|
|
||||||||
Locus Control Region Activity1Department of Biological Sciences, City University of New York, Hunter College, New York, NY 10021
| Abstract |
|---|
|
|
|---|
/TCR
/Dad1 gene locus bears a locus control region (LCR) that drives high-level, position-independent, thymic transgene expression in chromatin. It achieves this through DNA sequences that enhance transcription and protect transgene expression from integration site-dependent position effects. The former activity maps to a classical enhancer region (E
). In contrast, the elements supporting the latter capacity that suppresses position effects are incompletely understood. Such elements likely play important roles in their native locus and may resemble insulator/boundary sequences. Insulators support enhancer blocking and/or chromatin barrier activity. Most vertebrate enhancer-blocking insulators are dependent on the CTCF transcription factor and its cognate DNA binding site. However, studies have also revealed CTCF-independent enhancer blocking and barrier insulator activity in the vertebrate genome. The TCR
LCR contains a CTCF-dependent and multiple CTCF-independent enhancer-blocking regions whose roles in LCR activity are unknown. Using randomly integrated reporter transgenes in mice, we find that the CTCF region plays a very minor role in LCR function. In contrast, we report the in vivo function of two additional downstream elements located in the region of the LCR that supports CTCF-independent enhancer-blocking activity in cell culture. Internal deletion of either of these elements significantly impairs LCR activity. These results reveal that the position-effect suppression region of the TCR
LCR harbors an array of CTCF-independent, positive-acting gene regulatory elements, some of which share characteristics with barrier-type insulators. These elements may help manage the separate regulatory programs of the TCR
and Dad1 genes. | Introduction |
|---|
|
|
|---|
chain resides on mouse chromosome 14 in a gene locus containing three important genes, TCR
, TCR
, and Dad1, whose very close linkage is evolutionarily conserved (1). TCR
and TCR
genes encode subunits of the 
and 
T cell Ag receptors, respectively. Dad1 encodes a protein with antiapoptotic activity (2). Mice bearing Dad1 null mutations die in utero displaying evidence of increased and inappropriate apoptosis (3, 4, 5). Furthermore, Dad1 expression levels are greatly increased in the late stages of thymocyte development and overexpression of Dad1 in peripheral T cells causes hyperproliferation in response to TCR activation (6). Therefore, in addition to its important functions during embryogenesis, Dad1 may act to modulate the results of T cell stimulation by Ag.
Enforcing proper regulation of TCR
, TCR
, and Dad1 genes in the same genomic locus is likely a complex task (7). TCR
and TCR
genes are somatically rearranging and ultimately are solely expressed on either 
or 
T cells, respectively. In contrast, the Dad1 gene is ubiquitously expressed (8). The cis-acting control mechanisms ensuring the coordination and separation of these three simultaneous but very different gene regulatory programs are incompletely understood. Proper TCR gene rearrangement/expression and apoptosis are both critical processes in T cell development. Therefore, the identification, characterization, and function of cis-acting transcriptional control elements acting on this important gene locus are of significant interest.
An advance in the understanding of gene regulation in this locus was made with the discovery of a locus control region (LCR)5 in the region of DNA between the TCR
constant region exons and the Dad1 gene (9). In transgenic reporter systems, LCRs are defined by their ability to drive expression of linked genes to physiological levels in a predictable tissue-specific and copy number-related manner irrespective of the site of transgene integration in the mouse genome (10). The TCR
LCR has been consistently shown to direct expression of various reporter transgenes to lymphoid tissues at levels related to copy number (9, 11, 12). This rare characteristic is indicative of the LCRs ability to completely protect a transgene from position effects on its expression. Position effects occur when sequences at a given integration site either silence or otherwise alter the pattern or level of gene expression expected from a particular transgene construct (13).
Consistent with other LCRs, the TCR
LCR is composed of a group of DNase I hypersensitive sites (HS) named HS1, HS1', and HS2 through 6. Of these HS, only HS1 (also known as E
) supports classical transcriptional enhancer activity as defined by transient reporter gene transfection assays (14). Nevertheless, the
6-kb region downstream of E
(containing HS1' and HS2 through 6) is critical for the TCR
LCRs ability to protect transgenes from position effects (9, 15). This region also appears to play a role in the regulation of the endogenous locus (8, 16). It is especially important to determine the in vivo functional elements of the TCR
LCR responsible for suppressing position effects at ectopic sites of integration in the genome. Such information may give insight into this powerful, but still mostly unexplained, aspect of LCR activity, in general. In addition, these TCR
LCR subelements are very likely to play a role in managing the separate regulatory programs of the TCR
and Dad1 genes that flank it, thus preventing their inappropriate interaction during T cell development. In this way, some of the position effect suppressing subelements of the TCR
LCR may act as insulator/boundary-like elements in vivo.
Insulator sequences are thought to play a role in separating regulatory influence in the genome and support enhancer blocking and/or chromatin barrier activity with the ability to halt the propagation of repressive chromatin states (17). Studies of insulator elements have so far revealed only one functional sequence element that is common to multiple vertebrate enhancer-blocking-type insulators, the binding site for the CTCF transcription factor (18). CTCF is an 11 zinc finger protein that can play multiple roles at the gene loci it regulates, including gene activation, repression, and enhancer-blocking functions (19). In addition, CTCF is activated upon BCR stimulation and thus may play a role in regulating immune responses (20). There is also clear evidence of CTCF-independent insulator activity in the vertebrate genome and considerable speculation as to their roles in LCR activity (17). As such, there is much interest in the role of CTCF-dependent (21, 22, 23) and CTCF-independent (24, 25) insulator-like elements at immunologically important gene loci, including several shown to contain an LCR (reviewed in Ref. 10).
There is considerable evidence that the TCR
LCR harbors subelements with insulator-like properties that may contribute to its ability to suppress position effects in vivo. Assays in cultured cell lines have identified a broad region of TCR
LCR DNA downstream of E
that supports enhancer-blocking activity (24, 25). In this area, HS1', HS4, and HS6 are the most prominent HS in both transgenic and native TCR
LCR loci of thymocytes (15, 26). A CTCF site with enhancer-blocking activity has been identified in HS1' (25). In the present study, we focus our search for DNA elements participating in position effect suppression to these three regions of the TCR
LCR. We previously reported one such element, a 238-bp sequence within HS6 whose deletion significantly impairs, but does not completely abolish, the LCRs position effect suppression capacity (26). This information, along with the prior enhancer-blocking data (24, 25), clearly suggests that additional elements downstream of E
contribute to LCR activity. Primary candidates for such elements include the identified CTCF binding site in HS1' with enhancer-blocking activity (25), the tissue specifically methylated area of HS4 DNA, the function of which is still unknown (27), and a 316-bp segment of the HS6 region at the very 3' end of the LCR (named HS6-316) whose activity was revealed in cell culture (26). In this study, we describe the functional contributions of these three candidate position-effect suppression elements to TCR
LCR activity in vivo using an integration site-independent transgenic reporter system in mice.
We find that the CTCF region is a very minor contributor to LCR function. In contrast, internal deletion of the HS4 or HS6-316 regions, neither of which interacts with CTCF (25), results in a more significant impairment of LCR activity. Altogether, the data show that the TCR
LCR subregion supporting its position-effect suppression capacity harbors an array of cooperating CTCF-independent, positive-acting functional elements, some of which share properties with barrier insulators. The existence of these multiple elements in between the TCR
and Dad1 genes would, in principle, allow for dynamic regulation of the strength of this intergenic regions activity. This is an intriguing possibility given the in vivo functions and expression patterns of the TCR
and Dad1 genes that flank it in the genome.
| Materials and Methods |
|---|
|
|
|---|
In vivo DNase I footprinting was conducted essentially as described in Ref. 28 using nuclei from thymus of C57BL/6 mice and mouse fibroblasts (NIH3T3). Briefly, nuclei were digested with varying amounts of DNase I (Worthington Biochemical) ranging from 0.0 to 4.0 µg/ml. Plain genomic DNA was digested with 0.25–1 µg/ml DNase I. The cleaved genomic DNA was purified by phenol/chloroform/isoamyl extraction followed by ethanol precipitation. The DNA was then subjected to ligation mediated-PCR using acrylamide gel-purified, gene-specific oligonucleotide primers (Proligo). The amplification products were further analyzed as described previously (28). The primers were complimentary to the following TCR
locus sequences: primer 1, 5'-CTGCATCCTACGGAAAAACTCTTTCCA-3'; primer 2, 5'-CTCCCTCGGCGTGTTTATTCGGGA-3'; and primer 3, 5'-CCAAAAGGCTTTCTCCCTCGGCGTGTT-3'.
Nuclear extract preparation and EMSA
Thymic and NIH3T3 nuclei were prepared as previously described (28). Nuclear extract (3 µg) was used in EMSA with 40,000 cpm (dry) of 32P-labeled oligonucleotide probe. The final binding reaction conditions (25) were as follows: 20 mM HEPES (pH 7.9), 5 mM MgCl2, 150 mM KCl, 1 mM DTT, 1 mM PMSF, 5% glycerol, and 0.5% Triton X-100 with 1 µg of poly(dI:dC) (double stranded). Incubations were on ice for 45 min. For binding site competition assays, a 50-fold molar excess of unlabeled oligonucleotide was added to the binding reaction before the addition of labeled probe. The sequences (5'–3') of the oligonucleotide probes used are as follows: 5'-CTCF, TGGGAGTCCCACTCTGTTGTAGTGTCCT; 3'-CTCF, GGTAGCCACACGGGGGCAGCAGTACTCC;
-globin FII, CCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCA.
Transgenic mice
These transgenic animal studies have been reviewed and approved by the Hunter College Institutional Animal Care and Use Committee. DNA fragments for microinjection were twice purified on low-melting point agarose gels (SeaPlaque) and isolated using
-agarose (New England Biolabs). The purified DNA was microinjected into the male pronucleus of (C57BL/6 x CBA)F1 fertilized mouse eggs (Sloan-Kettering Transgenics Facility) that were then transferred to pseudopregnant female mice. Transgenic founders were identified by Southern blot analyses of tail DNA digested with NcoI (New England Biolabs) and probed with a 900-bp SmaI fragment from the LCR that detected the transgene and the endogenous locus on different size restriction fragments. Relative copy number was determined for each line by analysis of at least two Southern blots by PhosphorImager quantification (Molecular Dynamics). All lines directly compared here were analyzed for relative copy number on the same Southern blots using the same probe and enzyme digestion. The signal from the endogenous TCR
locus was used as a normalizing control.
DNA constructs
The
:1-6 transgene construct containing a 4.9-kb human
-globin gene fragment and a 7.4-kb fragment of the TCR
LCR containing HS1 through HS6 has been previously described (15).
:1-6
CTCF is a deletion mutant version of
:1-6 in which a 94-bp AvrII to ScaI fragment within HS1' containing tandem CTCF binding sites was removed. The
:1-6
HS4 construct was designed to delete an ApaLI to DraI fragment containing 1.1 kb of HS4 region DNA from the
:1-6 wild-type LCR-linked transgene.
:1-6
HS6-316 is a construct that removes a 316-bp PstI to BglII fragment in the HS6 region from the
:1-6 transgene. Transgene inserts for microinjection were liberated from vector DNA by using the XhoI and ClaI sites of the parent cloning vector pSP72 (Promega).
RNA analyses
RNA was prepared as previously described using a single-step isolation protocol (29) from mouse tissues that were dissected of fat and washed with PBS to minimize contamination with blood. Five micrograms of RNA per sample was run on a 1% agarose gel and transferred onto a noncharged nylon membrane (Genescreen) for Northern blot hybridization analyses using Quickhyb solution (Stratagene). A 428-bp BamHI-NcoI genomic fragment of human
-globin gene coding region was used to probe for the mRNA product of the reporter transgene. To normalize for loading variation, blots were stripped and reprobed with a 500-bp Sau 3AI fragment of the TCR
constant region (C
) cDNA or a probe to 18S rRNA (Ambion). All probes were labeled with [
-32P]dCTP using a random primer labeling kit (Invitrogen Life Technologies). Transgene signals were quantified and normalized to the relevant loading control signal by PhosphorImager analysis.
| Results |
|---|
|
|
|---|
The HS1' element is a critical component of the TCR
LCR affecting long-range chromatin structure and epigenetic modification at transgene loci (15, 27). To identify DNA sequences within HS1' interacting with nuclear factors, we performed DNase I-mediated in vivo footprinting on this region of the endogenous TCR
LCR. Nuclei of mouse thymocytes (which express both TCR
and Dad1) and NIH3T3 mouse fibroblasts (which express Dad1 but not TCR
) were treated with limiting amounts of DNase I. The cleavage products were amplified by ligation-mediated PCR using locus-specific primers. In both types of nuclei, the data revealed two adjacent occupied sequences that have homology to the consensus recognition site for the CTCF protein (Fig. 1). The 3' site (labeled 3' CTCF/TAD1) was previously confirmed as a bona fide CTCF binding site by EMSA, Ab "supershift" assays, and chromatin immunoprecipitation (25). In contrast, the 5' CTCF-like site located 14 bp upstream had not been previously recognized. EMSA experiments were performed using separate oligonucleotides representing either the 5' or 3' CTCF site homolog and nuclear extracts from thymocytes or fibroblasts. These experiments showed that both CTCF sites formed protein-DNA complexes of similar mobility in both thymocyte and fibroblast extracts (data not shown) and could cross-compete for each others complexes in unlabeled oligonucleotide competitor inhibition assays (Fig. 1C). Furthermore, excess unlabeled CTCF site DNA from the chicken
-globin insulator (18) also effectively competed for the complexes bound to both the 5' CTCF-like and 3' CTCF/TAD1 sites (Fig. 1C). Based on these experiments in combination with the data reported by Magdinier et al. (25), we concluded that both occupied CTCF-like sites bind to similar complexes containing CTCF (or closely related) factors. The apparent lack of T cell-specific in vivo occupancy at either of these sites in chromatin (Fig. 1A) is concordant with this conclusion. Most importantly for the present study, this information directed the design of the internal deletion mutant used here to test the role of the tandem CTCF-like sites in LCR activity in transgenic mice.
|
LCR subelements
Much of our understanding of the components of TCR
LCR function has come from analyses of reporter transgene loci in mice. The present study was conducted using a 4.9-kb human
-globin reporter gene fragment linked to either the wild-type TCR
LCR (a construct named
:1-6) or internal deletion mutants thereof (Fig. 2B). The
-globin reporter fragment contains the human
-globin promoter, exons, introns, and 3' enhancer sequence. It is highly subject to position-effect silencing in the absence of additional elements (30, 31) and has long been used as a reporter of LCR activity in multiple systems (11, 32, 33, 34). Including an intact LCR in the transgene eliminates these position effects. Linking the
-globin reporter gene to HS1-6 of the TCR
LCR yields the high-level, lymphoid organ-specific and relatively consistent reporter expression levels per copy (within a narrow 2- to 3-fold range) indicative of integration-site independence and full TCR
LCR activity in vivo (15).
|
(Fig. 2A) (15, 24, 25). We created three different LCR internal deletion mutants to assess the contribution of the deleted sequences to LCR activity (Fig. 2B). These mutant LCRs are missing either the region of HS1' containing the tandem CTCF-like binding sites identified above, the region of HS4 containing the target of tissue- and site-specific DNA demethylation (27) or the HS6-316 position-effect suppressing region previously described in cell culture (26). Each of these mutant LCRs was linked separately to the human
-globin fragment to create the transgenes named
:1-6
CTCF,
:1-6
HS4, and
:1-6
HS6-316, respectively. Multiple transgenic lines bearing these constructs were generated. The activity of these mutant LCR-driven transgenes was compared with that of the wild-type
:1-6 construct using a new set of
:1-6-transgenic lines. In all, 20 new, independent transgenic mouse lines are analyzed here.
Inconsistent tissue distribution of mutant TCR
LCR-driven transgene expression
Reporter gene expression levels under the control of the TCR
LCR are consistently highest in the thymus, next highest in the spleen and very low (<10% of thymic expression) in nonlymphoid organs (9, 12, 15). The six new independent
:1-6-transgenic lines analyzed here consistently displayed this expression pattern with very little variation (Fig. 3A). We previously observed that mutant TCR
LCR-driven
-globin transgenes (26), as well as non-LCR-containing
-globin reporter transgenes (Ref. 28 and B. D. Oritz, unpublished observations), do not consistently maintain this tissue distribution. This is likely due to the effects of interference by native regulatory sequences at the varying sites of transgene integration. Therefore, we interpret significant deviation from the wild-type expression pattern (Fig. 3A) as indicative of position effects and, thus, impaired LCR activity. The effect of deleting the CTCF sites from the LCR on the normal transgene expression pattern was minor with mRNA levels only barely crossing the 10% "threshold" (relative to thymic mRNA levels) in lung and heart (Fig. 3B). Tissue distribution of transgene expression was somewhat more perturbed in the absence of the 316-bp region of HS6 with average relative expression levels in some nonlymphoid organs exceeding 20% of that seen in thymus (Fig. 3C). However, the relative tissue distribution of multiple lines bearing the
:1-6
HS4 mutant transgene was plainly abnormal, leading to large variations in organ expression levels relative to thymus among the four lines analyzed (Fig. 3D). These data indicate that the
HS6-316 and
HS4 mutant LCRs are less able to protect the transgene from position effects.
|
Because LCRs confer copy number-related expression upon a linked transgene, we examined whether transgene expression levels were altered when driven by the various mutant LCRs. Using Northern blots and PhosphorImager analyses, we compared the expression levels (per transgene copy) of the wild-type
:1-6 and mutant
:1-6
CTCF transgenes in lymphoid tissues. Detected
-globin mRNA levels were normalized to those of endogenous TCR
in thymus. The products were then divided by the relative copy number estimates among the various lines. A representative Northern blot is shown in Fig. 4A and quantified expression levels per copy are shown in Fig. 4B. The data show that the average transgene expression levels per copy from the
CTCF mutant construct are slightly reduced from the average of wild-type
:1-6 transgene expression levels, with 77% of wild-type expression in thymus. Coupled with the data in Fig. 3B, it appears that the tandem CTCF sites are minor contributors, at best, to the TCR
LCRs activity in this system.
|
HS4 and
HS6-316 mutations impair TCR
LCR activity
As mentioned previously, the region of HS4 and a 316-bp region within HS6 were identified as candidate participants in TCR
LCR function, and Fig. 3, C and D, suggest that these sequences may be necessary for the LCR to fully protect transgenes from position effects. Using the same methods described for Fig. 4, we quantified the contribution of the HS4 and HS6-316 elements to TCR
LCR-driven transgene expression in thymus. We compared transgene mRNA levels (per copy) produced by the
:1-6
HS4 and
:1-6
HS6-316 transgenes to those of the wild-type LCR-driven
:1-6 construct. In the representative experiment shown in Fig. 5, average transgene mRNA levels per copy are reduced over 4-fold from wild-type levels when HS4 DNA is absent from the LCR. Similarly, average expression levels of the
HS6-316 mutant are 3.3-fold lower per transgene copy, compared with that driven by the wild-type LCR. Along with the results in Fig. 3, C and D, these data help confirm that the HS4 and HS6-316 regions of the TCR
LCR harbor in vivo functional elements.
|
| Discussion |
|---|
|
|
|---|
/TCR
/Dad1 gene locus that are active in vivo is an important endeavor. Among other things, these elements collectively help achieve the carefully orchestrated gene rearrangements that ensure generation of both 
and 
T cells with a wide repertoire of TCR specificities. In addition, it is important to understand the regulation, and possible coordination, of TCR
and Dad1 gene expression. TCR
gene assembly and expression are the final step before thymic selection processes that entail sorting through the randomly generated TCR repertoire. These processes promote further development of desirable T cells bearing TCR specificities that are able to use self-MHC without being overly self-reactive (35). Those T cells bearing TCR specificities that do not meet these criteria die by apoptosis. In this light, the evolutionarily conserved linkage of the TCR
gene to the antiapoptosis gene Dad1 is particularly intriguing. The expression patterns of these two genes are different from each other, both in terms of tissue distribution and developmental timing (6, 8). The TCR
LCR is flanked by the TCR
gene on its 5' end and the Dad1 gene on its 3' end. The roughly
6-kb of LCR DNA in between the HS1/E
element and the most proximal end of the Dad1 locus is critical for LCR activity. It would also be expected to play an important role in coordinating and/or separating the regulation of the TCR
and Dad1 genes during thymocyte development (as well as throughout the embryo), perhaps in a manner analogous to insulator elements.
Although a connection between LCR activity and insulator elements has been proposed (17), in vivo data directly linking the two are sparse. With the rare exception of imprinted gene loci (36), the activity of the various types of insulators is typically studied in cell culture models. Although these models have provided invaluable data on insulator mechanisms, they are not optimal for the study of LCR activity (37). The TCR
LCR we study has both CTCF-dependent and CTCF-independent enhancer-blocking activities in its position-effect suppressing region (24, 25). Therefore, our experimental model provided a rare opportunity to further characterize these various types of insulator elements (and their roles in LCR activity and gene regulation in vivo) using an integration-site independent, LCR-driven reporter transgene system. We have determined that the CTCF-binding region of the TCR
LCR is largely dispensable for LCR activity. In contrast, we found that the CTCF-independent enhancer-blocking region of the LCR contains two additional elements that are major contributors to the LCRs function. These may be insulator-like elements. Alternatively, these could represent positive regulators of gene expression in chromatin distinct from classical transcriptional enhancers.
Seemingly conflicting data have been reported regarding the role of CTCF and its cognate binding site in position-effect suppression in chromatin. Work on the chicken
-globin insulator has produced clear evidence that its barrier capacity is independent of its CTCF binding sequences (38, 39). However, reports using other experimental systems have asserted that CTCF can block the spreading of repressive chromatin (40), regulate the balance between activating and silencing histone modifications (41), and protect from position effects (42). We found that a deletion of the tandem CTCF-like binding sites of the TCR
LCR did not have a significant impact on its position-effect suppressing activity in vivo. These data indicate that the enhancer-blocking activity demonstrated for this CTCF-binding region does not meaningfully contribute to overcoming heterochromatin-induced position effects in our system. Overcoming these effects is a hallmark of LCR activity at ectopically integrated transgene loci (43, 44). Nonetheless, the enhancer-blocking data reported previously (25) suggest that these sites do bear some activity. It is possible that the CTCF sites act as an enhancer blocker that is only active elsewhere in the embryo and/or in restricted situations arising during thymocyte development that would not be detected in analyses of bulk thymocytes.
The unchecked spreading of condensed chromatin is one likely cause of the position-effect gene silencing often observed from randomly integrated transgenes in mice (13, 43, 44). TCR
LCR activity prevents these effects. We find that the HS4 and HS6-316 regions of the LCR are required for complete LCR activity in vivo and may well be two examples of CTCF-independent barrier-type insulator elements. Although we do not formally test these elements as self-contained barrier insulators here, these elements do share some important characteristics with known barrier insulators. For example, in T cells, the endogenous HS4 region DNA shows a higher level of histone acetylation than its neighboring sequences (25), a trait of the chicken
-globin insulator (45, 46). Also, the HS6-316 region protects stable-transfected reporter constructs from silencing in chromatin (26), the hallmark property of barrier insulators (47). The discovery of multiple functional elements in the position-effect suppressing region of the TCR
LCR provides evidence in support of a proposed model of barrier insulator activity (17), where barrier function depends on the local balance between negative and positive regulatory activity in chromatin. In this model, the three functional elements in the 3' end of the TCR
LCR described to date (Ref. 26 and the present study) would synergize to create a strong positive regulatory influence to prevent position-effect silencing. We have shown that removal of any one of these elements reduces the strength of LCR activity (Fig. 6). This model may also help explain the cell-type specificity of TCR
LCR activity. In nonlymphoid tissue, HS4 region DNA is selectively and heavily methylated (27) and the TF123 region of HS6, described previously (26), is not occupied in vivo by the factors that do bind it in T cells (28). According to the above barrier model, inactivation of HS4 and TF123 elements in this way could render the LCR too weak to fully protect from position effects in nonlymphoid organs.
|
/Dad1 gene locus would present an interesting challenge to an insulator element.
In either model (insulator vs positive regulator), these elements may play a role in coordinating the expression of the TCR
and Dad1 genes, which display differing kinetics during thymocyte development. TCR
gene rearrangement and transcription begin at the CD4–CD8–CD25–CD44– (DN4) stage of thymocyte development (48, 49). In contrast, high levels of Dad1 expression are not seen until the later, single positive stage (6). Therefore, it is likely that a strong separation of the TCR
and Dad1 gene regulatory influences would be warranted at early thymocyte stages. However, at later stages, it might be desirable to selectively reduce that regulatory separation so that Dad1 and TCR
genes may be coordinately up-regulated in T cells that have successfully survived thymic selection. In principle, having multiple cooperating elements working collectively in the TCR
/Dad1 intergenic region would make it possible to dynamically modulate this regions regulatory activity via selective inactivation of its component elements. Having localized and confirmed the function of these TCR
LCR subelements, these hypotheses, along with the important question of what gene regulatory "machinery" these elements interact with, can now be explored.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Science Foundation Career Award MCB-0236964 and National Institutes of Health (NIH) Grant AI-053050 (to B.D.O.). J.G.K. and J.A. were supported by Research Centers in Minority Institutions Award RR-03037 from the National Center for Research Resources of the NIH that also provides support of the infrastructure and instrumentation in the Department of Biological Sciences at Hunter College. F.H. was a Fellow of the Research Initiative for Scientific Enhancement Program (Grant GM-060665) of the NIH and a Ford Foundation Dissertation Fellow. ![]()
2 Current address: National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892. ![]()
3 Current address: Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, MD 21205. ![]()
4 Address correspondence and reprint requests to Dr. Benjamin D. Ortiz, Department of Biological Sciences, City University of New York, Hunter College, 695 Park Avenue, Room 927N, New York, NY 10021. E-mail address: ortiz{at}genectr.hunter.cuny.edu ![]()
5 Abbreviations used in this paper: LCR, locus control region; HS, hypersensitive site. ![]()
Received for publication February 23, 2007. Accepted for publication May 3, 2007.
| References |
|---|
|
|
|---|
chain constant region. Immunogenetics 46: 376-382. [Medline]
/
locus. Immunol. Rev. 200: 224-232. [Medline]
/
locus impairs T-cell development and reveals the presence of the nearby antiapoptosis gene Dad1. Mol. Cell. Biol. 17: 2151-2157. [Abstract]
/
locus. Immunity 1: 207-217. [Medline]
locus control region specifies thymic, but not peripheral, patterns of TCR
gene expression. J. Immunol. 175: 6659-6667.
locus. EMBO J. 8: 729-733. [Medline]
locus required for tissue-specific locus control region activity. Mol. Cell. Biol. 19: 1901-1909.
/
locus enhancer identity and position are critical for the assembly of TCR
and
variable region genes. Proc. Natl. Acad. Sci. USA 100: 2598-2603.
and
gene segments within the human T cell receptor
/
locus. Proc. Natl. Acad. Sci. USA 94: 5219-5224.
and Dad1 genes. J. Immunol. 163: 295-300.
and Dad1 genes. J. Biol. Chem. 279: 25381-25389.
locus control region. J. Biol. Chem. 275: 1952-1958.
/Dad1 gene locus. J. Immunol. 167: 3836-3845.
-globin gene in transgenic mice. Nature 315: 338-340. [Medline]
-globin genes in transgenic mice. EMBO J. 4: 1715-1723. [Medline]
-globin gene in transgenic mice. Cell 51: 975-985. [Medline]
-globin insulator are separable activities. Proc. Natl. Acad. Sci. USA 99: 6883-6888.
-globin locus. Genes Dev. 20: 2349-2354. This article has been cited by other articles:
![]() |
E. Molto, A. Fernandez, and L. Montoliu Boundaries in vertebrate genomes: different solutions to adequately insulate gene expression domains Brief Funct Genomic Proteomic, July 1, 2009; 8(4): 283 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ribeiro de Almeida, H. Heath, S. Krpic, G. M. Dingjan, J. P. van Hamburg, I. Bergen, S. van de Nobelen, F. Sleutels, F. Grosveld, N. Galjart, et al. Critical Role for the Transcription Regulator CCCTC-Binding Factor in the Control of Th2 Cytokine Expression J. Immunol., January 15, 2009; 182(2): 999 - 1010. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |