The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 8274-8279
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, E.
Right arrow Articles by Ley, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, E.
Right arrow Articles by Ley, K.

IL-23 Is Required for Neutrophil Homeostasis in Normal and Neutrophilic Mice1

Emily Smith2,*, Alexander Zarbock*,§, Matthew A. Stark{dagger}, Tracy L. Burcin{dagger}, Anthony C. Bruce{dagger}, Patricia Foley{ddagger} and Klaus Ley

* Robert M. Berne Cardiovascular Research Center, {dagger} Departments of Biomedical Engineering and Molecular Physiology and Biological Physics, and {ddagger} Office for the Vice President for Research and Graduate Studies, University of Virginia, Charlottesville, VA 22908; § Department of Anesthesiology and Critical Care Medicine, University of Muenster, Muenster, Germany; and Division of Inflammation Biology, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037. division of Inflammation Biology, La Jolla Institute for Allergy and Immnology, La Jolla, CA 92037


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-23 is secreted by macrophages and dendritic cells in response to microbial products and inflammatory cytokines. IL-23 is a heterodimer composed of the unique IL-23p19 subunit linked to the common p40 subunit that it shares with IL-12. IL-23 is implicated in autoimmune diseases, where it supports the expansion of IL-17A-producing CD4+ Th17 cells. IL-23 also regulates granulopoiesis in a neutrostat regulatory feedback loop through IL-17A-producing neutrophil regulatory (Tn) cells, most of which express {gamma}{delta} TCR. This homeostatic system is disrupted in mice lacking adhesion molecules like β2-integrins (Itgb2–/–) which have defective neutrophil trafficking and neutrophilia. To test the role of IL-23 in the homeostatic regulation of circulating neutrophil numbers, we measured blood neutrophil numbers in p40-deficient (IL12b–/–) mice and found them reduced compared with wild-type mice. IL12b–/–Itgb2–/– mice, lacking β2-integrins, IL-12, and IL-23 showed significantly blunted neutrophilia compared with Itgb2–/– mice. Treatment of both IL12b–/– and IL12b–/–Itgb2–/– mice with IL-23, but not IL-12, restored circulating neutrophil counts. Serum levels of IL-17A were readily detectable in Itgb2–/– mice, but not in IL12b–/–Itgb2–/– mice, suggesting that IL-17A production is reduced when IL-23 is absent. Similarly, tissue mRNA expression of IL-17A was reduced in IL12b–/–Itgb2–/–mice compared with Itgb2–/– controls. The total number of CD3+ IL-17A-producing Tn cells were significantly reduced in the spleen and lamina propria of IL12b–/–Itgb2–/– mice, with the largest reduction found in {gamma}{delta}+ T cells. Our results suggest a prominent role of IL-23 in the regulation of granulopoiesis and the prevalence of IL-17A-producing Tn cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin-23 is a cytokine involved in the pathogenesis of many autoimmune diseases including experimental autoimmune encephalitis (EAE),3 rheumatoid arthritis, and inflammatory bowel disease (1, 2, 3, 4, 5, 6, 7, 8). Before the discovery of IL-23, these diseases were considered to be primarily Th1-dependent and IFN-{gamma}-driven through the production of IL-12 by activated macrophages (9, 10). IL-12 and IL-23 are heterodimers (p40p35 and p40p19, respectively) secreted by macrophages and dendritic cells (11). Studies using either p40-deficient (IL12b–/–) mice or p40-blocking Abs disrupt the activities of both cytokines simultaneously, but this was not always recognized (12, 13). In the case of EAE, only since the generation of p35- and p19-deficient mice has the pathogenic role of IL-23 and not IL-12 become evident (1). This was further confirmed by anti-IL-23 therapy, which has been shown to ameliorate EAE, whereas anti-IL-12 Abs exacerbate the disease (1, 14, 15, 16). In inflammatory bowel disease, a genome-wide association study found a significant association between IL-23 receptor (IL-23R) polymorphisms and Crohn’s disease (17). Therefore, IL-23 and/or its receptor are now attractive targets for the treatment of autoimmune diseases.

IL-23 mediates its proinflammatory effects through the activation of effector memory T cells that secrete IL-17A (18). There are three types of IL-17A-secreting T cells found in normal wild-type (WT) mice; {gamma}{delta}+ T cells are the most abundant, followed by CD4+CD8{alpha}βhigh T cells (also termed Th17 cells) and the least abundant CD4CD8{alpha}βlow T cells, the role of which remains ill-defined (19, 20). IL-17A-producing {gamma}{delta}+ T cells have been implicated in host response to Mycobacterium tuberculosis and M. bovis infections, with the V{delta}1+ T cell subset playing an important role in protection against Escherichia coli infections (21, 22, 23). Stimulation of purified {gamma}{delta}+ T cells with IL-23 alone but not IL-6 or TGF-β enhances the production of IL-17A, and Ab blockade of IL-23 (p19) or the p40 subunit reduces IL-17A release in vitro in response to a variety of proinflammatory stimuli (21, 22, 23).

Th17 cells are distinct from Thl and Th2 cells (24, 25). Naive CD4+ T cells only polarize into Th17 cells if Th1 (INF-{gamma} and IL-12) and Th2 (IL-4) cytokines or transcription factors T-Bet and GATA-3 are blocked or removed, and if IL-6, IL-21 and TGF-β are present (24, 25, 26, 27, 28, 29, 30, 31, 32). The role of IL-23 in the activation and maintenance of IL-17A-expressing T cells remains controversial. Naïve CD4+ T cells do not express IL-23R receptor and consequently, IL-23 does not have any effects on their differentiation or IL-17A production (26, 27, 29). We and others have shown that exogenously applied IL-23, but not IL-12, can increase the expression and production of IL-17A from effector T cells (18, 19). Recently, a more complex role for IL-23 in vivo was demonstrated, with IL-6 and IL-21 up-regulating IL-23R expression on naive CD4+ T cells, and IL-23, in combination with TGF-β, inducing the differentiation of Th17 cells (30, 31, 32). Upon activation, Th17 cells release the cytokines IL-17A, IL-17F, IL-22, TNF-{alpha} and IL-6, all of which can induce inflammatory responses (33, 34).

The IL-23/IL-17 axis regulates granulopoiesis via a neutrostat regulatory feedback loop (19, 20). Transgenic overexpression of IL-17A in murine livers elevates neutrophil counts, bone marrow (BM) and splenic colony forming units and the release of granlocyte-colony stimulating factor (G-CSF) from BM stromal cells (35, 36). In normal WT and neutrophilic mice, a positive correlation is found between neutrophil numbers and serum levels of IL-17A and G-CSF (37).

CD18 is the common β2 subunit of the four β2 integrins: CD11a/CD18 (LFA-1), CD11b/CD18 (Mac-1), CD11c/CD18, and CD11d/CD18. Mice with a targeted null mutation in the Itgb2 gene lack all β2 integrins and are neutrophilic, due to the inability of neutrophils to traffic into nonlymphoid tissues and altered hematopoiesis (19, 38). This was demonstrated by the transfer of WT neutrophils into Itgb2–/– mice, which lowered neutrophil counts to normal WT levels and reduced serum IL-17A levels and tissue expression of IL-23, but not IL-12 (19, 37). Phagocytosis of apoptotic neutrophils by Itgb2–/– macrophages or dendritic cells reduced IL-23 expression in these cells in vitro, thus closing the feedback loop (19).

To test the role of IL-23 upstream of IL-17A in the regulation of granulopoiesis in vivo, we generated IL12b–/–Itgb2–/– mice as a tool to determine the effects of IL-23 on granulopoiesis and IL-17A expression and secretion, and the prevalence of IL-17A -producing Tn cells in vivo. We found that IL-23 deficiency profoundly affects IL-17A expression and secretion, and thereby granulopoiesis in mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals and treatments

Mice lacking CD18 integrin (Itgb2–/–) (38) or p40 (IL12b–/–) (39) and WT C57BL/6 mice (The Jackson Laboratory) were used between 8 and 16 wk of age and kept in specific pathogen-free conditions in a barrier facility. Mice deficient in both CD18 and p40 were generated by breeding Itgb2+/– with IL12b–/– mice, and all mice were on a C57BL/6 background at least for ten generations. All animal experiments were approved by the Institutional Animal Care and Use Committee at the University of Virginia. For Ab blockade of p40 (30517; R&D Systems), 100 µg of Ab or rat IgG1 isotype control (R&D Systems) per mouse was injected i.v. into WT mice and blood neutrophil counts assessed after 48 h. Some p40-deficient mice were injected with 2 µg of recombinant mouse (rm) IL-12, rmIL-23 (both R&D Systems) or saline as a control and blood neutrophil counts were assessed after 24 and 48 h via tail bleed into EDTA coated capillary tubes. Blood samples were then analyzed by automatic analyzer (Hemavet 850, CDC Technologies) and confirmed by Kimura-stained manual counts using a hemocytometer.

Recombinant proteins and Abs

The following mAbs (all reagents from BD Pharmingen, unless otherwise indicated) were used: Purified or Allophycocyanin-conjugated anti-CD3{epsilon} (145-2C11), allophycocyanin CY7 or PerCP-conjugated anti-CD4 (RM4–5), anti-CD16/CD32 (2.4G2; The Lymphocyte Culture Center, University of Virginia), purified anti-CD28 (37.51), FITC or allophycocyanin conjugated anti-TCR β-chain (H57–597), FITC or biotin-conjugated anti-{gamma}{delta} TCR (GL3), PE-conjugated anti-IL-17A (TC11–18H10.1), and PerCP-conjugated streptavidin was used for the detection of the biotin-conjugated primary Ab.

Flow cytometry

Animals were anesthetized with an i.p. injection of a mixture containing ketamine hydrochloride (Sanofi Winthrop Pharmaceuticals, 125 mg/kg), xylazine (TranquiVed, Phoenix Scientific, 12.5 mg/kg), and atropine sulfate (Fujisawa USA, 0.025 mg/kg) then euthanized by cervical dislocation. Single cell suspensions of the spleen, mesenteric lymph node (MLN) and Peyer’s patches were obtained by straining tissues through a 70-µm screen (BD Falcon). RBC were lysed and white blood cells washed twice with PBS-FBS. Lamina propria (LP) lymphocytes were prepared as previously described (40). Where indicated, cells were cultured in RPMI 1640 containing 10% FBS, 1x nonessential amino acids (Invitrogen Life Technologies), 10 mM HEPES, 2 mM L-glutamine (Invitrogen Life Technologies), 1 mM sodium pyruvate (Invitrogen Life Technologies), and 1% penicillin/streptomycin for 5 h with 10 ng/ml PMA (Sigma-Aldrich), 500 ng/ml calcium ionophore (Sigma-Aldrich), and GolgiStop (BD Pharmingen).

Following stimulation, cells were resuspended at 107/ml. Fc{gamma} II/III receptors were blocked with 0.5 µg anti-CD16/CD32 and the cell suspension was incubated with an optimal concentration of mAbs for 20 min at 4°C in staining buffer (5% FBS in PBS) and washed. When biotinylated mAbs were used, streptavidin-PerCP was added for 20 min at 4°C, and cells washed twice in staining buffer. Intracellular staining was performed using Fix & Perm cell permeabilization reagents (Caltag Laboratories) according to the manufacturer’s instructions. Flow cytometry analysis was performed on a Becton Dickinson FACSCalibur dual laser and data were analyzed using FlowJo software (Tree Star). Gates were set by isotype controls.

Cytokine quantification

IL-17A, CXCL1, and G-CSF protein in serum or cell culture supernatants were measured by DuoSet ELISA kits (R&D Systems) according to the manufacturer’s directions. CCL2, IL-6, and IL-12 were measured using BD cytometric bead array, mouse inflammation kit (BD Biosciences) according to the manufacturer’s instructions. Experimentally determined detection limits were calculated by adding two SDs to the mean OD value of replicate blanks.

mRNA quantification

RNA was extracted from tissue following homogenization in TRIzol (Invitrogen Life Technologies), according to the manufacturer’s instructions. Reverse transcription and PCR steps were performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen) as previously described (19). IL-17A primer sequences were as follows: sense: ATCCCTCAAAGCTCAGCGTGTC and anti-sense: GGGTCTTCATTGCGGTGGAGAG. One microgram of total RNA was used for all tissues. Values were determined using the iCycler iQ Real-Time Detection System Software v3.0 (Qiagen). The corresponding values were normalized to 18s RNA and then normalized to individual WT mouse organs as the calibrator control (always equal to 1), thereby expressing the values as relative quantification values.

Statistical analysis

Data were expressed as mean ± SEM. Statistical significance between groups was set at p < 0.05 using a two-tailed paired or unpaired t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
p40-deficient mice are neutropenic

To analyze the effects of IL-23 in vivo, we used mice lacking both IL-12 and IL-23 (IL12b–/–) and investigated circulating neutrophil numbers. p40-deficient mice had 60% lower neutrophil numbers (p < 0.05) compared to healthy WT mice (Fig. 1a). As previously described, Itgb2–/– mice have severely elevated neutrophil counts (38), IL-23 message, and IL-17A-producing Tn cells (19). When IL12b–/– mice were crossed with mice suffering from severe neutrophilia (Itgb2–/–) to create IL12b–/–Itgb2–/– mice, neutrophil numbers were significantly reduced compared to Itgb2–/– mice (p < 0.01) but still remained elevated compared WT mice (Fig. 1b). The IL12b–/–Itgb2–/– mice showed no additional pathology beyond the phenotype previously found in Itgb2–/– mice (data not shown) (38).


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 1. p40-deficient mice have impaired granulopoiesis. Circulating blood neutrophil levels (1000 cells per µl; k/µl) were assessed in (A) WT and IL12b–/– mice or (B) Itgb2–/– and IL12b–/–Itgb2–/– mice (*, p < 0.05; **, p < 0.01 by unpaired students t test). C, Blood neutrophil counts were assessed in WT mice following treatment with a p40 Ab or IgG1 isotype control for 48 h (**, p < 0.01 by paired students t test). IL12b–/– mice (D) or IL12b–/–Itgb2–/– mice (E) were reconstituted with rmIL-23, rmIL-12, or saline and circulating neutrophil levels were analyzed at 24 h (*, p < 0.05 by paired Student’s t test).

 
To confirm these findings, we used an Ab against p40 in WT mice, which severely reduced neutrophil numbers compared to the isotype control, confirming previous studies (Fig. 1c) (19). The neutropenia seen in IL12b–/– mice was reversed by reconstitution with rmIL-23, but not rmIL-12 (Fig. 1d). This reversal was transient with neutrophil numbers returning to baseline levels 48 h after treatment (data not shown). Reconstitution of IL12b–/–Itgb2–/– mice with rmIL-23 significantly raised neutrophil counts after 24 h (Fig. 1e). RmIL-12 did not affect neutrophil counts compared to the saline controls. Thus, IL-23 and not IL-12 is responsible for the regulation of granulopoiesis in p40-deficient mice on a normal or neutrophilic background.

p40 subunit regulates circulating levels of IL-17A

One of the major downstream cytokines of IL-23 is IL-17A (19). In this study, we analyzed the effects of p40 deficiency on circulating IL-17A levels in normal (WT), neutropenic (IL12b–/–), and neutrophilic (Itgb2–/– and IL12b–/–Itgb2–/–) mice. IL-17A was not detectable by ELISA in the serum of WT mice, as previously reported (37), nor was it detectable in the serum of IL12b–/– mice. High levels of IL-17A were found in the serum of Itgb2–/– mice (37) however, IL-17A was not detectable in the serum of IL12b–/–Itgb2–/– mice (Fig. 2a). This suggests that p40 is involved in regulating circulating levels of IL-17A in neutrophilic mice.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 2. p40 deficiency affects circulating cytokine levels. Serum levels of IL-17A (detection limit; 15.7 pg/ml indicated by dashed line) (A), G-CSF (detection limit; 125 pg/ml) (B), CCL2 (detection limit; 62.5 pg/ml) (C), CXCL1 (detection limit; 15.7 pg/ml) (D), and IL-6 (detection limit; 31.3 pg/ml) (E) levels were assessed in WT, IL12b–/–, Itgb2–/–, and IL12b–/–Itgb2–/– mice (*, p < 0.05; **, p < 0.01 by unpaired Student’s t test).

 
Cytokines downstream of IL-17A (G-CSF, CCL2, CXCL1, and IL-6) were analyzed in the sera of Itgb2–/– and IL12b–/–Itgb2–/– mice (Fig. 2, b, c, d, and e). G-CSF and CCL2 levels were significantly reduced (p < 0.01 and p < 0.05 respectively) in IL12b–/–Itgb2–/– mice, as was IL-6 (p < 0.05). CXCL1 was not affected by the p40 deficiency.

IL-17A expression and the number of IL-17A-producing Tn cells are reduced in p40-deficient mice

To explore whether a deficiency in IL-23 could affect the basal expression of IL-17A in neutrophilic mice, IL-17A mRNA expression was assessed in various organs of IL12b–/–Itgb2–/– and Itgb2–/– mice. IL-17A expression was reduced in the MLN, spleen, and LP of IL12b–/–Itgb2–/– mice compared to Itgb2–/– mice (Fig. 3). The IL-17A message levels were roughly mirrored by the percentage of IL-17A-producing Tn cells which were reduced in the MLN, spleen, and LP of IL12b–/–Itgb2–/– mice compared to Itgb2–/– mice (Fig. 4, a and b). Culture of splenocytes on plate-absorbed anti-CD3, with soluble anti-CD28, with and without IL-23 for 3 days also demonstrated a significant reduction in the proportion of IL-17A-producing Tn cells from IL12b–/–Itgb2–/– mice compared to Itgb2–/– mice (data not shown). Analysis of the Tn cell subsets ({gamma}{delta}+, CD4CD8{alpha}βlow, and Th17) revealed that the number of IL-17A-producing {gamma}{delta}+ Tn cells was significantly reduced in the MLN and spleen of IL12b–/–Itgb2–/– mice compared to the control (Fig. 4c). The proportion of CD3+ T cells that were Th17 cells or CD4CD8{alpha}βlow T cells were not significantly affected by the p40 deficiency (Fig. 4, d and e). This indicates that the expansion of IL-17A-producing {gamma}{delta}+ cells in vivo is likely to depend on the presence of IL-23.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 3. IL-17A mRNA expression is reduced in p40-deficient mice in vivo. mRNA expression of IL-17A was assessed in the MLN, spleen, and LP of Itgb2–/– and IL12b–/–Itgb2–/– mice. Values are expressed on a log scale as relative quantification (RQ) values as determined by normalization of IL-17A to 18s RNA and expressed as fold increase compared with IL-17A expression (=1) in the respective WT mouse organs (*, p < 0.05; **, p < 0.01 by unpaired Student’s t test).

 

Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 4. The proportion of IL-17A-producing Tn cells is reduced in p40-deficient mice. Single cell suspensions were prepared from the MLN, spleen, and LP of Itgb2–/– and IL12b–/–Itgb2–/– mice and stimulated with a mixture of PMA, ionomycin, and GolgiStop for 5 h. A, Representative plots of the spleen from Itgb2–/– and IL12b–/–Itgb2–/– mice. Total number of IL-17A-producing T cells (B), IL-17A-producing {gamma}{delta}+ T cells (C), CD4+ Th17 cells (D), and CD4CD8{alpha}βlow T cells (E), as a percentage of all CD3+ T cells (*, p < 0.05; **, p < 0.01 by unpaired Student’s t test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The present data demonstrate a key role for IL-23 in regulating granulopoiesis. Both normal and neutrophilic (Itgb2–/–) mice showed reduced circulating neutrophil counts when deficient in p40. The effect of the p40-containing cytokines, IL-23 and IL-12, on regulating neutrophil numbers was further established by Ab blockade against p40, which induced neutropenia in WT mice. Injection of rmIL-23 but not rmIL-12 into p40-deficient mice restored circulating neutrophil numbers. Circulating levels of IL-17A were not detectable in mice lacking p40. Concomitantly, expression of IL-17A mRNA was reduced in IL12b–/–Itgb2–/– mice, which correlated with a reduction in the percentage of IL-17A-producing Tn cells by flow cytometry. Thus, IL-23 plays a prominent role in the maintenance of IL-17A-producing Tn cells and therefore neutrophil homeostasis in vivo.

Adhesion-molecule-deficient mice demonstrate a neutrophilic phenotype, with elevated serum levels of IL-17A and G-CSF (37). These mice also contain expanded populations of IL-17A-producing Tn cells (19, 20). The neutrophilia seen in these mice is not due to the passive accumulation of neutrophils in the vasculature, nor due to alterations in the marginating pool found in the lung, but is primarily caused by increased granulopoiesis (37, 41). A reduction in neutrophil apoptosis may also contribute to neutrophilia in Itgb2–/– mice (42). Previous studies have shown that IL-17A can act directly on BM stromal cells to produce G-CSF, up-regulate the cell surface expression of stem cell factor, as well as stimulate myeloid progenitor cell proliferation (36). Consistent with the IL-23-IL-17-G-CSF neutrophil-regulatory feedback loop (19), p40-deficient mice have a significant reduction in the number of hemopoietic progenitor cells in the bone marrow compared to WT mice (43). Mice lacking p40 also have reduced circulating neutrophil counts, which can be rescued by treatment with IL-23, but not IL-12. Taken together, these results indicate that IL-23 is a key regulator of granulopoiesis in mice.

In vitro studies have shown that IL-23 stimulates the production of IL-17A from memory CD4+ T cells but not naive CD4+ T cells (18). Initial reports describing the distinct lineage of Th17 cells showed that naive CD4+ T cells could expand and secrete higher quantities of IL-17A when treated with IL-23 in the presence of blocking Abs against INF-{gamma} and/or IL-4 (24, 25). However, Th17 cell polarization only occurred in the presence of IL-6 and TGF-β, and not in the presence of IL-23 (26, 27, 29). Furthermore, IL-23 did not induce the expression of ROR{gamma}t, which was the first described transcriptional regulator of Th17 cells (44). Some in vitro studies have shown that IL-23 can expand existing effector memory populations of Th17 cells following polarization (26, 27). However, Bettelli et al. (29), did not find an expansion of the polarized Th17 pool following treatment with exogenous IL-23, nor did they find a reduction using anti-p40 blocking Abs. Therefore, it appeared that naive Th17 cells must first be polarized into a precursor Th17 cell which express IL-23R, and then IL-23 may act on these cells to further expand and/or maintain the cell population. IL-6 treatment of naive CD4+ T cells can induce the expression of IL-23R, as can IL-21 (30, 31, 32). IL-6 can activate Stat3, which in turn activates ROR{gamma}t and IL-21R expression. At this stage, the cells can be differentiated into Th17 cells independently IL-6, through the combination of IL-21 or IL-23 and TGF-β (30, 31, 32).

In the aforementioned studies, the polarization of Th17 cells was performed in vitro, a situation that cannot recapitulate the complex in vivo environment of secondary lymphoid tissues. In this study, we report a reduction in the number of IL-17A-producing cells, and IL-17A expression at the message, protein, and cellular levels in p40-deficient mice. In contrast to the in vitro findings, we find that IL-23 does support the polarization, survival and activation of IL-17A-producing Tn cells in vivo. Because Th17 cells show little response to IL-23 (29) and show little change in IL12b–/– mice (see Fig. 4), it is likely that {gamma}{delta}+ T cells are the main Tn cell subset that respond to IL-23. The p40 deficiency also caused a reduction in serum levels of both IL-6 and IL-17A. Thus, it is possible that IL-23 may regulate the polarization of Th17 cells indirectly by making IL-6 available. Indeed, IL-6 is an indispensable ingredient in the cytokine mixes that promote the commitment of T cells to the IL-17A-producing phenotype (26, 27, 29).

Because IL-23 primarily acts on memory T cells enhancing the secretion of IL-17A (18), it is not surprising that the secretion of IL-17A was not detectable in the sera of IL12b–/–Itgb2–/– mice. This is consistent with the reduction in the number of IL-17A-producing Tn cells in IL12b–/–Itgb2–/– mice by 60%. The p40 deficiency also reduced serum levels of IL-6, CCL2, and G-CSF. In collagen-induced arthritis models, p40- or p19-deficient mice have reduced IL-17A and IL-6 mRNA expression compared with WT mice (4). p19 blocking Abs also reduce the secretion of IL-6, IL-17A, CCL2, and CXCL1 in colon homogenates of inflammatory bowel disease models and IL-17A in the sera of EAE mouse models (16, 45). Conversely, in CNS and colitis autoimmune models, IL-23 treatment increases the mRNA expression of IL-17A, CCL2, and IL-6 in CD4+ T cells and the colon (3, 5).

IL-23 also plays a protective role in the host response to intracellular and extracellular bacterial and fungal infections through the regulation of proinflammatory cytokines and chemokines (46, 47, 48, 49). Taken together, these studies indicate that multiple cytokine pathways are influenced by IL-23, which regulate inflammatory processes as well as controlling the production and release of neutrophils into the systemic circulation. The reduction in serum levels of both IL-17A and G-CSF in IL12b–/–Itgb2–/– mice is consistent with the idea that IL-23 is the main upstream regulator of both of these proteins in vivo (19).

It is possible that polarization studies of Th17 cells in vitro do not faithfully replicate the in vivo situation, and as such, the role of IL-23 may have been underestimated. Most likely, {gamma}{delta}+ T cells are the IL-17A-producers that respond most to IL-23. These cells have not been studied in vitro previously. The pathogenic role of IL-23 in autoimmune disease is well understood; however, the role of IL-23 in host response to infection by controlling granulopoiesis needs further definition. Our study shows a dominant role of IL-23 in the regulation of granulopoiesis and the prevalence of IL-17A-producing Tn cell subsets.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants HL73361 (to K.L.), T32 GM 08715-01A1 (to M.A.S.), and Deutsche Forschungsgemeinschaft AZ428/2-1 (to A.Z.). Back

2 Address correspondence and reprint requests to Dr. Emily Smith, Robert M. Berne Cardiovascular Research Center, University of Virginia, P.O. Box 801394, Charlottesville, VA 22908. E-mail address: es9cy{at}virginia.edu Back

3 Abbreviations used in this paper: EAE, experimental autoimmune encephalitis; WT, wild type; BM, bone marrow; rm, recombinant mouse; MLN, mesenteric lymph node; LP, lamina propria. Tn, neutrophil regulatory T cell; Th17, IL-17 producing cox + T cells; 16-23R, 16-23 receptor; G-CSF, granulocyte-colony stimulating factor. Back

Received for publication July 5, 2007. Accepted for publication October 10, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, et al 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744-748. [Medline]
  2. Langrish, C. L., B. S. McKenzie, N. J. Wilson, M. R. de Waal, R. A. Kastelein, D. J. Cua. 2004. IL-12 and IL-23: master regulators of innate and adaptive immunity. Immunol. Rev. 202: 96-105. [Medline]
  3. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: 233-240. [Abstract/Free Full Text]
  4. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, D. J. Cua. 2003. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J. Exp. Med. 198: 1951-1957. [Abstract/Free Full Text]
  5. Yen, D., J. Cheung, H. Scheerens, F. Poulet, T. McClanahan, B. Mckenzie, M. A. Kleinschek, A. Owyang, J. Mattson, W. Blumenschein, et al 2006. IL-23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6. J. Clin. Invest. 116: 1310-1316. [Medline]
  6. Becker, C., H. Dornhoff, C. Neufert, M. C. Fantini, S. Wirtz, S. Huebner, A. Nikolaev, H. A. Lehr, A. J. Murphy, D. M. Valenzuela, et al 2006. Cutting edge: IL-23 cross-regulates IL-12 production in T cell-dependent experimental colitis. J. Immunol. 177: 2760-2764. [Abstract/Free Full Text]
  7. Cho, M. L., J. W. Kang, Y. M. Moon, H. J. Nam, J. Y. Jhun, S. B. Heo, H. T. Jin, S. Y. Min, J. H. Ju, K. S. Park, et al 2006. STAT3 and NF-{kappa}B signal pathway is required for IL-23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist-deficient mice. J. Immunol. 176: 5652-5661. [Abstract/Free Full Text]
  8. Schmidt, C., T. Giese, B. Ludwig, I. Mueller-Molaian, T. Marth, S. Zeuzem, S. C. Meuer, A. Stallmach. 2005. Expression of interleukin-12-related cytokine transcripts in inflammatory bowel disease: elevated interleukin-23p19 and interleukin-27p28 in Crohn’s disease but not in ulcerative colitis. Inflamm. Bowel. Dis. 11: 16-23. [Medline]
  9. Adorini, L.. 1999. Interleukin-12, a key cytokine in Th1-mediated autoimmune diseases. Cell Mol. Life Sci. 55: 1610-1625. [Medline]
  10. Steinman, L.. 2007. A brief history of TH17, the first major revision in the TH1/TH2 hypothesis of T cell-mediated tissue damage. Nat. Med. 13: 139-145. [Medline]
  11. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13: 715-725. [Medline]
  12. Leonard, J. P., K. E. Waldburger, S. J. Goldman. 1995. Prevention of experimental autoimmune encephalomyelitis by antibodies against interleukin 12. J. Exp. Med. 181: 381-386. [Abstract/Free Full Text]
  13. Brok, H. P. M., M. van Meurs, E. Blezer, A. Schantz, D. Peritt, G. Treacy, J. D. Laman, J. Bauer, B. A. ’t Hart. 2002. Prevention of experimental autoimmune encephalomyelitis in common marmosets using an anti-IL-12p40 monoclonal antibody. J. Immunol. 169: 6554-6563. [Abstract/Free Full Text]
  14. Gran, B., G. X. Zhang, S. Yu, J. Li, X. H. Chen, E. S. Ventura, M. Kamoun, A. Rostami. 2002. IL-12p35-deficient mice are susceptible to experimental autoimmune encephalomyelitis: evidence for redundancy in the IL-12 system in the induction of central nervous system autoimmune demyelination. J. Immunol. 169: 7104-7110. [Abstract/Free Full Text]
  15. Becher, B., B. G. Durell, R. J. Noelle. 2002. Experimental autoimmune encephalitis and inflammation in the absence of interleukin-12. J. Clin. Invest. 110: 493-497. [Medline]
  16. Chen, Y., C. L. Langrish, B. McKenzie, B. Joyce-Shaikh, J. S. Stumhofer, T. McClanahan, W. Blumenschein, T. Churakovsa, J. Low, L. Presta, et al 2006. Anti-IL-23 therapy inhibits multiple inflammatory pathways and ameliorates autoimmune encephalomyelitis. J. Clin. Invest. 116: 1317-1326. [Medline]
  17. Duerr, R. H., K. D. Taylor, S. R. Brant, J. D. Rioux, M. S. Silverberg, M. J. Daly, A. H. Steinhart, C. Abraham, M. Regueiro, A. Griffiths, et al 2006. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 314: 1461-1463. [Abstract/Free Full Text]
  18. Aggarwal, S., N. Ghilardi, M. H. Xie, F. J. de Sauvage, A. L. Gurney. 2003. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J. Biol. Chem. 278: 1910-1914. [Abstract/Free Full Text]
  19. Stark, M. A., Y. Huo, T. L. Burcin, M. A. Morris, T. S. Olson, K. Ley. 2005. Phagocytosis of apoptotic neutrophils regulates granulopoiesis via IL-23 and IL-17. Immunity 22: 285-294. [Medline]
  20. Ley, K., E. Smith, M. A. Stark. 2006. IL-17A-producing neutrophil-regulatory Tn lymphocytes. Immunol. Res. 34: 229-242. [Medline]
  21. Lockhart, E., A. M. Green, J. L. Flynn. 2006. IL-17 production is dominated by {gamma}{delta} T cells rather than CD4 T cells during Mycobacterium tuberculosis infection. J. Immunol. 177: 4662-4669. [Abstract/Free Full Text]
  22. Shibata, K., H. Yamada, H. Hara, K. Kishihara, Y. Yoshikai. 2007. Resident V{delta}1+ {gamma}{delta} T cells control early infiltration of neutrophils after Escherichia coli infection via IL-17 production. J. Immunol. 178: 4466-4472. [Abstract/Free Full Text]
  23. Umemura, M., A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, G. Matsuzaki. 2007. IL-17-mediated regulation of innate and acquired immune response against pulmonary Mycobacterium bovis bacille Calmette-Guerin infection. J. Immunol. 178: 3786-3796. [Abstract/Free Full Text]
  24. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6: 1123-1132. [Medline]
  25. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat. Immunol. 6: 1133-1141. [Medline]
  26. Veldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, B. Stockinger. 2006. TGFβ in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 24: 179-189. [Medline]
  27. Mangan, P. R., L. E. Harrington, D. B. O’Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, C. T. Weaver. 2006. Transforming growth factor-β induces development of the TH17 lineage. Nature 441: 231-234. [Medline]
  28. Mathur, A. N., H. C. Chang, D. G. Zisoulis, R. Kapur, M. L. Belladonna, G. S. Kansas, M. H. Kaplan. 2006. T-bet is a critical determinant in the Instability of the IL-17-secreting T-helper phenotype. Blood 108: 1595-1601. [Abstract/Free Full Text]
  29. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235-238. [Medline]
  30. Zhou, L., I. I. Ivanov, R. Spolski, R. Min, K. Shenderov, T. Egawa, D. E. Levy, W. J. Leonard, D. R. Littman. 2007. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat. Immunol. 8: 967-974. [Medline]
  31. Nurieva, R., X. O. Yang, G. Martinez, Y. Zhang, A. D. Panopoulos, L. Ma, K. Schluns, Q. Tian, S. S. Watowich, A. M. Jetten, C. Dong. 2007. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature 448: 480-483. [Medline]
  32. Korn, T., E. Bettelli, W. Gao, A. Awasthi, A. Jager, T. B. Strom, M. Oukka, V. K. Kuchroo. 2007. IL-21 initiates an alternative pathway to induce proinflammatory TH17 cells. Nature 448: 484-487. [Medline]
  33. Fossiez, F., O. Djossou, P. Chomarat, L. Flores-Romo, S. it-Yahia, C. Maat, J. J. Pin, P. Garrone, E. Garcia, S. Saeland, et al 1996. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med. 183: 2593-2603. [Abstract/Free Full Text]
  34. Chung, Y., X. Yang, S. H. Chang, L. Ma, Q. Tian, C. Dong. 2006. Expression and regulation of IL-22 in the IL-17-producing CD4+ T lymphocytes. Cell Res. 16: 902-907. [Medline]
  35. Schwarzenberger, P., V. La Russa, A. Miller, P. Ye, W. Huang, A. Zieske, S. Nelson, G. J. Bagby, D. Stoltz, R. L. Mynatt, et al 1998. IL-17 stimulates granulopoiesis in mice: use of an alternate, novel gene therapy-derived method for in vivo evaluation of cytokines. J. Immunol. 161: 6383-6389. [Abstract/Free Full Text]
  36. Schwarzenberger, P., W. Huang, P. Ye, P. Oliver, M. Manuel, Z. Zhang, G. Bagby, S. Nelson, J. K. Kolls. 2000. Requirement of endogenous stem cell factor and granulocyte-colony-stimulating factor for IL-17-mediated granulopoiesis. J. Immunol. 164: 4783-4789. [Abstract/Free Full Text]
  37. Forlow, S. B., J. R. Schurr, J. K. Kolls, G. J. Bagby, P. O. Schwarzenberger, K. Ley. 2001. Increased granulopoiesis through interleukin-17 and granulocyte colony-stimulating factor in leukocyte adhesion molecule-deficient mice. Blood 98: 3309-3314. [Abstract/Free Full Text]
  38. Scharffetter-Kochanek, K., H. Lu, K. Norman, N. van Nood, F. Munoz, S. Grabbe, M. McArthur, I. Lorenzo, S. Kaplan, K. Ley, et al 1998. Spontaneous skin ulceration and defective T cell function in CD18 null mice. J. Exp. Med. 188: 119-131. [Abstract/Free Full Text]
  39. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Carvajal, C. Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, M. K. Gately. 1996. IL-12-deficient mice are defective in IFN{gamma} production and type 1 cytokine responses. Immunity 4: 471-481. [Medline]
  40. Rivera-Nieves, J., T. Olson, G. Bamias, A. Bruce, M. Solga, R. F. Knight, S. Hoang, F. Cominelli, K. Ley. 2005. L-selectin, {alpha} 4 β 1, and {alpha} 4 β 7 integrins participate in CD4+ T cell recruitment to chronically inflamed small intestine. J. Immunol. 174: 2343-2352. [Abstract/Free Full Text]
  41. Doerschuk, C. M.. 2001. Mechanisms of leukocyte sequestration in inflamed lungs. Microcirculation 8: 71-88. [Medline]
  42. Weinmann, P., K. Scharffetter-Kochanek, S. B. Forlow, T. Peters, B. Walzog. 2003. A role for apoptosis in the control of neutrophil homeostasis in the circulation: insights from CD18-deficient mice. Blood 101: 739-746. [Abstract/Free Full Text]
  43. Broxmeyer, H. E., H. A. Bruns, S. Zhang, S. Cooper, G. Hangoc, A. N. J. McKenzie, A. L. Dent, U. Schindler, L. K. Naeger, T. Hoey, M. H. Kaplan. 2002. Th1 cells regulate hematopoietic progenitor cell homeostasis by production of oncostatin M. Immunity 16: 815-825. [Medline]
  44. Ivanov, I. I., B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J. Lafaille, D. J. Cua, D. R. Littman. 2006. The orphan nuclear receptor ROR{gamma}t directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126: 1121-1133. [Medline]
  45. Hue, S., P. Ahern, S. Buonocore, M. C. Kullberg, D. J. Cua, B. S. McKenzie, F. Powrie, K. J. Maloy. 2006. Interleukin-23 drives innate and T cell-mediated intestinal inflammation. J. Exp. Med. 203: 2473-2483. [Abstract/Free Full Text]
  46. Wozniak, T. M., A. A. Ryan, W. J. Britton. 2006. Interleukin-23 restores immunity to Mycobacterium tuberculosis infection in IL-12p40-deficient mice and is not required for the development of IL-17-secreting T cell responses. J. Immunol. 177: 8684-8692. [Abstract/Free Full Text]
  47. Khader, S. A., J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, A. M. Cooper. 2005. IL-23 compensates for the absence of IL-12p70 and is essential for the IL-17 response during tuberculosis but is dispensable for protection and antigen-specific IFN-{gamma} responses if IL-12p70 is available. J. Immunol. 175: 788-795. [Abstract/Free Full Text]
  48. Kleinschek, M. A., U. Muller, S. J. Brodie, W. Stenzel, G. Kohler, W. M. Blumenschein, R. K. Straubinger, T. McClanahan, R. A. Kastelein, G. Alber. 2006. IL-23 enhances the inflammatory cell response in Cryptococcus neoformans infection and induces a cytokine pattern distinct from IL-12. J. Immunol. 176: 1098-1106. [Abstract/Free Full Text]
  49. Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, J. K. Kolls. 2003. Cutting edge: roles of toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J. Immunol. 170: 4432-4436. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. von Vietinghoff and K. Ley
IL-17A Controls IL-17F Production and Maintains Blood Neutrophil Counts in Mice
J. Immunol., July 15, 2009; 183(2): 865 - 873.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Ohnmacht, A. Pullner, S. B.S. King, I. Drexler, S. Meier, T. Brocker, and D. Voehringer
Constitutive ablation of dendritic cells breaks self-tolerance of CD4 T cells and results in spontaneous fatal autoimmunity
J. Exp. Med., March 16, 2009; 206(3): 549 - 559.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Combaluzier and J. Pieters
Chemotaxis and Phagocytosis in Neutrophils Is Independent of Coronin 1
J. Immunol., March 1, 2009; 182(5): 2745 - 2752.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Liu, Y. Yuan, Y. Li, J. Zhang, G. Xiao, Y. Vodovotz, T. R. Billiar, M. A. Wilson, and J. Fan
Interacting Neuroendocrine and Innate and Acquired Immune Pathways Regulate Neutrophil Mobilization from Bone Marrow following Hemorrhagic Shock
J. Immunol., January 1, 2009; 182(1): 572 - 580.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. von Vietinghoff and K. Ley
Homeostatic Regulation of Blood Neutrophil Counts
J. Immunol., October 15, 2008; 181(8): 5183 - 5188.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Smith, M. A. Stark, A. Zarbock, T. L. Burcin, A. C. Bruce, D. Vaswani, P. Foley, and K. Ley
IL-17A Inhibits the Expansion of IL-17A-Producing T Cells in Mice through "Short-Loop" Inhibition via IL-17 Receptor
J. Immunol., July 15, 2008; 181(2): 1357 - 1364.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, E.
Right arrow Articles by Ley, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, E.
Right arrow Articles by Ley, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS