The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 1088 -1095
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gomos-Klein, J.
Right arrow Articles by Ortiz, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gomos-Klein, J.
Right arrow Articles by Ortiz, B. D.

CTCF-Independent, but Not CTCF-Dependent, Elements Significantly Contribute to TCR-{alpha} Locus Control Region Activity1

Janette Gomos-Klein, Faith Harrow2, Jemma Alarcón3 and Benjamin D. Ortiz4

Department of Biological Sciences, City University of New York, Hunter College, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The mouse TCR{alpha}/TCR{delta}/Dad1 gene locus bears a locus control region (LCR) that drives high-level, position-independent, thymic transgene expression in chromatin. It achieves this through DNA sequences that enhance transcription and protect transgene expression from integration site-dependent position effects. The former activity maps to a classical enhancer region (E{alpha}). In contrast, the elements supporting the latter capacity that suppresses position effects are incompletely understood. Such elements likely play important roles in their native locus and may resemble insulator/boundary sequences. Insulators support enhancer blocking and/or chromatin barrier activity. Most vertebrate enhancer-blocking insulators are dependent on the CTCF transcription factor and its cognate DNA binding site. However, studies have also revealed CTCF-independent enhancer blocking and barrier insulator activity in the vertebrate genome. The TCR{alpha} LCR contains a CTCF-dependent and multiple CTCF-independent enhancer-blocking regions whose roles in LCR activity are unknown. Using randomly integrated reporter transgenes in mice, we find that the CTCF region plays a very minor role in LCR function. In contrast, we report the in vivo function of two additional downstream elements located in the region of the LCR that supports CTCF-independent enhancer-blocking activity in cell culture. Internal deletion of either of these elements significantly impairs LCR activity. These results reveal that the position-effect suppression region of the TCR{alpha} LCR harbors an array of CTCF-independent, positive-acting gene regulatory elements, some of which share characteristics with barrier-type insulators. These elements may help manage the separate regulatory programs of the TCR{alpha} and Dad1 genes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The gene encoding the TCR{alpha} chain resides on mouse chromosome 14 in a gene locus containing three important genes, TCR{alpha}, TCR{delta}, and Dad1, whose very close linkage is evolutionarily conserved (1). TCR{alpha} and TCR{delta} genes encode subunits of the {alpha}beta and {gamma}{delta} T cell Ag receptors, respectively. Dad1 encodes a protein with antiapoptotic activity (2). Mice bearing Dad1 null mutations die in utero displaying evidence of increased and inappropriate apoptosis (3, 4, 5). Furthermore, Dad1 expression levels are greatly increased in the late stages of thymocyte development and overexpression of Dad1 in peripheral T cells causes hyperproliferation in response to TCR activation (6). Therefore, in addition to its important functions during embryogenesis, Dad1 may act to modulate the results of T cell stimulation by Ag.

Enforcing proper regulation of TCR{alpha}, TCR{delta}, and Dad1 genes in the same genomic locus is likely a complex task (7). TCR{alpha} and TCR{delta} genes are somatically rearranging and ultimately are solely expressed on either {alpha}beta or {gamma}{delta} T cells, respectively. In contrast, the Dad1 gene is ubiquitously expressed (8). The cis-acting control mechanisms ensuring the coordination and separation of these three simultaneous but very different gene regulatory programs are incompletely understood. Proper TCR gene rearrangement/expression and apoptosis are both critical processes in T cell development. Therefore, the identification, characterization, and function of cis-acting transcriptional control elements acting on this important gene locus are of significant interest.

An advance in the understanding of gene regulation in this locus was made with the discovery of a locus control region (LCR)5 in the region of DNA between the TCR{alpha} constant region exons and the Dad1 gene (9). In transgenic reporter systems, LCRs are defined by their ability to drive expression of linked genes to physiological levels in a predictable tissue-specific and copy number-related manner irrespective of the site of transgene integration in the mouse genome (10). The TCR{alpha} LCR has been consistently shown to direct expression of various reporter transgenes to lymphoid tissues at levels related to copy number (9, 11, 12). This rare characteristic is indicative of the LCR’s ability to completely protect a transgene from position effects on its expression. Position effects occur when sequences at a given integration site either silence or otherwise alter the pattern or level of gene expression expected from a particular transgene construct (13).

Consistent with other LCRs, the TCR{alpha} LCR is composed of a group of DNase I hypersensitive sites (HS) named HS1, HS1', and HS2 through 6. Of these HS, only HS1 (also known as E{alpha}) supports classical transcriptional enhancer activity as defined by transient reporter gene transfection assays (14). Nevertheless, the ~6-kb region downstream of E{alpha} (containing HS1' and HS2 through 6) is critical for the TCR{alpha} LCR’s ability to protect transgenes from position effects (9, 15). This region also appears to play a role in the regulation of the endogenous locus (8, 16). It is especially important to determine the in vivo functional elements of the TCR{alpha} LCR responsible for suppressing position effects at ectopic sites of integration in the genome. Such information may give insight into this powerful, but still mostly unexplained, aspect of LCR activity, in general. In addition, these TCR{alpha} LCR subelements are very likely to play a role in managing the separate regulatory programs of the TCR{alpha} and Dad1 genes that flank it, thus preventing their inappropriate interaction during T cell development. In this way, some of the position effect suppressing subelements of the TCR{alpha} LCR may act as insulator/boundary-like elements in vivo.

Insulator sequences are thought to play a role in separating regulatory influence in the genome and support enhancer blocking and/or chromatin barrier activity with the ability to halt the propagation of repressive chromatin states (17). Studies of insulator elements have so far revealed only one functional sequence element that is common to multiple vertebrate enhancer-blocking-type insulators, the binding site for the CTCF transcription factor (18). CTCF is an 11 zinc finger protein that can play multiple roles at the gene loci it regulates, including gene activation, repression, and enhancer-blocking functions (19). In addition, CTCF is activated upon BCR stimulation and thus may play a role in regulating immune responses (20). There is also clear evidence of CTCF-independent insulator activity in the vertebrate genome and considerable speculation as to their roles in LCR activity (17). As such, there is much interest in the role of CTCF-dependent (21, 22, 23) and CTCF-independent (24, 25) insulator-like elements at immunologically important gene loci, including several shown to contain an LCR (reviewed in Ref. 10).

There is considerable evidence that the TCR{alpha} LCR harbors subelements with insulator-like properties that may contribute to its ability to suppress position effects in vivo. Assays in cultured cell lines have identified a broad region of TCR{alpha} LCR DNA downstream of E{alpha} that supports enhancer-blocking activity (24, 25). In this area, HS1', HS4, and HS6 are the most prominent HS in both transgenic and native TCR{alpha} LCR loci of thymocytes (15, 26). A CTCF site with enhancer-blocking activity has been identified in HS1' (25). In the present study, we focus our search for DNA elements participating in position effect suppression to these three regions of the TCR{alpha} LCR. We previously reported one such element, a 238-bp sequence within HS6 whose deletion significantly impairs, but does not completely abolish, the LCR’s position effect suppression capacity (26). This information, along with the prior enhancer-blocking data (24, 25), clearly suggests that additional elements downstream of E{alpha} contribute to LCR activity. Primary candidates for such elements include the identified CTCF binding site in HS1' with enhancer-blocking activity (25), the tissue specifically methylated area of HS4 DNA, the function of which is still unknown (27), and a 316-bp segment of the HS6 region at the very 3' end of the LCR (named HS6-316) whose activity was revealed in cell culture (26). In this study, we describe the functional contributions of these three candidate position-effect suppression elements to TCR{alpha} LCR activity in vivo using an integration site-independent transgenic reporter system in mice.

We find that the CTCF region is a very minor contributor to LCR function. In contrast, internal deletion of the HS4 or HS6-316 regions, neither of which interacts with CTCF (25), results in a more significant impairment of LCR activity. Altogether, the data show that the TCR{alpha} LCR subregion supporting its position-effect suppression capacity harbors an array of cooperating CTCF-independent, positive-acting functional elements, some of which share properties with barrier insulators. The existence of these multiple elements in between the TCR{alpha} and Dad1 genes would, in principle, allow for dynamic regulation of the strength of this intergenic region’s activity. This is an intriguing possibility given the in vivo functions and expression patterns of the TCR{alpha} and Dad1 genes that flank it in the genome.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In vivo DNase I footprint analyses

In vivo DNase I footprinting was conducted essentially as described in Ref. 28 using nuclei from thymus of C57BL/6 mice and mouse fibroblasts (NIH3T3). Briefly, nuclei were digested with varying amounts of DNase I (Worthington Biochemical) ranging from 0.0 to 4.0 µg/ml. Plain genomic DNA was digested with 0.25–1 µg/ml DNase I. The cleaved genomic DNA was purified by phenol/chloroform/isoamyl extraction followed by ethanol precipitation. The DNA was then subjected to ligation mediated-PCR using acrylamide gel-purified, gene-specific oligonucleotide primers (Proligo). The amplification products were further analyzed as described previously (28). The primers were complimentary to the following TCR{alpha} locus sequences: primer 1, 5'-CTGCATCCTACGGAAAAACTCTTTCCA-3'; primer 2, 5'-CTCCCTCGGCGTGTTTATTCGGGA-3'; and primer 3, 5'-CCAAAAGGCTTTCTCCCTCGGCGTGTT-3'.

Nuclear extract preparation and EMSA

Thymic and NIH3T3 nuclei were prepared as previously described (28). Nuclear extract (3 µg) was used in EMSA with 40,000 cpm (dry) of 32P-labeled oligonucleotide probe. The final binding reaction conditions (25) were as follows: 20 mM HEPES (pH 7.9), 5 mM MgCl2, 150 mM KCl, 1 mM DTT, 1 mM PMSF, 5% glycerol, and 0.5% Triton X-100 with 1 µg of poly(dI:dC) (double stranded). Incubations were on ice for 45 min. For binding site competition assays, a 50-fold molar excess of unlabeled oligonucleotide was added to the binding reaction before the addition of labeled probe. The sequences (5'–3') of the oligonucleotide probes used are as follows: 5'-CTCF, TGGGAGTCCCACTCTGTTGTAGTGTCCT; 3'-CTCF, GGTAGCCACACGGGGGCAGCAGTACTCC; beta-globin FII, CCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCA.

Transgenic mice

These transgenic animal studies have been reviewed and approved by the Hunter College Institutional Animal Care and Use Committee. DNA fragments for microinjection were twice purified on low-melting point agarose gels (SeaPlaque) and isolated using beta-agarose (New England Biolabs). The purified DNA was microinjected into the male pronucleus of (C57BL/6 x CBA)F1 fertilized mouse eggs (Sloan-Kettering Transgenics Facility) that were then transferred to pseudopregnant female mice. Transgenic founders were identified by Southern blot analyses of tail DNA digested with NcoI (New England Biolabs) and probed with a 900-bp SmaI fragment from the LCR that detected the transgene and the endogenous locus on different size restriction fragments. Relative copy number was determined for each line by analysis of at least two Southern blots by PhosphorImager quantification (Molecular Dynamics). All lines directly compared here were analyzed for relative copy number on the same Southern blots using the same probe and enzyme digestion. The signal from the endogenous TCR{alpha} locus was used as a normalizing control.

DNA constructs

The beta:1-6 transgene construct containing a 4.9-kb human beta-globin gene fragment and a 7.4-kb fragment of the TCR{alpha} LCR containing HS1 through HS6 has been previously described (15). beta:1-6{Delta}CTCF is a deletion mutant version of beta:1-6 in which a 94-bp AvrII to ScaI fragment within HS1' containing tandem CTCF binding sites was removed. The beta:1-6{Delta}HS4 construct was designed to delete an ApaLI to DraI fragment containing 1.1 kb of HS4 region DNA from the beta:1-6 wild-type LCR-linked transgene. beta:1-6{Delta}HS6-316 is a construct that removes a 316-bp PstI to BglII fragment in the HS6 region from the beta:1-6 transgene. Transgene inserts for microinjection were liberated from vector DNA by using the XhoI and ClaI sites of the parent cloning vector pSP72 (Promega).

RNA analyses

RNA was prepared as previously described using a single-step isolation protocol (29) from mouse tissues that were dissected of fat and washed with PBS to minimize contamination with blood. Five micrograms of RNA per sample was run on a 1% agarose gel and transferred onto a noncharged nylon membrane (Genescreen) for Northern blot hybridization analyses using Quickhyb solution (Stratagene). A 428-bp BamHI-NcoI genomic fragment of human beta-globin gene coding region was used to probe for the mRNA product of the reporter transgene. To normalize for loading variation, blots were stripped and reprobed with a 500-bp Sau 3AI fragment of the TCR{alpha} constant region (C{alpha}) cDNA or a probe to 18S rRNA (Ambion). All probes were labeled with [{alpha}-32P]dCTP using a random primer labeling kit (Invitrogen Life Technologies). Transgene signals were quantified and normalized to the relevant loading control signal by PhosphorImager analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In vivo footprinting reveals two CTCF-like binding sites in the HS1' region

The HS1' element is a critical component of the TCR{alpha} LCR affecting long-range chromatin structure and epigenetic modification at transgene loci (15, 27). To identify DNA sequences within HS1' interacting with nuclear factors, we performed DNase I-mediated in vivo footprinting on this region of the endogenous TCR{alpha} LCR. Nuclei of mouse thymocytes (which express both TCR{alpha} and Dad1) and NIH3T3 mouse fibroblasts (which express Dad1 but not TCR{alpha}) were treated with limiting amounts of DNase I. The cleavage products were amplified by ligation-mediated PCR using locus-specific primers. In both types of nuclei, the data revealed two adjacent occupied sequences that have homology to the consensus recognition site for the CTCF protein (Fig. 1). The 3' site (labeled 3' CTCF/TAD1) was previously confirmed as a bona fide CTCF binding site by EMSA, Ab "supershift" assays, and chromatin immunoprecipitation (25). In contrast, the 5' CTCF-like site located 14 bp upstream had not been previously recognized. EMSA experiments were performed using separate oligonucleotides representing either the 5' or 3' CTCF site homolog and nuclear extracts from thymocytes or fibroblasts. These experiments showed that both CTCF sites formed protein-DNA complexes of similar mobility in both thymocyte and fibroblast extracts (data not shown) and could cross-compete for each other’s complexes in unlabeled oligonucleotide competitor inhibition assays (Fig. 1C). Furthermore, excess unlabeled CTCF site DNA from the chicken beta-globin insulator (18) also effectively competed for the complexes bound to both the 5' CTCF-like and 3' CTCF/TAD1 sites (Fig. 1C). Based on these experiments in combination with the data reported by Magdinier et al. (25), we concluded that both occupied CTCF-like sites bind to similar complexes containing CTCF (or closely related) factors. The apparent lack of T cell-specific in vivo occupancy at either of these sites in chromatin (Fig. 1A) is concordant with this conclusion. Most importantly for the present study, this information directed the design of the internal deletion mutant used here to test the role of the tandem CTCF-like sites in LCR activity in transgenic mice.


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 1. DNase I-mediated in vivo footprint reveals occupation of tandem CTCF-like sites in the endogenous TCR{alpha} LCR. A, Ligation-mediated PCR on plain genomic DNA or DNase I-treated nuclei (mouse thymus, NIH3T3 mouse fibroblasts). Triangle indicates increasing DNase I concentration. Brackets indicate two strong footprint regions named 5' CTCF-like and 3' CTCF/TAD1 (25 ). B, Comparison of occupied sequences in HS1' to CTCF consensus binding sequences of Igf2/H19 (50 ) and the FII site of the chicken beta-globin insulator (18 ). Shaded areas indicate conservation of sequence identity among the four CTCF sites. C, The 3' and 5' CTCF-like sites cross-compete for each others’ binding complexes (indicated by arrow). EMSA using 3'-CTCF/TAD1 and 5'-CTCF-like site-labeled oligonucleotides (top) and thymic nuclear extract. Unlabeled competitor oligonucleotides used are indicated (in vertical type). FII indicates an oligonucleotide of the chicken beta-globin insulator CTCF binding site, which also efficiently competes for the complexes formed on both 3' and 5' CTCF-like sites. Probe lane indicates labeled probe incubated without nuclear extract. The position of the unbound "free probe" is indicated with a bracket.

 
A reporter transgene model for assessing the function of TCR{alpha} LCR subelements

Much of our understanding of the components of TCR{alpha} LCR function has come from analyses of reporter transgene loci in mice. The present study was conducted using a 4.9-kb human beta-globin reporter gene fragment linked to either the wild-type TCR{alpha} LCR (a construct named beta:1-6) or internal deletion mutants thereof (Fig. 2B). The beta-globin reporter fragment contains the human beta-globin promoter, exons, introns, and 3' enhancer sequence. It is highly subject to position-effect silencing in the absence of additional elements (30, 31) and has long been used as a reporter of LCR activity in multiple systems (11, 32, 33, 34). Including an intact LCR in the transgene eliminates these position effects. Linking the beta-globin reporter gene to HS1-6 of the TCR{alpha} LCR yields the high-level, lymphoid organ-specific and relatively consistent reporter expression levels per copy (within a narrow 2- to 3-fold range) indicative of integration-site independence and full TCR{alpha} LCR activity in vivo (15).


Figure 2
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 2. A, Diagram (not drawn to scale) of the 3' end of the TCR{alpha}/Dad1 genomic locus. The nine DNase I HS of the LCR are indicated as vertical arrows. Horizontal arrows indicate the transcriptional orientation of the TCR{alpha} and Dad1 genes. Gray boxes indicate the exon sequences of the TCR{alpha} constant region (C{alpha}). Stippled box represents the third exon of the Dad1 gene. E{alpha} indicates the TCR{alpha} classic transcriptional enhancer in HS1. Hatched area indicates the minimal required DNA sequences for full LCR activity (HS1-6). B, Transgene constructs used in this study. Human beta-globin reporter gene fragment is linked 5' of the indicated HS of the LCR. The filled boxes indicate the region within the LCR that is deleted in each mutant transgene.

 
As mentioned earlier, our previous analyses led us to focus on elements within the three prominent HS (HS1', HS4, and HS6) in the insulator-like/position-effect suppressing region of the LCR downstream of E{alpha} (Fig. 2A) (15, 24, 25). We created three different LCR internal deletion mutants to assess the contribution of the deleted sequences to LCR activity (Fig. 2B). These mutant LCRs are missing either the region of HS1' containing the tandem CTCF-like binding sites identified above, the region of HS4 containing the target of tissue- and site-specific DNA demethylation (27) or the HS6-316 position-effect suppressing region previously described in cell culture (26). Each of these mutant LCRs was linked separately to the human beta-globin fragment to create the transgenes named beta:1-6{Delta}CTCF, beta:1-6{Delta}HS4, and beta:1-6{Delta}HS6-316, respectively. Multiple transgenic lines bearing these constructs were generated. The activity of these mutant LCR-driven transgenes was compared with that of the wild-type beta:1-6 construct using a new set of beta:1-6-transgenic lines. In all, 20 new, independent transgenic mouse lines are analyzed here.

Inconsistent tissue distribution of mutant TCR{alpha} LCR-driven transgene expression

Reporter gene expression levels under the control of the TCR{alpha} LCR are consistently highest in the thymus, next highest in the spleen and very low (<10% of thymic expression) in nonlymphoid organs (9, 12, 15). The six new independent beta:1-6-transgenic lines analyzed here consistently displayed this expression pattern with very little variation (Fig. 3A). We previously observed that mutant TCR{alpha} LCR-driven beta-globin transgenes (26), as well as non-LCR-containing beta-globin reporter transgenes (Ref. 28 and B. D. Oritz, unpublished observations), do not consistently maintain this tissue distribution. This is likely due to the effects of interference by native regulatory sequences at the varying sites of transgene integration. Therefore, we interpret significant deviation from the wild-type expression pattern (Fig. 3A) as indicative of position effects and, thus, impaired LCR activity. The effect of deleting the CTCF sites from the LCR on the normal transgene expression pattern was minor with mRNA levels only barely crossing the 10% "threshold" (relative to thymic mRNA levels) in lung and heart (Fig. 3B). Tissue distribution of transgene expression was somewhat more perturbed in the absence of the 316-bp region of HS6 with average relative expression levels in some nonlymphoid organs exceeding 20% of that seen in thymus (Fig. 3C). However, the relative tissue distribution of multiple lines bearing the beta:1-6{Delta}HS4 mutant transgene was plainly abnormal, leading to large variations in organ expression levels relative to thymus among the four lines analyzed (Fig. 3D). These data indicate that the {Delta}HS6-316 and {Delta}HS4 mutant LCRs are less able to protect the transgene from position effects.


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 3. Line-to-line consistency in relative tissue distribution of transgene expression from wild-type and mutant LCR-driven constructs. A, PhosphorImager analyses of Northern blots of organ RNA from six independent transgenic lines bearing the beta:1-6 (wild-type LCR-driven) reporter construct The inset is a representative Northern blot on beta:1-6 line 42 showing the reporter beta-globin signal and 18S rRNA signal used as a normalizing control. The graph represents the average relative tissue distribution of normalized transgene expression in the indicated organs (T, thymus; S, spleen; K, kidney; Lg, lung; Li, liver; H, heart) among the various lines. Within each line examined, thymic transgene expression was designated as 100%. Reporter expression from other organs within the same line was plotted as a percentage of thymic expression. Error bars, The SD in the percent thymic expression levels for each organ among the six beta:1-6-transgenic lines. Note the low variation in percentage of thymic expression from line-to-line and that nonlymphoid expression is well below the 10% of maximum level marked by the horizontal bar. B, Similar analyses of four independent lines of transgenic mice bearing the beta:1-6{Delta}CTCF construct with the Northern blot from beta:1-6{Delta}CTCF line 16 shown in the inset. C, Similar analyses of six independent transgenic lines bearing the beta:1-6{Delta}HS6-316 construct with the Northern blot from beta:1-6{Delta}HS6-316 line 20 shown in the inset. D, Similar analyses of four independent transgenic lines bearing the beta:1-6{Delta}HS4 construct with the Northern blot from beta:1-6{Delta}HS4 line 40 shown in the inset. Note the greater variation in relative tissue distribution of transgene expression seen in C and D as compared with A and B.

 
Minor reduction in LCR-driven transgene expression levels upon tandem CTCF-like site deletion

Because LCRs confer copy number-related expression upon a linked transgene, we examined whether transgene expression levels were altered when driven by the various mutant LCRs. Using Northern blots and PhosphorImager analyses, we compared the expression levels (per transgene copy) of the wild-type beta:1-6 and mutant beta:1-6{Delta}CTCF transgenes in lymphoid tissues. Detected beta-globin mRNA levels were normalized to those of endogenous TCR{alpha} in thymus. The products were then divided by the relative copy number estimates among the various lines. A representative Northern blot is shown in Fig. 4A and quantified expression levels per copy are shown in Fig. 4B. The data show that the average transgene expression levels per copy from the {Delta}CTCF mutant construct are slightly reduced from the average of wild-type beta:1-6 transgene expression levels, with 77% of wild-type expression in thymus. Coupled with the data in Fig. 3B, it appears that the tandem CTCF sites are minor contributors, at best, to the TCR{alpha} LCR’s activity in this system.


Figure 4
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 4. Transgene expression levels per copy are only slightly lowered upon internal deletion of the CTCF site region. A, Representative Northern blot analyses of reporter transgene expression in thymus of multiple lines of mice bearing either the wild-type (beta:1-6) or CTCF site region deleted (beta:1-6{Delta}CTCF) LCR-driven reporter constructs. The relative copy numbers from left to right are: 16, 4, 7, 9, 10, 3, 12, 4, 10, 11. B, PhosphorImager analyses of Northern blot plotted as normalized transgene expression per copy. TCR{alpha} mRNA was used as a normalizing control for thymus samples. The gray diamonds indicate the expression level per copy in each individual line. The horizontal dash indicates the average of the expression levels per copy of all transgenic lines bearing the same construct, as indicated.

 
The {Delta}HS4 and {Delta}HS6-316 mutations impair TCR{alpha} LCR activity

As mentioned previously, the region of HS4 and a 316-bp region within HS6 were identified as candidate participants in TCR{alpha} LCR function, and Fig. 3, C and D, suggest that these sequences may be necessary for the LCR to fully protect transgenes from position effects. Using the same methods described for Fig. 4, we quantified the contribution of the HS4 and HS6-316 elements to TCR{alpha} LCR-driven transgene expression in thymus. We compared transgene mRNA levels (per copy) produced by the beta:1-6{Delta}HS4 and beta:1-6{Delta}HS6-316 transgenes to those of the wild-type LCR-driven beta:1-6 construct. In the representative experiment shown in Fig. 5, average transgene mRNA levels per copy are reduced over 4-fold from wild-type levels when HS4 DNA is absent from the LCR. Similarly, average expression levels of the {Delta}HS6-316 mutant are 3.3-fold lower per transgene copy, compared with that driven by the wild-type LCR. Along with the results in Fig. 3, C and D, these data help confirm that the HS4 and HS6-316 regions of the TCR{alpha} LCR harbor in vivo functional elements.


Figure 5
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 5. Transgene expression levels per copy are significantly reduced upon internal deletion of either the HS4 or HS6-316 regions. A, Representative Northern blot analyses of reporter transgene expression in thymus of multiple lines of mice bearing either the wild-type (beta:1-6), HS4 deleted (beta:1-6{Delta}HS4), or HS6-316-deleted (beta:1-6{Delta}HS6-316) LCR-driven reporter constructs. In this blot, the relative copy numbers from left to right are: 16, 4, 7, 9, 10, 3, 1, 1, 5, 14, 9, 38, 5, 6, 17, 6. B, PhosphorImager analyses of Northern blots plotted as normalized transgene expression per copy. TCR{alpha} mRNA was used as a normalizing control for thymus samples. The gray diamonds indicate the expression level per copy of the indicated organ in each individual line. The horizontal dash indicates the average of the expression levels per copy of all transgenic lines bearing the same construct, as indicated.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Identifying the cis-acting gene regulatory elements of the complex TCR{alpha}/TCR{delta}/Dad1 gene locus that are active in vivo is an important endeavor. Among other things, these elements collectively help achieve the carefully orchestrated gene rearrangements that ensure generation of both {alpha}beta and {gamma}{delta} T cells with a wide repertoire of TCR specificities. In addition, it is important to understand the regulation, and possible coordination, of TCR{alpha} and Dad1 gene expression. TCR{alpha} gene assembly and expression are the final step before thymic selection processes that entail sorting through the randomly generated TCR repertoire. These processes promote further development of desirable T cells bearing TCR specificities that are able to use self-MHC without being overly self-reactive (35). Those T cells bearing TCR specificities that do not meet these criteria die by apoptosis. In this light, the evolutionarily conserved linkage of the TCR{alpha} gene to the antiapoptosis gene Dad1 is particularly intriguing. The expression patterns of these two genes are different from each other, both in terms of tissue distribution and developmental timing (6, 8). The TCR{alpha} LCR is flanked by the TCR{alpha} gene on its 5' end and the Dad1 gene on its 3' end. The roughly ~6-kb of LCR DNA in between the HS1/E{alpha} element and the most proximal end of the Dad1 locus is critical for LCR activity. It would also be expected to play an important role in coordinating and/or separating the regulation of the TCR{alpha} and Dad1 genes during thymocyte development (as well as throughout the embryo), perhaps in a manner analogous to insulator elements.

Although a connection between LCR activity and insulator elements has been proposed (17), in vivo data directly linking the two are sparse. With the rare exception of imprinted gene loci (36), the activity of the various types of insulators is typically studied in cell culture models. Although these models have provided invaluable data on insulator mechanisms, they are not optimal for the study of LCR activity (37). The TCR{alpha} LCR we study has both CTCF-dependent and CTCF-independent enhancer-blocking activities in its position-effect suppressing region (24, 25). Therefore, our experimental model provided a rare opportunity to further characterize these various types of insulator elements (and their roles in LCR activity and gene regulation in vivo) using an integration-site independent, LCR-driven reporter transgene system. We have determined that the CTCF-binding region of the TCR{alpha} LCR is largely dispensable for LCR activity. In contrast, we found that the CTCF-independent enhancer-blocking region of the LCR contains two additional elements that are major contributors to the LCR’s function. These may be insulator-like elements. Alternatively, these could represent positive regulators of gene expression in chromatin distinct from classical transcriptional enhancers.

Seemingly conflicting data have been reported regarding the role of CTCF and its cognate binding site in position-effect suppression in chromatin. Work on the chicken beta-globin insulator has produced clear evidence that its barrier capacity is independent of its CTCF binding sequences (38, 39). However, reports using other experimental systems have asserted that CTCF can block the spreading of repressive chromatin (40), regulate the balance between activating and silencing histone modifications (41), and protect from position effects (42). We found that a deletion of the tandem CTCF-like binding sites of the TCR{alpha} LCR did not have a significant impact on its position-effect suppressing activity in vivo. These data indicate that the enhancer-blocking activity demonstrated for this CTCF-binding region does not meaningfully contribute to overcoming heterochromatin-induced position effects in our system. Overcoming these effects is a hallmark of LCR activity at ectopically integrated transgene loci (43, 44). Nonetheless, the enhancer-blocking data reported previously (25) suggest that these sites do bear some activity. It is possible that the CTCF sites act as an enhancer blocker that is only active elsewhere in the embryo and/or in restricted situations arising during thymocyte development that would not be detected in analyses of bulk thymocytes.

The unchecked spreading of condensed chromatin is one likely cause of the position-effect gene silencing often observed from randomly integrated transgenes in mice (13, 43, 44). TCR{alpha} LCR activity prevents these effects. We find that the HS4 and HS6-316 regions of the LCR are required for complete LCR activity in vivo and may well be two examples of CTCF-independent barrier-type insulator elements. Although we do not formally test these elements as self-contained barrier insulators here, these elements do share some important characteristics with known barrier insulators. For example, in T cells, the endogenous HS4 region DNA shows a higher level of histone acetylation than its neighboring sequences (25), a trait of the chicken beta-globin insulator (45, 46). Also, the HS6-316 region protects stable-transfected reporter constructs from silencing in chromatin (26), the hallmark property of barrier insulators (47). The discovery of multiple functional elements in the position-effect suppressing region of the TCR{alpha} LCR provides evidence in support of a proposed model of barrier insulator activity (17), where barrier function depends on the local balance between negative and positive regulatory activity in chromatin. In this model, the three functional elements in the 3' end of the TCR{alpha} LCR described to date (Ref. 26 and the present study) would synergize to create a strong positive regulatory influence to prevent position-effect silencing. We have shown that removal of any one of these elements reduces the strength of LCR activity (Fig. 6). This model may also help explain the cell-type specificity of TCR{alpha} LCR activity. In nonlymphoid tissue, HS4 region DNA is selectively and heavily methylated (27) and the TF123 region of HS6, described previously (26), is not occupied in vivo by the factors that do bind it in T cells (28). According to the above barrier model, inactivation of HS4 and TF123 elements in this way could render the LCR too weak to fully protect from position effects in nonlymphoid organs.


Figure 6
View larger version (9K):
[in this window]
[in a new window]

 
FIGURE 6. Summary of data from multiple experiments showing the effect of internal deletion of the indicated DNA sequences on TCR{alpha}-driven expression levels (per copy) in lymphoid organs (thymus and spleen). Deleted sequences are represented by dark boxes and labeled with arrows. The average percentage of wild-type LCR-driven expression (±SE) observed in the indicated mutant is shown. Underneath, n represents the number of mutant LCR-driven expression data points used to calculate the average. The effect of the {Delta}TF123 deletion was previously reported (26 28 ) and is presented here as well to show all of the active regions downstream of E{alpha}/HS1 identified to date.

 
Our data are also consistent with a model in which the HS4 and HS6-316 elements are not insulators, per se, but rather are positive regulators of gene expression in chromatin. However, in this model, the mechanism of action of these elements would be distinct from those used by classic transcriptional enhancers. The HS4 and HS6-316 regions are devoid of such classic enhancer activity (14). Another reason to consider this alternative hypothesis is that insulator elements have typically been found in between genes that are not destined to be coexpressed. There are stages of T cell development where both of these genes become coexpressed (6). Therefore, the TCR{alpha}/Dad1 gene locus would present an interesting challenge to an insulator element.

In either model (insulator vs positive regulator), these elements may play a role in coordinating the expression of the TCR{alpha} and Dad1 genes, which display differing kinetics during thymocyte development. TCR{alpha} gene rearrangement and transcription begin at the CD4CD8CD25CD44 (DN4) stage of thymocyte development (48, 49). In contrast, high levels of Dad1 expression are not seen until the later, single positive stage (6). Therefore, it is likely that a strong separation of the TCR{alpha} and Dad1 gene regulatory influences would be warranted at early thymocyte stages. However, at later stages, it might be desirable to selectively reduce that regulatory separation so that Dad1 and TCR{alpha} genes may be coordinately up-regulated in T cells that have successfully survived thymic selection. In principle, having multiple cooperating elements working collectively in the TCR{alpha}/Dad1 intergenic region would make it possible to dynamically modulate this region’s regulatory activity via selective inactivation of its component elements. Having localized and confirmed the function of these TCR{alpha} LCR subelements, these hypotheses, along with the important question of what gene regulatory "machinery" these elements interact with, can now be explored.


    Acknowledgments
 
We thank G. Felsenfeld, D. Brazill, A. Alaie, and D. Loayza for critical reading of this manuscript and A. Kloc, R. Arroyave, M. Kucerova-Levisohn, K. Erhard, S. Kivlehan, and J. Oppermann for technical assistance. We gratefully acknowledge the invaluable advice and assistance of D. Sant’Angelo, W. Mark, and the Sloan-Kettering transgenics facility for the generation of transgenic mice.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Science Foundation Career Award MCB-0236964 and National Institutes of Health (NIH) Grant AI-053050 (to B.D.O.). J.G.K. and J.A. were supported by Research Centers in Minority Institutions Award RR-03037 from the National Center for Research Resources of the NIH that also provides support of the infrastructure and instrumentation in the Department of Biological Sciences at Hunter College. F.H. was a Fellow of the Research Initiative for Scientific Enhancement Program (Grant GM-060665) of the NIH and a Ford Foundation Dissertation Fellow. Back

2 Current address: National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892. Back

3 Current address: Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, MD 21205. Back

4 Address correspondence and reprint requests to Dr. Benjamin D. Ortiz, Department of Biological Sciences, City University of New York, Hunter College, 695 Park Avenue, Room 927N, New York, NY 10021. E-mail address: ortiz{at}genectr.hunter.cuny.edu Back

5 Abbreviations used in this paper: LCR, locus control region; HS, hypersensitive site. Back

Received for publication February 23, 2007. Accepted for publication May 3, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Wang, K., L. Gan, C. L. Kuo, L. Hood. 1997. A highly conserved apoptotic suppressor gene is located near the chicken T-cell receptor {alpha} chain constant region. Immunogenetics 46: 376-382. [Medline]
  2. Nakashima, T., T. Sekiguchi, A. Kuraoka, K. Fukushima, Y. Shibata, S. Komiyama, T. Nishimoto. 1993. Molecular cloning of a human cDNA encoding a novel protein, DAD1, whose defect causes apoptotic cell death in hamster BHK21 cells. Mol. Cell. Biol. 13: 6367-6374. [Abstract/Free Full Text]
  3. Makishima, T., T. Nakashima, K. Nagata-Kuno, K. Fukushima, H. Iida, M. Sakaguchi, Y. Ikehara, S. Komiyama, T. Nishimoto. 1997. The highly conserved DAD1 protein involved in apoptosis is required for N-linked glycosylation. Genes Cells 2: 129-141. [Abstract]
  4. Brewster, J. L., S. L. Martin, J. Toms, D. Goss, K. Wang, K. Zachrone, A. Davis, G. Carlson, L. Hood, J. D. Coffin. 2000. Deletion of Dad1 in mice induces an apoptosis-associated embryonic death. Genesis 26: 271-278. [Medline]
  5. Hong, N. A., M. Flannery, S. N. Hsieh, D. Cado, R. Pedersen, A. Winoto. 2000. Mice lacking Dad1, the defender against apoptotic death-1, express abnormal N-linked glycoproteins and undergo increased embryonic apoptosis. Dev. Biol. 220: 76-84. [Medline]
  6. Hong, N. A., N. H. Kabra, S. N. Hsieh, D. Cado, A. Winoto. 1999. In vivo overexpression of Dad1, the defender against apoptotic death-1, enhances T cell proliferation but does not protect against apoptosis. J. Immunol. 163: 1888-1893. [Abstract/Free Full Text]
  7. Krangel, M. S., J. Carabana, I. Abbarategui, R. Schlimgen, A. Hawwari. 2004. Enforcing order within a complex locus: current perspectives on the control of V(D)J recombination at the murine T-cell receptor {alpha}/{delta} locus. Immunol. Rev. 200: 224-232. [Medline]
  8. Hong, N. A., D. Cado, J. Mitchell, B. D. Ortiz, S. N. Hsieh, A. Winoto. 1997. A targeted mutation at the T-cell receptor {alpha}/{delta} locus impairs T-cell development and reveals the presence of the nearby antiapoptosis gene Dad1. Mol. Cell. Biol. 17: 2151-2157. [Abstract]
  9. Diaz, P., D. Cado, A. Winoto. 1994. A locus control region in the T cell receptor {alpha}/{delta} locus. Immunity 1: 207-217. [Medline]
  10. Li, Q., K. R. Peterson, X. Fang, G. Stamatoyannopoulos. 2002. Locus control regions. Blood 100: 3077-3086. [Abstract/Free Full Text]
  11. Ortiz, B. D., D. Cado, V. Chen, P. W. Diaz, A. Winoto. 1997. Adjacent DNA elements dominantly restrict the ubiquitous activity of a novel chromatin-opening region to specific tissues. EMBO J. 16: 5037-5045. [Medline]
  12. Harrow, F., B. D. Ortiz. 2005. The TCR{alpha} locus control region specifies thymic, but not peripheral, patterns of TCR{alpha} gene expression. J. Immunol. 175: 6659-6667. [Abstract/Free Full Text]
  13. Palmiter, R. D., R. L. Brinster. 1986. Germ-line transformation of mice. Annu. Rev. Genet. 20: 465-499. [Medline]
  14. Winoto, A., D. Baltimore. 1989. A novel, inducible and T cell-specific enhancer located at the 3' end of the T cell receptor {alpha} locus. EMBO J. 8: 729-733. [Medline]
  15. Ortiz, B. D., D. Cado, A. Winoto. 1999. A new element within the T-cell receptor {alpha} locus required for tissue-specific locus control region activity. Mol. Cell. Biol. 19: 1901-1909. [Abstract/Free Full Text]
  16. Bassing, C. H., R. E. Tillman, B. B. Woodman, D. Canty, R. J. Monroe, B. P. Sleckman, F. W. Alt. 2003. T cell receptor (TCR) {alpha}/{delta} locus enhancer identity and position are critical for the assembly of TCR {delta} and {alpha} variable region genes. Proc. Natl. Acad. Sci. USA 100: 2598-2603. [Abstract/Free Full Text]
  17. Gaszner, M., G. Felsenfeld. 2006. Insulators: exploiting transcriptional and epigenetic mechanisms. Nat. Rev. Genet. 7: 703-713. [Medline]
  18. Bell, A. C., A. G. West, G. Felsenfeld. 1999. The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98: 387-396. [Medline]
  19. Ohlsson, R., R. Renkawitz, V. Lobanenkov. 2001. CTCF is a uniquely versatile transcription regulator linked to epigenetics and disease. Trends Genet. 17: 520-527. [Medline]
  20. Qi, C. F., A. Martensson, M. Mattioli, R. Dalla-Favera, V. V. Lobanenkov, H. C. Morse, III. 2003. CTCF functions as a critical regulator of cell-cycle arrest and death after ligation of the B cell receptor on immature B cells. Proc. Natl. Acad. Sci. USA 100: 633-638. [Abstract/Free Full Text]
  21. Gombert, W. M., S. D. Farris, E. D. Rubio, K. M. Morey-Rosler, W. H. Schubach, A. Krumm. 2003. The c-myc insulator element and matrix attachment regions define the c-myc chromosomal domain. Mol. Cell. Biol. 23: 9338-9348. [Abstract/Free Full Text]
  22. Garrett, F. E., A. V. Emelyanov, M. A. Sepulveda, P. Flanagan, S. Volpi, F. Li, D. Loukinov, L. A. Eckhardt, V. V. Lobanenkov, B. K. Birshtein. 2005. Chromatin architecture near a potential 3' end of the Igh locus involves modular regulation of histone modifications during B-cell development and in vivo occupancy at CTCF sites. Mol. Cell. Biol. 25: 1511-1525. [Abstract/Free Full Text]
  23. Zhong, X. P., M. S. Krangel. 1997. An enhancer-blocking element between {alpha} and {delta} gene segments within the human T cell receptor {alpha}/{delta} locus. Proc. Natl. Acad. Sci. USA 94: 5219-5224. [Abstract/Free Full Text]
  24. Zhong, X. P., M. S. Krangel. 1999. Enhancer-blocking activity within the DNase I hypersensitive site 2 to 6 region between the TCR{alpha} and Dad1 genes. J. Immunol. 163: 295-300. [Abstract/Free Full Text]
  25. Magdinier, F., T. M. Yusufzai, G. Felsenfeld. 2004. Both CTCF-dependent and -independent insulators are found between the mouse T cell receptor {alpha} and Dad1 genes. J. Biol. Chem. 279: 25381-25389. [Abstract/Free Full Text]
  26. Harrow, F., J. U. Amuta, S. R. Hutchinson, F. Akwaa, B. D. Ortiz. 2004. Factors binding a non-classical cis-element prevent heterochromatin effects on locus control region activity. J. Biol. Chem. 279: 17842-17849. [Abstract/Free Full Text]
  27. Santoso, B., B. D. Ortiz, A. Winoto. 2000. Control of organ-specific demethylation by an element of the T-cell receptor-{alpha} locus control region. J. Biol. Chem. 275: 1952-1958. [Abstract/Free Full Text]
  28. Ortiz, B. D., F. Harrow, D. Cado, B. Santoso, A. Winoto. 2001. Function and factor interactions of a locus control region element in the mouse T cell receptor-{alpha}/Dad1 gene locus. J. Immunol. 167: 3836-3845. [Abstract/Free Full Text]
  29. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159. [Medline]
  30. Magram, J., K. Chada, F. Costantini. 1985. Developmental regulation of a cloned adult beta-globin gene in transgenic mice. Nature 315: 338-340. [Medline]
  31. Townes, T. M., J. B. Lingrel, H. Y. Chen, R. L. Brinster, R. D. Palmiter. 1985. Erythroid-specific expression of human beta-globin genes in transgenic mice. EMBO J. 4: 1715-1723. [Medline]
  32. Grosveld, F., G. B. van Assendelft, D. R. Greaves, G. Kollias. 1987. Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51: 975-985. [Medline]
  33. Greaves, D. R., F. D. Wilson, G. Lang, D. Kioussis. 1989. Human CD2 3'-flanking sequences confer high-level, T cell-specific, position-independent gene expression in transgenic mice. Cell 56: 979-986. [Medline]
  34. Chauveau, C., E. A. Jansson, S. Muller, M. Cogne, S. Pettersson. 1999. Cutting edge: Ig heavy chain 3' HS1-4 directs correct spatial position-independent expression of a linked transgene to B lineage cells. J. Immunol. 163: 4637-4641. [Abstract/Free Full Text]
  35. Hogquist, K. A., T. A. Baldwin, S. C. Jameson. 2005. Central tolerance: learning self-control in the thymus. Nat. Rev. Immunol. 5: 772-782. [Medline]
  36. Lewis, A., A. Murrell. 2004. Genomic imprinting: CTCF protects the boundaries. Curr. Biol. 14: R284-R286. [Medline]
  37. Skarpidi, E., G. Vassilopoulos, G. Stamatoyannopoulos, Q. Li. 1998. Comparison of expression of human globin genes transferred into mouse erythroleukemia cells and in transgenic mice. Blood 92: 3416-3421. [Abstract/Free Full Text]
  38. Recillas-Targa, F., M. J. Pikaart, B. Burgess-Beusse, A. C. Bell, M. D. Litt, A. G. West, M. Gaszner, G. Felsenfeld. 2002. Position-effect protection and enhancer blocking by the chicken beta-globin insulator are separable activities. Proc. Natl. Acad. Sci. USA 99: 6883-6888. [Abstract/Free Full Text]
  39. West, A. G., S. Huang, M. Gaszner, M. D. Litt, G. Felsenfeld. 2004. Recruitment of histone modifications by USF proteins at a vertebrate barrier element. Mol. Cell 16: 453-463. [Medline]
  40. Defossez, P. A., E. Gilson. 2002. The vertebrate protein CTCF functions as an insulator in Saccharomyces cerevisiae. Nucleic Acids Res. 30: 5136-5141. [Abstract/Free Full Text]
  41. Splinter, E., H. Heath, J. Kooren, R. J. Palstra, P. Klous, F. Grosveld, N. Galjart, W. de Laat. 2006. CTCF mediates long-range chromatin looping and local histone modification in the beta-globin locus. Genes Dev. 20: 2349-2354. [Abstract/Free Full Text]
  42. Filippova, G. N., M. K. Cheng, J. M. Moore, J. P. Truong, Y. J. Hu, D. K. Nguyen, K. D. Tsuchiya, C. M. Disteche. 2005. Boundaries between chromosomal domains of X inactivation and escape bind CTCF and lack CpG methylation during early development. Dev. Cell 8: 31-42. [Medline]
  43. Festenstein, R., M. Tolaini, P. Corbella, C. Mamalaki, J. Parrington, M. Fox, A. Miliou, M. Jones, D. Kioussis. 1996. Locus control region function and heterochromatin-induced position effect variegation. Science 271: 1123-1125. [Abstract]
  44. Milot, E., J. Strouboulis, T. Trimborn, M. Wijgerde, E. de Boer, A. Langeveld, K. Tan-Un, W. Vergeer, N. Yannoutsos, F. Grosveld, P. Fraser. 1996. Heterochromatin effects on the frequency and duration of LCR-mediated gene transcription. Cell 87: 105-114. [Medline]
  45. Litt, M. D., M. Simpson, F. Recillas-Targa, M. N. Prioleau, G. Felsenfeld. 2001. Transitions in histone acetylation reveal boundaries of three separately regulated neighboring loci. EMBO J. 20: 2224-2235. [Medline]
  46. Mutskov, V. J., C. M. Farrell, P. A. Wade, A. P. Wolffe, G. Felsenfeld. 2002. The barrier function of an insulator couples high histone acetylation levels with specific protection of promoter DNA from methylation. Genes Dev. 16: 1540-1554. [Abstract/Free Full Text]
  47. Felsenfeld, G., B. Burgess-Beusse, C. Farrell, M. Gaszner, R. Ghirlando, S. Huang, C. Jin, M. Litt, F. Magdinier, V. Mutskov, et al 2004. Chromatin boundaries and chromatin domains. Cold Spring Harbor Symp. Quant. Biol. 69: 245-250. [Medline]
  48. Pearse, M., L. Wu, M. Egerton, A. Wilson, K. Shortman, R. Scollay. 1989. A murine early thymocyte developmental sequence is marked by transient expression of the interleukin 2 receptor. Proc. Natl. Acad. Sci. USA 86: 1614-1618. [Abstract/Free Full Text]
  49. Petrie, H. T., F. Livak, D. Burtrum, S. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production. J. Exp. Med. 182: 121-127. [Abstract/Free Full Text]
  50. Bell, A. C., G. Felsenfeld. 2000. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405: 482-485. [Medline]



This article has been cited by other articles:


Home page
Brief Funct Genomic ProteomicHome page
E. Molto, A. Fernandez, and L. Montoliu
Boundaries in vertebrate genomes: different solutions to adequately insulate gene expression domains
Brief Funct Genomic Proteomic, July 1, 2009; 8(4): 283 - 296.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Ribeiro de Almeida, H. Heath, S. Krpic, G. M. Dingjan, J. P. van Hamburg, I. Bergen, S. van de Nobelen, F. Sleutels, F. Grosveld, N. Galjart, et al.
Critical Role for the Transcription Regulator CCCTC-Binding Factor in the Control of Th2 Cytokine Expression
J. Immunol., January 15, 2009; 182(2): 999 - 1010.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gomos-Klein, J.
Right arrow Articles by Ortiz, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gomos-Klein, J.
Right arrow Articles by Ortiz, B. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS