A. G. Rust, M. Korb, K. Kennedy, T. Hai, H. Bolouri, A. Aderem. 2006. Systems biology approaches identify ATF2 as a negative regulator of Toll-like receptor 4. Nature 441: 173-178. [Medline]
  34. Saxena, N. K., P. M. Vertino, F. A. Anaia, D. Sharma. 2007. Leptin-induced growth stimulation of breast cancer cells involves recruitment of histone acetyltransferases and mediator complex to cyclin D1 promoter via activation of Stat3. J. Biol. Chem. 282: 13316-13325. [Abstract/Free Full Text]
  35. Kim, Y. B., S. Uotani, D. D. Pierroz, J. S. Flier, B. B. Kahn. 2000. In vivo administration of leptin activates signal transduction directly in insulin-sensitive tissues: overlapping but distinct pathways from insulin. Endocrinology 141: 2328-2339. [Abstract/Free Full Text]
  36. Chen, B. C., C. C. Liao, M. J. Hsu, Y. T. Liao, C. C. Lin, J. R. Sheu, C. H. Lin. 2006. Peptidoglycan-induced IL-6 production in RAW 265.7 macrophages is mediated by cyclooxygenase-2, PGE2/PGE4 receptors, protein kinaseA, I{kappa}B kinase and NF-{kappa}B. J. Immunol. 177: 681-693. [Abstract/Free Full Text]
  37. Lin, C. H., H. W. Cheng, M. J. Hsu, M. C. Chen, C. C. Lin, B. C. Chen. 2006. c-Src mediates thrombin-induced NF-{kappa}B activation and IL-8/CXCL8 expression in lung epithelial cells. J. Immunol. 177: 3427-3438. [Abstract/Free Full Text]
  38. Gerritsen, M. E., A. J. Williams, A. S. Neish, S. Moore, Y. Shi, T. Collins. 1997. CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA 94: 2927-2932. [Abstract/Free Full Text]
  39. Chan, H. M., N. B. Thangue. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J. Cell. Sci. 114: 2363-2373. [Abstract/Free Full Text]
  40. Hagan, M. M., P. J. Havel, R. J. Seeley. 1999. Cerebrospinal fluid and plasma leptin measurements: covariability with dopamine and cortisol in fasting humans. J. Clin. Endocrinol. Metab. 84: 3579-3585. [Abstract/Free Full Text]
  41. Brunetti, L., B. Michelotto, G. Orlando, M. Vacca. 1999. Leptin inhibits norepinephrine and dopamine release from rat hypothalamic neuronal endings. Eur. J. Pharmacol. 372: 237-240. [Medline]
  42. Das, U. N.. 2001. Is obesity an inflammatory condition?. Nutrition 17: 953-966. [Medline]
  43. Braddon, F. E., B. Rodgers, M. E. Wadsworth, J. M. Davies. 1986. Onset of obesity in a 36 year birth cohort study. Br. Med. J. 293: 299-303. [Abstract/Free Full Text]
  44. Sarraf, P., R. C. Frederich, E. M. Turner, G. Ma, N. T. Jaskowiak, D. J. Rivet, J. S. Flier, B. B. Lowell, D. L. Fraker, H. R. Alexander. 1997. Multiple cytokines and acute inflammation raise mouse leptin levels:potential role in inflammtroy anorexia. J. Exp. Med. 185: 171-175. [Abstract/Free Full Text]
  45. Lofferda, S., S. Q. Yang, H. Z. Lin, C. L. Karp, M. L. Brengman, D. J. Wang, A. S. Klein, G. B. Bulkley, C. Bao, P. W. Noble, et al 1998. Leptin regulates proinflammatory immune responses. FASEB J. 12: 57-65. [Abstract/Free Full Text]
  46. Wang, Y., K. K. Kuropatwinski, D. W. White, T. S. Hawley, R. G. Hawley, L. A. Tartaglia, H. Baumann. 1997. Leptin receptor action in hepatic cells. J. Biol. Chem. 272: 16216-16223. [Abstract/Free Full Text]
  47. Hirsch, E., V. L. Katanaev, C. Garlanda, O. Azzolino, L. Pirola, L. Silengo, S. Sozzani, A. Mantovani, F. Altruda, M. P. Wymann. 2000. Central role for G proteincoupled phosphoinositide 3-kinase {gamma} in inflammation. Science 287: 1049-1053. [Abstract/Free Full Text]
  48. Persson, E., O. S. Voznesensky, Y. F. Huang, U. H. Lerner. 2005. Increased expression of interleukin-6 by vasoactive intestinal peptide is associated with regulation of CREB, AP-1 and C/EBP, but not NF-{kappa}B, in mouse calvarial osteoblasts. Bone 37: 513-529. [Medline]
  49. White, M. K., D. S. Strayer. 2002. Survival signaling in type II pneumocytes activated by surfactant protein-A. Exp. Cell Res. 280: 270-279. [Medline]
  50. Romashkova, J. A., S. S. Makarov. 1999. NF-{kappa}B is a target of AKT in anti-apoptotic PDGF signalling. Nature 401: 86-90. [Medline]
  51. Lee, J. Y., N. A. Kim, A. Sanford, K. E. Sullivan. 2003. Histone acetylation and chromatin conformation are regulated separately at the TNF-{alpha} promoter in monocytes and macrophages. J. Leukocyte Biol. 73: 862-871. [Abstract/Free Full Text]
  52. Gilmour, P. S., I. Rahman, K. Donaldson, W. MacNee. 2003. Histone acetylation regulates epithelial IL-8 release mediated by oxidative stress from environmental particles. Am. J. Physiol. 284: L533-L540.



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Hongo, T. Watanabe, S. Arita, T. Kanome, H. Kageyama, S. Shioda, and A. Miyazaki
Leptin modulates ACAT1 expression and cholesterol efflux from human macrophages
Am J Physiol Endocrinol Metab, August 1, 2009; 297(2): E474 - E482.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. E. Mitchell, R. Nogueiras, A. Morris, S. Tovar, C. Grant, M. Cruickshank, D. V. Rayner, C. Dieguez, and L. M. Williams
Leptin receptor gene expression and number in the brain are regulated by leptin level and nutritional status
J. Physiol., July 15, 2009; 587(14): 3573 - 3585.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Nishida, A. Andoh, O. Inatomi, and Y. Fujiyama
Interleukin-32 Expression in the Pancreas
J. Biol. Chem., June 26, 2009; 284(26): 17868 - 17876.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S.-N. Yang, H.-T. Chen, H.-K. Tsou, C.-Y. Huang, W.-H. Yang, C.-M. Su, Y.-C. Fong, W.-P. Tseng, and C.-H. Tang
Leptin enhances cell migration in human chondrosarcoma cells through OBRl leptin receptor
Carcinogenesis, April 1, 2009; 30(4): 566 - 574.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C.-H. Tang, J.-Y. Chuang, Y.-C. Fong, M.-C. Maa, T.-D. Way, and C.-H. Hung
Bone-derived SDF-1 stimulates IL-6 release via CXCR4, ERK and NF-{kappa}B pathways and promotes osteoclastogenesis in human oral cancer cells
Carcinogenesis, August 1, 2008; 29(8): 1483 - 1492.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Nishida, A. Andoh, M. Shioya, S. Kim-Mitsuyama, A. Takayanagi, and Y. Fujiyama
Phosphatidylinositol 3-kinase/Akt signaling mediates interleukin-32{alpha} induction in human pancreatic periacinar myofibroblasts
Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G831 - G838.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Chen, Y.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, C.-H.
Right arrow Articles by Chen, Y.-F.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS