|
|
||||||||





* Robert M. Berne Cardiovascular Research Center,
Departments of Biomedical Engineering and Molecular Physiology and Biological Physics, and
Office for the Vice President for Research and Graduate Studies, University of Virginia, Charlottesville, VA 22908;
Department of Anesthesiology and Critical Care Medicine, University of Muenster, Muenster, Germany; and
¶ Division of Inflammation Biology, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037.
division of Inflammation Biology, La Jolla Institute for Allergy and Immnology, La Jolla, CA 92037
| Abstract |
|---|
|
|
|---|

TCR. This homeostatic system is disrupted in mice lacking adhesion molecules like β2-integrins (Itgb2–/–) which have defective neutrophil trafficking and neutrophilia. To test the role of IL-23 in the homeostatic regulation of circulating neutrophil numbers, we measured blood neutrophil numbers in p40-deficient (IL12b–/–) mice and found them reduced compared with wild-type mice. IL12b–/–Itgb2–/– mice, lacking β2-integrins, IL-12, and IL-23 showed significantly blunted neutrophilia compared with Itgb2–/– mice. Treatment of both IL12b–/– and IL12b–/–Itgb2–/– mice with IL-23, but not IL-12, restored circulating neutrophil counts. Serum levels of IL-17A were readily detectable in Itgb2–/– mice, but not in IL12b–/–Itgb2–/– mice, suggesting that IL-17A production is reduced when IL-23 is absent. Similarly, tissue mRNA expression of IL-17A was reduced in IL12b–/–Itgb2–/–mice compared with Itgb2–/– controls. The total number of CD3+ IL-17A-producing Tn cells were significantly reduced in the spleen and lamina propria of IL12b–/–Itgb2–/– mice, with the largest reduction found in 
+ T cells. Our results suggest a prominent role of IL-23 in the regulation of granulopoiesis and the prevalence of IL-17A-producing Tn cells. | Introduction |
|---|
|
|
|---|
-driven through the production of IL-12 by activated macrophages (9, 10). IL-12 and IL-23 are heterodimers (p40p35 and p40p19, respectively) secreted by macrophages and dendritic cells (11). Studies using either p40-deficient (IL12b–/–) mice or p40-blocking Abs disrupt the activities of both cytokines simultaneously, but this was not always recognized (12, 13). In the case of EAE, only since the generation of p35- and p19-deficient mice has the pathogenic role of IL-23 and not IL-12 become evident (1). This was further confirmed by anti-IL-23 therapy, which has been shown to ameliorate EAE, whereas anti-IL-12 Abs exacerbate the disease (1, 14, 15, 16). In inflammatory bowel disease, a genome-wide association study found a significant association between IL-23 receptor (IL-23R) polymorphisms and Crohns disease (17). Therefore, IL-23 and/or its receptor are now attractive targets for the treatment of autoimmune diseases.
IL-23 mediates its proinflammatory effects through the activation of effector memory T cells that secrete IL-17A (18). There are three types of IL-17A-secreting T cells found in normal wild-type (WT) mice; 
+ T cells are the most abundant, followed by CD4+CD8–
βhigh T cells (also termed Th17 cells) and the least abundant CD4–CD8–
βlow T cells, the role of which remains ill-defined (19, 20). IL-17A-producing 
+ T cells have been implicated in host response to Mycobacterium tuberculosis and M. bovis infections, with the V
1+ T cell subset playing an important role in protection against Escherichia coli infections (21, 22, 23). Stimulation of purified 
+ T cells with IL-23 alone but not IL-6 or TGF-β enhances the production of IL-17A, and Ab blockade of IL-23 (p19) or the p40 subunit reduces IL-17A release in vitro in response to a variety of proinflammatory stimuli (21, 22, 23).
Th17 cells are distinct from Thl and Th2 cells (24, 25). Naive CD4+ T cells only polarize into Th17 cells if Th1 (INF-
and IL-12) and Th2 (IL-4) cytokines or transcription factors T-Bet and GATA-3 are blocked or removed, and if IL-6, IL-21 and TGF-β are present (24, 25, 26, 27, 28, 29, 30, 31, 32). The role of IL-23 in the activation and maintenance of IL-17A-expressing T cells remains controversial. Naïve CD4+ T cells do not express IL-23R receptor and consequently, IL-23 does not have any effects on their differentiation or IL-17A production (26, 27, 29). We and others have shown that exogenously applied IL-23, but not IL-12, can increase the expression and production of IL-17A from effector T cells (18, 19). Recently, a more complex role for IL-23 in vivo was demonstrated, with IL-6 and IL-21 up-regulating IL-23R expression on naive CD4+ T cells, and IL-23, in combination with TGF-β, inducing the differentiation of Th17 cells (30, 31, 32). Upon activation, Th17 cells release the cytokines IL-17A, IL-17F, IL-22, TNF-
and IL-6, all of which can induce inflammatory responses (33, 34).
The IL-23/IL-17 axis regulates granulopoiesis via a neutrostat regulatory feedback loop (19, 20). Transgenic overexpression of IL-17A in murine livers elevates neutrophil counts, bone marrow (BM) and splenic colony forming units and the release of granlocyte-colony stimulating factor (G-CSF) from BM stromal cells (35, 36). In normal WT and neutrophilic mice, a positive correlation is found between neutrophil numbers and serum levels of IL-17A and G-CSF (37).
CD18 is the common β2 subunit of the four β2 integrins: CD11a/CD18 (LFA-1), CD11b/CD18 (Mac-1), CD11c/CD18, and CD11d/CD18. Mice with a targeted null mutation in the Itgb2 gene lack all β2 integrins and are neutrophilic, due to the inability of neutrophils to traffic into nonlymphoid tissues and altered hematopoiesis (19, 38). This was demonstrated by the transfer of WT neutrophils into Itgb2–/– mice, which lowered neutrophil counts to normal WT levels and reduced serum IL-17A levels and tissue expression of IL-23, but not IL-12 (19, 37). Phagocytosis of apoptotic neutrophils by Itgb2–/– macrophages or dendritic cells reduced IL-23 expression in these cells in vitro, thus closing the feedback loop (19).
To test the role of IL-23 upstream of IL-17A in the regulation of granulopoiesis in vivo, we generated IL12b–/–Itgb2–/– mice as a tool to determine the effects of IL-23 on granulopoiesis and IL-17A expression and secretion, and the prevalence of IL-17A -producing Tn cells in vivo. We found that IL-23 deficiency profoundly affects IL-17A expression and secretion, and thereby granulopoiesis in mice.
| Materials and Methods |
|---|
|
|
|---|
Mice lacking CD18 integrin (Itgb2–/–) (38) or p40 (IL12b–/–) (39) and WT C57BL/6 mice (The Jackson Laboratory) were used between 8 and 16 wk of age and kept in specific pathogen-free conditions in a barrier facility. Mice deficient in both CD18 and p40 were generated by breeding Itgb2+/– with IL12b–/– mice, and all mice were on a C57BL/6 background at least for ten generations. All animal experiments were approved by the Institutional Animal Care and Use Committee at the University of Virginia. For Ab blockade of p40 (30517; R&D Systems), 100 µg of Ab or rat IgG1 isotype control (R&D Systems) per mouse was injected i.v. into WT mice and blood neutrophil counts assessed after 48 h. Some p40-deficient mice were injected with 2 µg of recombinant mouse (rm) IL-12, rmIL-23 (both R&D Systems) or saline as a control and blood neutrophil counts were assessed after 24 and 48 h via tail bleed into EDTA coated capillary tubes. Blood samples were then analyzed by automatic analyzer (Hemavet 850, CDC Technologies) and confirmed by Kimura-stained manual counts using a hemocytometer.
Recombinant proteins and Abs
The following mAbs (all reagents from BD Pharmingen, unless otherwise indicated) were used: Purified or Allophycocyanin-conjugated anti-CD3
(145-2C11), allophycocyanin CY7 or PerCP-conjugated anti-CD4 (RM4–5), anti-CD16/CD32 (2.4G2; The Lymphocyte Culture Center, University of Virginia), purified anti-CD28 (37.51), FITC or allophycocyanin conjugated anti-TCR β-chain (H57–597), FITC or biotin-conjugated anti-
TCR (GL3), PE-conjugated anti-IL-17A (TC11–18H10.1), and PerCP-conjugated streptavidin was used for the detection of the biotin-conjugated primary Ab.
Flow cytometry
Animals were anesthetized with an i.p. injection of a mixture containing ketamine hydrochloride (Sanofi Winthrop Pharmaceuticals, 125 mg/kg), xylazine (TranquiVed, Phoenix Scientific, 12.5 mg/kg), and atropine sulfate (Fujisawa USA, 0.025 mg/kg) then euthanized by cervical dislocation. Single cell suspensions of the spleen, mesenteric lymph node (MLN) and Peyers patches were obtained by straining tissues through a 70-µm screen (BD Falcon). RBC were lysed and white blood cells washed twice with PBS-FBS. Lamina propria (LP) lymphocytes were prepared as previously described (40). Where indicated, cells were cultured in RPMI 1640 containing 10% FBS, 1x nonessential amino acids (Invitrogen Life Technologies), 10 mM HEPES, 2 mM L-glutamine (Invitrogen Life Technologies), 1 mM sodium pyruvate (Invitrogen Life Technologies), and 1% penicillin/streptomycin for 5 h with 10 ng/ml PMA (Sigma-Aldrich), 500 ng/ml calcium ionophore (Sigma-Aldrich), and GolgiStop (BD Pharmingen).
Following stimulation, cells were resuspended at 107/ml. Fc
II/III receptors were blocked with 0.5 µg anti-CD16/CD32 and the cell suspension was incubated with an optimal concentration of mAbs for 20 min at 4°C in staining buffer (5% FBS in PBS) and washed. When biotinylated mAbs were used, streptavidin-PerCP was added for 20 min at 4°C, and cells washed twice in staining buffer. Intracellular staining was performed using Fix & Perm cell permeabilization reagents (Caltag Laboratories) according to the manufacturers instructions. Flow cytometry analysis was performed on a Becton Dickinson FACSCalibur dual laser and data were analyzed using FlowJo software (Tree Star). Gates were set by isotype controls.
Cytokine quantification
IL-17A, CXCL1, and G-CSF protein in serum or cell culture supernatants were measured by DuoSet ELISA kits (R&D Systems) according to the manufacturers directions. CCL2, IL-6, and IL-12 were measured using BD cytometric bead array, mouse inflammation kit (BD Biosciences) according to the manufacturers instructions. Experimentally determined detection limits were calculated by adding two SDs to the mean OD value of replicate blanks.
mRNA quantification
RNA was extracted from tissue following homogenization in TRIzol (Invitrogen Life Technologies), according to the manufacturers instructions. Reverse transcription and PCR steps were performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen) as previously described (19). IL-17A primer sequences were as follows: sense: ATCCCTCAAAGCTCAGCGTGTC and anti-sense: GGGTCTTCATTGCGGTGGAGAG. One microgram of total RNA was used for all tissues. Values were determined using the iCycler iQ Real-Time Detection System Software v3.0 (Qiagen). The corresponding values were normalized to 18s RNA and then normalized to individual WT mouse organs as the calibrator control (always equal to 1), thereby expressing the values as relative quantification values.
Statistical analysis
Data were expressed as mean ± SEM. Statistical significance between groups was set at p < 0.05 using a two-tailed paired or unpaired t test.
| Results |
|---|
|
|
|---|
To analyze the effects of IL-23 in vivo, we used mice lacking both IL-12 and IL-23 (IL12b–/–) and investigated circulating neutrophil numbers. p40-deficient mice had 60% lower neutrophil numbers (p < 0.05) compared to healthy WT mice (Fig. 1a). As previously described, Itgb2–/– mice have severely elevated neutrophil counts (38), IL-23 message, and IL-17A-producing Tn cells (19). When IL12b–/– mice were crossed with mice suffering from severe neutrophilia (Itgb2–/–) to create IL12b–/–Itgb2–/– mice, neutrophil numbers were significantly reduced compared to Itgb2–/– mice (p < 0.01) but still remained elevated compared WT mice (Fig. 1b). The IL12b–/–Itgb2–/– mice showed no additional pathology beyond the phenotype previously found in Itgb2–/– mice (data not shown) (38).
|
p40 subunit regulates circulating levels of IL-17A
One of the major downstream cytokines of IL-23 is IL-17A (19). In this study, we analyzed the effects of p40 deficiency on circulating IL-17A levels in normal (WT), neutropenic (IL12b–/–), and neutrophilic (Itgb2–/– and IL12b–/–Itgb2–/–) mice. IL-17A was not detectable by ELISA in the serum of WT mice, as previously reported (37), nor was it detectable in the serum of IL12b–/– mice. High levels of IL-17A were found in the serum of Itgb2–/– mice (37) however, IL-17A was not detectable in the serum of IL12b–/–Itgb2–/– mice (Fig. 2a). This suggests that p40 is involved in regulating circulating levels of IL-17A in neutrophilic mice.
|
IL-17A expression and the number of IL-17A-producing Tn cells are reduced in p40-deficient mice
To explore whether a deficiency in IL-23 could affect the basal expression of IL-17A in neutrophilic mice, IL-17A mRNA expression was assessed in various organs of IL12b–/–Itgb2–/– and Itgb2–/– mice. IL-17A expression was reduced in the MLN, spleen, and LP of IL12b–/–Itgb2–/– mice compared to Itgb2–/– mice (Fig. 3). The IL-17A message levels were roughly mirrored by the percentage of IL-17A-producing Tn cells which were reduced in the MLN, spleen, and LP of IL12b–/–Itgb2–/– mice compared to Itgb2–/– mice (Fig. 4, a and b). Culture of splenocytes on plate-absorbed anti-CD3, with soluble anti-CD28, with and without IL-23 for 3 days also demonstrated a significant reduction in the proportion of IL-17A-producing Tn cells from IL12b–/–Itgb2–/– mice compared to Itgb2–/– mice (data not shown). Analysis of the Tn cell subsets (
+, CD4–CD8–
βlow, and Th17) revealed that the number of IL-17A-producing 
+ Tn cells was significantly reduced in the MLN and spleen of IL12b–/–Itgb2–/– mice compared to the control (Fig. 4c). The proportion of CD3+ T cells that were Th17 cells or CD4–CD8–
βlow T cells were not significantly affected by the p40 deficiency (Fig. 4, d and e). This indicates that the expansion of IL-17A-producing 
+ cells in vivo is likely to depend on the presence of IL-23.
|
|
| Discussion |
|---|
|
|
|---|
Adhesion-molecule-deficient mice demonstrate a neutrophilic phenotype, with elevated serum levels of IL-17A and G-CSF (37). These mice also contain expanded populations of IL-17A-producing Tn cells (19, 20). The neutrophilia seen in these mice is not due to the passive accumulation of neutrophils in the vasculature, nor due to alterations in the marginating pool found in the lung, but is primarily caused by increased granulopoiesis (37, 41). A reduction in neutrophil apoptosis may also contribute to neutrophilia in Itgb2–/– mice (42). Previous studies have shown that IL-17A can act directly on BM stromal cells to produce G-CSF, up-regulate the cell surface expression of stem cell factor, as well as stimulate myeloid progenitor cell proliferation (36). Consistent with the IL-23-IL-17-G-CSF neutrophil-regulatory feedback loop (19), p40-deficient mice have a significant reduction in the number of hemopoietic progenitor cells in the bone marrow compared to WT mice (43). Mice lacking p40 also have reduced circulating neutrophil counts, which can be rescued by treatment with IL-23, but not IL-12. Taken together, these results indicate that IL-23 is a key regulator of granulopoiesis in mice.
In vitro studies have shown that IL-23 stimulates the production of IL-17A from memory CD4+ T cells but not naive CD4+ T cells (18). Initial reports describing the distinct lineage of Th17 cells showed that naive CD4+ T cells could expand and secrete higher quantities of IL-17A when treated with IL-23 in the presence of blocking Abs against INF-
and/or IL-4 (24, 25). However, Th17 cell polarization only occurred in the presence of IL-6 and TGF-β, and not in the presence of IL-23 (26, 27, 29). Furthermore, IL-23 did not induce the expression of ROR
t, which was the first described transcriptional regulator of Th17 cells (44). Some in vitro studies have shown that IL-23 can expand existing effector memory populations of Th17 cells following polarization (26, 27). However, Bettelli et al. (29), did not find an expansion of the polarized Th17 pool following treatment with exogenous IL-23, nor did they find a reduction using anti-p40 blocking Abs. Therefore, it appeared that naive Th17 cells must first be polarized into a precursor Th17 cell which express IL-23R, and then IL-23 may act on these cells to further expand and/or maintain the cell population. IL-6 treatment of naive CD4+ T cells can induce the expression of IL-23R, as can IL-21 (30, 31, 32). IL-6 can activate Stat3, which in turn activates ROR
t and IL-21R expression. At this stage, the cells can be differentiated into Th17 cells independently IL-6, through the combination of IL-21 or IL-23 and TGF-β (30, 31, 32).
In the aforementioned studies, the polarization of Th17 cells was performed in vitro, a situation that cannot recapitulate the complex in vivo environment of secondary lymphoid tissues. In this study, we report a reduction in the number of IL-17A-producing cells, and IL-17A expression at the message, protein, and cellular levels in p40-deficient mice. In contrast to the in vitro findings, we find that IL-23 does support the polarization, survival and activation of IL-17A-producing Tn cells in vivo. Because Th17 cells show little response to IL-23 (29) and show little change in IL12b–/– mice (see Fig. 4), it is likely that 
+ T cells are the main Tn cell subset that respond to IL-23. The p40 deficiency also caused a reduction in serum levels of both IL-6 and IL-17A. Thus, it is possible that IL-23 may regulate the polarization of Th17 cells indirectly by making IL-6 available. Indeed, IL-6 is an indispensable ingredient in the cytokine mixes that promote the commitment of T cells to the IL-17A-producing phenotype (26, 27, 29).
Because IL-23 primarily acts on memory T cells enhancing the secretion of IL-17A (18), it is not surprising that the secretion of IL-17A was not detectable in the sera of IL12b–/–Itgb2–/– mice. This is consistent with the reduction in the number of IL-17A-producing Tn cells in IL12b–/–Itgb2–/– mice by 60%. The p40 deficiency also reduced serum levels of IL-6, CCL2, and G-CSF. In collagen-induced arthritis models, p40- or p19-deficient mice have reduced IL-17A and IL-6 mRNA expression compared with WT mice (4). p19 blocking Abs also reduce the secretion of IL-6, IL-17A, CCL2, and CXCL1 in colon homogenates of inflammatory bowel disease models and IL-17A in the sera of EAE mouse models (16, 45). Conversely, in CNS and colitis autoimmune models, IL-23 treatment increases the mRNA expression of IL-17A, CCL2, and IL-6 in CD4+ T cells and the colon (3, 5).
IL-23 also plays a protective role in the host response to intracellular and extracellular bacterial and fungal infections through the regulation of proinflammatory cytokines and chemokines (46, 47, 48, 49). Taken together, these studies indicate that multiple cytokine pathways are influenced by IL-23, which regulate inflammatory processes as well as controlling the production and release of neutrophils into the systemic circulation. The reduction in serum levels of both IL-17A and G-CSF in IL12b–/–Itgb2–/– mice is consistent with the idea that IL-23 is the main upstream regulator of both of these proteins in vivo (19).
It is possible that polarization studies of Th17 cells in vitro do not faithfully replicate the in vivo situation, and as such, the role of IL-23 may have been underestimated. Most likely, 
+ T cells are the IL-17A-producers that respond most to IL-23. These cells have not been studied in vitro previously. The pathogenic role of IL-23 in autoimmune disease is well understood; however, the role of IL-23 in host response to infection by controlling granulopoiesis needs further definition. Our study shows a dominant role of IL-23 in the regulation of granulopoiesis and the prevalence of IL-17A-producing Tn cell subsets.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants HL73361 (to K.L.), T32 GM 08715-01A1 (to M.A.S.), and Deutsche Forschungsgemeinschaft AZ428/2-1 (to A.Z.). ![]()
2 Address correspondence and reprint requests to Dr. Emily Smith, Robert M. Berne Cardiovascular Research Center, University of Virginia, P.O. Box 801394, Charlottesville, VA 22908. E-mail address: es9cy{at}virginia.edu ![]()
3 Abbreviations used in this paper: EAE, experimental autoimmune encephalitis; WT, wild type; BM, bone marrow; rm, recombinant mouse; MLN, mesenteric lymph node; LP, lamina propria. Tn, neutrophil regulatory T cell; Th17, IL-17 producing cox + T cells; 16-23R, 16-23 receptor; G-CSF, granulocyte-colony stimulating factor. ![]()
Received for publication July 5, 2007. Accepted for publication October 10, 2007.
| References |
|---|
|
|
|---|
B signal pathway is required for IL-23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist-deficient mice. J. Immunol. 176: 5652-5661. 
T cells rather than CD4 T cells during Mycobacterium tuberculosis infection. J. Immunol. 177: 4662-4669.
1+ 
T cells control early infiltration of neutrophils after Escherichia coli infection via IL-17 production. J. Immunol. 178: 4466-4472.
production and type 1 cytokine responses. Immunity 4: 471-481. [Medline]
4 β 1, and
4 β 7 integrins participate in CD4+ T cell recruitment to chronically inflamed small intestine. J. Immunol. 174: 2343-2352.
t directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126: 1121-1133. [Medline]
responses if IL-12p70 is available. J. Immunol. 175: 788-795. This article has been cited by other articles:
![]() |
A. M. Soulika, E. Lee, E. McCauley, L. Miers, P. Bannerman, and D. Pleasure Initiation and Progression of Axonopathy in Experimental Autoimmune Encephalomyelitis J. Neurosci., November 25, 2009; 29(47): 14965 - 14979. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Smith, S. von Vietinghoff, M. A. Stark, A. Zarbock, J. M. Sanders, A. Duley, J. Rivera-Nieves, T. P. Bender, and K. Ley T-Lineage Cells Require the Thymus but Not V(D)J Recombination to Produce IL-17A and Regulate Granulopoiesis In Vivo J. Immunol., November 1, 2009; 183(9): 5685 - 5693. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Monteiro, A. Scovino, S. Raposo, V. M. Gaze, C. Cruz, E. Svensjo, M. S. Narciso, A. P. Colombo, J. B. Pesquero, E. Feres-Filho, et al. Kinin Danger Signals Proteolytically Released by Gingipain Induce Fimbriae-Specific IFN-{gamma}- and IL-17-Producing T Cells in Mice Infected Intramucosally with Porphyromonas gingivalis J. Immunol., September 15, 2009; 183(6): 3700 - 3711. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. von Vietinghoff and K. Ley IL-17A Controls IL-17F Production and Maintains Blood Neutrophil Counts in Mice J. Immunol., July 15, 2009; 183(2): 865 - 873. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ohnmacht, A. Pullner, S. B.S. King, I. Drexler, S. Meier, T. Brocker, and D. Voehringer Constitutive ablation of dendritic cells breaks self-tolerance of CD4 T cells and results in spontaneous fatal autoimmunity J. Exp. Med., March 16, 2009; 206(3): 549 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Combaluzier and J. Pieters Chemotaxis and Phagocytosis in Neutrophils Is Independent of Coronin 1 J. Immunol., March 1, 2009; 182(5): 2745 - 2752. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, Y. Yuan, Y. Li, J. Zhang, G. Xiao, Y. Vodovotz, T. R. Billiar, M. A. Wilson, and J. Fan Interacting Neuroendocrine and Innate and Acquired Immune Pathways Regulate Neutrophil Mobilization from Bone Marrow following Hemorrhagic Shock J. Immunol., January 1, 2009; 182(1): 572 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. von Vietinghoff and K. Ley Homeostatic Regulation of Blood Neutrophil Counts J. Immunol., October 15, 2008; 181(8): 5183 - 5188. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Smith, M. A. Stark, A. Zarbock, T. L. Burcin, A. C. Bruce, D. Vaswani, P. Foley, and K. Ley IL-17A Inhibits the Expansion of IL-17A-Producing T Cells in Mice through "Short-Loop" Inhibition via IL-17 Receptor J. Immunol., July 15, 2008; 181(2): 1357 - 1364. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |