The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 8180 -8190
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bryant, V. L.
Right arrow Articles by Tangye, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bryant, V. L.
Right arrow Articles by Tangye, S. G.

Cytokine-Mediated Regulation of Human B Cell Differentiation into Ig-Secreting Cells: Predominant Role of IL-21 Produced by CXCR5+ T Follicular Helper Cells1

Vanessa L. Bryant2,*,{dagger},{ddagger}, Cindy S. Ma*,{dagger}, Danielle T. Avery*,{dagger}, Ying Li§, Kim L. Good3,*,{dagger},{ddagger}, Lynn M. Corcoran, Rene de Waal Malefyt§ and Stuart G. Tangye4,*,{dagger},{ddagger}

* Garvan Institute of Medical Research, Darlinghurst, New South Wales, Australia; {dagger} Centenary Institute of Cancer Medicine and Cell Biology, Newtown, New South Wales, Australia; and {ddagger} Department of Experimental Medicine, University of Sydney, Sydney, New South Wales, Australia; § Schering Plough Biopharma (formerly DNAX), Palo Alto, CA 94304; and Walter and Eliza Hall Institute, Parkville, Victoria, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Differentiation of B cells into Ig-secreting cells (ISC) is critical for the generation of protective humoral immune responses. Because of the important role played by secreted Ig in host protection against infection, it is necessary to identify molecules that control B cell differentiation. Recently, IL-21 was reported to generate ISC from activated human B cells. In this study, we examined the effects of IL-21 on the differentiation of all human mature B cell subsets—neonatal, transitional, naive, germinal center, IgM-memory, and isotype-switched memory cells—into ISC and compared its efficacy to that of IL-10, a well-known mediator of human B cell differentiation. IL-21 rapidly induced the generation of ISC and the secretion of vast quantities IgM, IgG and IgA from all of these B cell subsets. Its effect exceeded that of IL-10 by up to 100-fold, highlighting the potency of IL-21 as a B cell differentiation factor. Strikingly, IL-4 suppressed the stimulatory effects of IL-21 on naive B cells by reducing the expression of B-lymphocyte induced maturation protein-1 (Blimp-1). In contrast, memory B cells were resistant to the inhibitory effects of IL-4. Finally, the ability of human tonsillar CD4+CXCR5+CCR7 T follicular helper (TFH) cells, known to be a rich source of IL-21, to induce the differentiation of autologous B cells into ISC was mediated by the production of IL-21. These findings suggest that IL-21 produced by TFH cells during the primary as well as the subsequent responses to T cell-dependent Ag makes a major contribution to eliciting and maintaining long-lived humoral immunity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The differentiation of mature B cells into plasma cells (PC)5 is critical for the generation of protective humoral immune responses. Indeed, the efficient production of Ag-specific Ig by activated B cells underlies the success of most vaccines (1, 2). Many cytokines can induce Ig secretion by human B cells activated with mimics of T cell-dependent (i.e., CD40L) or T cell-independent (i.e., engaging the BCR) stimuli in vitro. These include IL-2 (3, 4, 5, 6), IL-4 (5, 7, 8, 9), IL-6 (3, 10, 11), IL-10 (3, 5, 12, 13, 14), IL-12 (15), IL-13 (16), IL-15 (17), and TGF-β (3, 18). Many of these cytokines have different efficacies and specificities. For instance, their effects often favor the production of a particular Ig isotype(s), with IL-4 and IL-13 inducing IgG4 and IgE secretion (16), TGF-β directing production of IgA (18), and IL-2, IL-10, and IL-15 increasing secretion of IgM, IgG1, and IgA (5, 13, 17). IL-4 has a greater effect on naive than on germinal center (GC) and memory B cells (19), while IL-10 preferentially enhances differentiation of GC and memory B cells into Ig-secreting cells (ISC) (20, 21, 22, 23, 24). Similarly, IL-6 exerts its effect on preactivated B cells (10, 11), suggesting that it acts at a later stage of B cell differentiation than other cytokines. Despite these findings regarding the activity of numerous cytokines on B cell activation, the in vitro effect of IL-10 exceeds that of other cytokines by up to 100-fold (5, 12, 13, 17), making it a well-recognized and potent inducer of Ig secretion by human B cells.

Over the past few years, IL-21 has emerged as a strong inducer of human B cell differentiation (25, 26, 27, 28). Specifically, IL-21 has been found to induce human naive splenic B cells to undergo isotype switching to produce IgG1 and IgG3 (26) and to induce cord blood (CB) and peripheral blood (PB) B cells to differentiate into PC (28). Although this latter study unequivocally demonstrated the ability of IL-21 to mediate the differentiation of human B cells into ISC (28), it did not compare the effects of IL-21 to other cytokines such as IL-10, nor did it compare the effects of IL-21 on naive and memory B cells from the same tissue (28). Furthermore, no information has been presented detailing the sensitivity of GC B cells to the differentiative effects of IL-21. For these reasons, we quantitatively examined the effects of IL-21 on the differentiation of all subsets of human mature B cells—neonatal, transitional, naive, GC, IgM memory, and isotype switched memory—into ISC and compared its efficacy to that of IL-10. Because CD4+CXCR5+CCR7T follicular helper (TFH) cells present in lymphoid tissues are a prominent source of IL-21 (29, 30, 31, 32), we also examined the contribution of TFH cell-derived IL-21 to B cell differentiation in vitro.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Abs and Reagents

The following Abs were used: FITC-anti-CD20, FITC-anti-CD57, PE-Texas Red-anti-CD4, and allophycocyanin-anti-CD38 mAb (BD Biosciences); PE-anti-CD27, biotinylated anti-IgM, IgG, and IgA mAb, Alexa 647-anti CXCR5, and streptavidin (SA) conjugated to PerCp (BD Pharmingen); PE-anti-CD38 (Caltag); and biotinylated and allophycocyanin-anti-CD27 mAb (eBioscience). Membranes of insect cells infected with baculovirus expressing recombinant human CD40L were prepared by Dr. G. Shoebridge and N. Hare (Centenary Institute of Cancer Medicine and Cell Biology, Newtown, New South Wales, Australia).

Human B cells

Human spleens from cadaveric organ donors and buffy coats from healthy donors were obtained from the Australian Red Cross Blood Service (Sydney, Australia). Tonsils and CB samples were provided by the Royal Prince Alfred Hospital (Sydney, Australia). Institutional human ethics review committees approved all studies. Transitional, naïve, and memory B cells were isolated from PB by sorting CD20+CD10+CD27, CD20+CD10CD27, and CD20+CD10CD27+ cells, respectively (24, 33, 34, 35). Splenic naive, IgM memory, and isotype-switched memory B cells were isolated by sorting CD20+CD27IgG/A/E, CD20+CD27+IgG/A/E, and CD20+CD27+IgM/D cells, respectively (23, 24, 35, 36, 37). GC B cells were sorted as CD20highCD38high cells from tonsil mononuclear cells (20, 38). Cells were sorted on a FACSVantage or Aria flow cytometer (BD Immunohistochemistry Systems); postsort purity was >98%.

B cell cultures

Purified B cells were cultured in B cell medium (RPMI 1640 containing L-glutamine (Invitrogen Life Technologies), 10% FCS (Invitrogen Life Technologies), 10 mM HEPES (pH 7.4) (Sigma-Aldrich), 0.1 mM nonessential amino acid solution (Sigma-Aldrich), 1 mM sodium pyruvate (Invitrogen Life Technologies), 60 mg/ml penicillin, 100 mg/ml streptomycin, 40 mg/ml transferrin (Sigma-Aldrich), and 20 µg/ml Normocin (InVivogen); Refs. 23 and 24) and stimulated with CD40L alone or with IL-4 (100 U/ml), IL-10 (50 U/ml; both provided by DNAX Research Institute, Palo Alto, CA), IL-21 (50 ng/ml; Peprotech), or IL-4 and IL-21. For some experiments, B cells were labeled with CFSE (Molecular Probes) (24). For phenotypic and functional analysis, the cells were cultured in 48-well plates (2 x 105/500 µl/well; Becton Dickinson Labware) for 4 or 5 days. In some experiments, B cells were cultured in 96-well plates (50 x 103 cells per 200 µl per well; Becton Dickinson Labware) for 10–12 days. For the data presented in Fig. 4, naive and memory B cells were sorted from human spleens as CD19+CD27 and CD19+CD27+ cells (35), respectively, and then cultured (10 x 103 cells per 200 µl) with irradiated CD32 (Fc{gamma}RII)-transfected L cells (20 x 103 per 200 µl) and anti-CD40 mAb (mAb89) (8, 12, 18) in the presence or absence of IL-21 (Cell Sciences), IL-2 (100 U/ml; R&D Systems), or IL-10 for 10 days in Yssel’s medium (35).

Assessing B cell differentiation into ISC

Phenotypic analysis. In vitro activated CB, naive, memory, or GC B cells were harvested after 4 days of culture and then incubated with PE-anti-CD27 and allophycocyanin-anti-CD38 mAb. The samples were fixed in 1% formaldehyde; data were acquired on a FACSCalibur flow cytometer (BD Biosciences) and analyzed using FlowJo (Tree Star). The frequency of cells expressing high levels of CD38 and CD27 (i.e., CD38highCD27high; Ref. 39) and the percentage of CD38highCD27high cells in each division were determined (24). The absolute number of cells was calculated by adding a known number of CaliBRITE beads (BD Biosciences) to each well before harvest (24).

ELISPOT analysis. Activated B cells were harvested after 4 days of in vitro culture and then incubated in the wells of MultiScreen-HA ELISPOT plates (Millipore) precoated with goat anti-human IgM, IgG, and IgA polyclonal antisera (Southern Biotech). The percentages of cells secreting IgM, IgG, and IgA were determined as previously described (24, 39, 40).

ELISA. Secretion of IgM, IgG, and IgA was determined by Ig H chain-specific immunoassays (12, 18, 24, 35).

CD4+ T cell/B cell cocultures

CD4+ T cells were isolated from human tonsils using CD4 Dynabeads (Dynal) (41). CD4+CXCR5+CD57+/– and CXCR5 subsets were isolated by cell sorting, treated with mitomycin C (40 µg/ml; Sigma-Aldrich) for 1 h at room temperature, and then cultured in 96-well U-bottom tissue culture plates with autologous B cells (25 x 103 cells per 200 µl per well) alone (41) or with PHA (5 µg/ml; Sigma-Aldrich) and IL-2 (20 U/ml; Chemicon) in the absence or presence of human IgG1 (Calbiochem) or IL-21R-Fc (10 µg/ml; R & D Systems). Ig secretion was determined after 5–10 days by ELISA.

Semiquantitative PCR analysis

RNA was isolated from activated B cells (Qiagen RNeasy kit; Qiagen) and then transcribed into cDNA using random hexamers (Invitrogen Life Technologies) as primers and Superscript II RNase H reverse transcriptase (Invitrogen). The resulting cDNA was normalized for expression of the constitutively expressed gene GAPDH (TGGTCGTATTGGGCGC (5') and GGTCATGAGTCCTTCACGATACC (3')) and then used as a template for PCR. The following primers were used (Sigma-Genosys): Pax-5 (GCATAGTGTCCACTGGCTCC (5') and CCAGGAGTCGTTGTACGAGG (3')) and B-lymphocyte induced maturation protein-1 (Blimp-1) (GATGCGGATATGACTCTGTGG (5') and CTCGGTTGCTTTAGACTGCTC (3')) (39, 40).

Western blotting

Naive and memory B cells were cultured in vitro for 4 days and then solubilized in ice-cold lysis buffer (10 mM Tris-HCl (pH 7.8), 1% Nonidet P-40, 150 mM NaCl, and enzyme inhibitors; Refs. 39 and 42). Cell lysates were electrophoresed through 12% acrylamide gels containing 0.1% SDS and transferred to PVDF membranes (Millipore). Membranes were probed with Abs against Blimp-1 (39, 43), Pax-5 (C-20) or SHP-2 followed by HRP-conjugated anti-rat, goat, or rabbit Ig antiserum, respectively (all from Santa-Cruz Biotechnology). The membranes were developed using ECL (Pierce).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-21 potently induces division-linked differentiation of human naive and memory B cells into ISC

Because IL-21 has been reported to induce CB B cells and PB memory B cells to generate ISC in vitro (28), we were interested in determining the relative rates of differentiation of distinct subsets of human B cells. Naive CB or splenic B cells yielded <1% CD38highCD27high ISC following stimulation for 4 days with CD40L with or without IL-10 (Fig. 1, a and b). In contrast, similar frequencies (~6%) of CD38highCD27high cells were detected in cultures of either splenic IgM memory or switched memory cells stimulated with CD40L/IL-10 (Fig. 1, c and d). Strikingly, IL-21 dramatically increased the frequency of CD38highCD27high cells generated in cultures of CB, naive, and memory subsets by 5- to 20-fold compared with that induced by CD40L alone or CD40L/IL-10 (Fig. 1).


Figure 1
View larger version (45K):
[in this window]
[in a new window]

 
FIGURE 1. IL-21 potently induces the division-linked differentiation of naive and memory B cells into effector cells with an ISC phenotype. CB B cells (a) or splenic naïve (b), IgM memory (c), or Ig isotype-switched memory B (d) cells were cultured with CD40L alone or together with IL-10 or IL-21. The cells were harvested after 4 days and the frequency of cells with a CD38highCD27high phenotype was determined. The values represent the mean ± SEM of four (a), five (b and c), and two (d) independent experiments. In some experiments, B cells were CFSE-labeled before culture and the frequency of CD38highCD27high cells per division was determined by division slicing. Note, there are no values in a for B cells in divisions 0–3 in cultures containing IL-21 because most of them had undergone more than four divisions (see Ref. 37 ).

 
Differentiation of human memory B cells into CD38highCD27high ISC induced by CD40L/IL-10 is linked to cell division (23, 24, 39). When CFSE-labeled B cells were examined, IL-21-induced differentiation of naive and memory cells into ISC was also found to be division linked (Fig. 1, a and b, far right panel). This contrasted the effect of IL-10, which yielded substantially fewer ISC irrespective of division history (Fig. 1, a and b). Although both IL-10 and IL-21 induced CD40L-stimulated IgM memory and switched memory B cells to become ISC, their rate of differentiation was much greater when cultured with IL-21 (Fig. 1, c and d; right panel). Thus, both memory B cell subsets underwent more than two divisions before they became ISC in response to CD40L/IL-10, whereas a small fraction (~5%) of ISC were generated from CD40L/IL-21-stimulated memory B cells before they underwent their first division (Fig. 1, c and d; far right panel). Once CD40L/IL-21-stimulated memory B cells had entered division, more of them became ISC with each subsequent division than those stimulated with CD40L/IL-10 (Fig. 1, c and d). The division-linked rate of differentiation of IgM memory and isotype-switched memory cells in response to CD40L/IL-21 greatly exceeded that of naive B cells (Fig. 1, b–d). Specifically, only 5–6% of ISC were generated from naive B cells that had undergone the greatest number of cell divisions (Fig. 1b, right panel), while ~40% of both memory B cell populations in these same divisions were ISC (Fig. 1, c and d; right panel). The differences in the rate of generation of ISC from stimulated splenic naive and memory B cells on a division basis mirrored differences in the frequency of ISC generated in the bulk population (compare Fig. 1, b–d).

The generation of functional ISC was assessed using ELISPOT by determining the frequency of cells secreting IgM, IgG, and IgA. Overall, the frequencies of functional ISC correlated with CD38highCD27high cells (Table I). Although most ISC generated from naive populations produced IgM, low frequencies of IgG and IgA ISC were also detected, demonstrating that IL-21 can facilitate isotype switching not only to IgG (26, 28), but also to IgA. IgM memory B cells yielded cells secreting IgM, and a significant proportion (>50%) also secreted IgG or IgA (Table I), thus revealing a heightened ability of IgM memory cells to undergo isotype switching compared with naive cells. Switched memory B cells predominantly secreted IgG and IgA (Table I), consistent with the acquisition of these isotypes in vivo. Thus, IL-21 is more potent than IL-10 at inducing the differentiation of human CD40L-stimulated B cells into ISC, mediating the differentiation of both memory B cell types and some naive B cells, which are less responsive to the effects of IL-10.


View this table:
[in this window]
[in a new window]

 
Table I. IL-21 induces differentiation of human B cells into functional ISC more efficiently than IL-10a

 
Kinetics of IL-21-induced Ig secretion by CD40L-stimulated human B cells

The kinetics and magnitude of Ig secretion by naive and memory B cell subsets were next examined. After 2 days of stimulation with CD40L/IL-21, naive splenic B cells secreted ~10- and ~5-fold more IgM than those stimulated with CD40L alone and CD40L/IL-10, respectively (Fig. 2a, left panel). As the culture continued, CD40L/IL-21-induced IgM secretion dramatically increased and exceeded that observed with CD40L/IL-10 by 10–50-fold, depending on the day of analysis. Secretion of IgG and IgA by naive B cells was not detectable at early time points for any of the cultures (Fig. 2a, middle and right panels). However, CD40L/IL-21 induced secretion of switched Ig isotypes by naive B cells within 3–4 days of culture, at least 24 h earlier than CD40L/IL-10. Naive B cells secreted 30–50-fold more IgG and IgA following stimulation with CD40L/IL-21 than with CD40L/IL-10 (Fig. 2a, middle and right panels). These findings were also reflected in an analysis of IgM memory and isotype-switched memory B cells, in that CD40L/IL-21 induced the secretion of all Ig isotypes examined more rapidly and to a greater extent (10- to 200-fold) than CD40L/IL-10 (Fig. 2, b and c, right panels). When the production of Ig isotypes by transitional, naive, and memory PB B cells stimulated with CD40L and either IL-10 or IL-21 was assessed, it was also apparent that the effect of IL-21 exceeded that of IL-10 by 10–100-fold and that these effects were clearly measurable after 10–12 days of in vitro culture (Table II). Overall, this kinetic analysis revealed IL-21 as a potent inducer of Ig production by naive and memory B cells and demonstrated for the first time that IL-21 induces substantial production of IgA, in addition to IgM and IgG, by these subsets of human B cells.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 2. Kinetics of Ig secretion induced by IL-10 and IL-21 from CD40L-stimulated human B cells. Naive (a), IgM memory (b), and switched memory B (c) cells from the same donor spleen were cultured with CD40L alone ({blacksquare}) or together with IL-10 ({blacktriangleup}) or IL-21 ({blacktriangledown}). Supernatants were harvested after 2, 3, 4, and 5 days of culture and the levels of secreted IgM (left panels), IgG (middle panels), and IgA (right panels) were determined by ELISA. Note that the scale on the y-axis for each Ig isotype secreted by the different B cell subsets is the same. IgM secretion by switched memory B cells is not presented, as these cells produce only small amounts of this isotype.

 

View this table:
[in this window]
[in a new window]

 
Table II. IL-4 reduces IL-21-induced differentiation of transitional and naïve, but not memory, B cellsa

 
GC B cells robustly respond to IL-21

A predominant source of IL-21 is the TFH cell (29, 32). TFH cells express CXCR5 and consequently home to the B cell areas of lymphoid tissues where they reside in close proximity to GC B cells (31, 44). Thus, it is likely that GC B cells would be targets for IL-21 produced by TFH cells. Tonsil GC B cells were cultured for 4 days with CD40L, CD40L/IL-10, or CD40L/IL-21 to examine the relative effects of these cytokines on the generation of ISC. Quantitation of ISC by flow cytometry and ELISPOT yielded comparable results, with <1, ~4, and ~20% of cells, respectively, harvested from cultures of GC B cells stimulated with CD40L, CD40L/IL-10, and CD40L/IL-21 being ISC (Fig. 3, a and b). IL-21 improves the survival of CD40L-stimulated GC B cells, increasing the recovery of viable cells by ~5-fold compared with CD40L alone (37). Thus, when the total number of ISC generated was determined, CD40L/IL-21 stimulated the generation of ~200- and ~20-fold more ISC than did CD40L alone and CD40L/IL-10, respectively (Fig. 3c). The ability of IL-21 to generate large numbers of ISC from CD40L-stimulated GC B cells was also reflected in the secretion of extraordinarily high levels of all Ig isotypes by these cells (Fig. 3d). Thus, GC B cells are highly responsive to the stimulatory effects of IL-21.


Figure 3
View larger version (46K):
[in this window]
[in a new window]

 
FIGURE 3. GC B cells robustly respond to IL-21. GC B cells were cultured for 4 days with CD40L alone or together with IL-10 or IL-21. a and b, The frequency of ISC was then determined by phenotype (i.e., CD38highCD27high) (a) or functional analysis (i.e., ELISPOT) (b). c, The absolute number of ISC was calculated by multiplying the frequency of ISC (in b) by the total number of cells recovered from these cultures. d, Ig secretion was determined by ELISA. The values in a–c represent the mean of two independent experiments; the values in d represent the mean of four independent experiments.

 
IL-10 and IL-2 reduce the dose of IL-21 required to induce Ig secretion by human B cells

We next questioned whether the effect of IL-21 on Ig secretion by CD40L-activated B cells could be augmented by adding IL-10 alone or together with IL-2. These cytokines were chosen because IL-10 can induce the differentiation of memory B cells into ISC, and IL-2 enhances the response of CD40L/IL-10-stimulated B cells (23, 24, 45). When IL-21 was used at a saturating concentration (i.e., 50–100 ng/ml), the addition of IL-10 and/or IL-2 did not further increase Ig secretion (data not shown). For this reason, the effects of IL-2 and IL-10 tested in conjunction used with suboptimal doses of IL-21. CD40-stimulated naive B cells responded to IL-21 at concentrations >1 ng/ml as evidenced by the production of IgM and IgG (Fig. 4, a, b, d, and e). In contrast, CD40-stimulated memory B cells exhibited 10-fold greater sensitivity to IL-21 (Fig. 4, c and f). The effect of adding IL-10 to naive B cells stimulated through CD40 and with increasing concentrations of IL-21 was twofold. First, it increased IgM and IgG secretion induced by 1 ng/ml IL-21 by 2- to 5-fold (Fig. 4, a and b). Second, it reduced the concentration of IL-21 necessary for IgG secretion by 10-fold (Fig. 4b). IL-10 also increased IgG production by memory B cells stimulated with 0.1–1 ng/ml IL-21 (Fig. 4c). The combination of IL-2 and IL-10 also increased IgM and IgG production induced by suboptimal concentrations of IL-21 by ~2-fold (Fig. 4, d–f). In addition, IL-2/IL-10 rendered naive B cells capable of responding to 10-fold less IL-21 (0.1 ng/ml) to produce IgM (Fig. 4d). To further explore the interplay between IL-2, IL-10, and IL-21, expression of the low-affinity IL-2 receptor (IL-2R{alpha}) on activated human B cells was examined. IL-10 up-regulated the expression of IL-2R{alpha} to a greater extent on memory than on naive B cells (Fig. 4, g and h, left panels; Ref. 23). However, IL-21 strongly up-regulated CD25 on both human B cell subsets, such that the level of expression on naive and memory cells was comparable (Fig. 4, g and h, right panels). Thus, IL-21 may modulate the responsiveness of human B cells to the stimulatory effects of IL-2 by regulating the expression of IL-2R.


Figure 4
View larger version (32K):
[in this window]
[in a new window]

 
FIGURE 4. IL-10 reduces the dose of IL-21 required to induce Ig secretion by human B cells. a–f, Naive (a, b d, and e) and memory (c and f) B cells were sort purified from human spleens and then cultured with anti-CD40 mAb immobilized on CD32-transfected L cells in the presence of the indicated increasing concentrations of IL-21 ({square}) alone or together with 100 U/ml IL-10 (a–c) or 100 U/ml IL-2 plus IL-10 ({blacksquare}) (d–f). Secretion of IgM and IgG was determined after 10 days of culture. Note that the data presented in a–c and d–f were derived from different experiments using different donor spleens. g and h, naive (g) and memory (h) B cells were cultured with anti-CD40 mAb in the absence or presence of IL-10 or IL-21. After 4 days, the cells were harvested and then incubated with an isotype control mAb (black-outlined histogram) or anti-CD25 mAb (solid gray histogram). The values represent the change in mean fluorescence intensity ({Delta}MFI) calculated as (MFI of CD25) – (MFI of isotype control).

 
IL-4 suppresses IL-21-induced ISC differentiation from naive but not memory B cells

IL-4 and IL-21 can act antagonistically, with IL-21 reducing IL-4-induced IgE production by murine B cells (46, 47) and IL-4 suppressing IgG secretion by human B cells stimulated with anti-CD40 mAb and IL-21 (28). However, the ability of IL-4 to inhibit IgG secretion by IL-21-stimulated human B cells was variable, ranging from 0 to 50% (28). We speculated that this variability reflects the fact that total PB B cells—a mix of transitional, naive, and memory B cells that differ in frequency for individual donors—were used in these studies (28) rather than subsets of purified B cells. Furthermore, IL-4 has distinct effects on naive and memory subsets (19, 37) that may not be detected when total B cells are examined.

CD40L alone or CD40L/IL-4 did not induce CB B cells to become ISC, as assessed phenotypically (Fig. 5a) or functionally (Fig. 5b). Although IL-21 generated functional ISC from CD40L-stimulated CB B cells, this was reduced 2.5–5-fold by IL-4 (Fig. 5, a and b). When differentiation was assessed in the context of division, IL-4 delayed the generation of ISC from CD40L/IL-21-stimulated B cells by several divisions (Fig. 5c). Next, we examined PB B cells, because these cells were used in the original study that reported inhibitory effects, albeit variable, of IL-4 on IL-21-induced Ig secretion (28). PB transitional, naive, and memory B cells secreted large amounts of Ig following stimulation with CD40L/IL-21; however, Ig secretion by memory B cells exceeded that of transitional and naive B cells, especially with respect to IgG and IgA production (Table II). IL-4 had little effect on Ig secretion by CD40L-stimulated PB B cells. However, it reduced IgM, IgG, and IgA secreted by CD40L/IL-21-stimulated transitional and naive cells by ~3- to 5-fold (Table II). In stark contrast, CD40L/IL-21-stimulated memory B cells continued to secrete large amounts of Ig irrespective of the presence of IL-4 (Table II). Similarly, while IL-4 reduced the percentage of ISC generated from CD40L/IL-21-stimulated splenic naive B cells by ~50% (Fig. 5d, left panel), it had only a small effect on CD40L/IL-21-stimulated splenic memory B cells (32 vs 27%; Fig. 5e, left panel). When division-linked differentiation of splenic B cell subsets was examined, IL-4 clearly reduced the frequency of ISC generated from CD40L/IL-21-stimulated naive B cells by >2-fold per division (Fig. 5d, right panel). In contrast, IL-4 did not affect the differentiation rate of CD40L/IL-21-stimulated memory B cells (Fig. 5e, right panel). It was possible that IL-4 inhibited IL-21-mediated B cell differentiation by suppressing their proliferation. However, >95% of B cells in cultures stimulated with CD40L/IL-21 with or without IL-4 had undergone more than one division, with most of these cells residing in divisions 3–8 (Fig. 5f). Thus, IL-4 suppresses the generation of ISC from CD40L/IL-21-treated naive B cells without affecting cell division. Overall, this analysis of defined B cell subsets from human CB, PB, and spleen clearly revealed the specific inhibitory effect exerted by IL-4 on naive but not memory B cells. The differential sensitivity of transitional/naive and memory B cells to the suppressive effects of IL-4 may explain the variable effect noted by Ettinger and colleagues (28).


Figure 5
View larger version (58K):
[in this window]
[in a new window]

 
FIGURE 5. IL-4 suppresses IL-21-induced differentiation of transitional and naive but not memory B cells by reducing the expression of Blimp-1. a–c, CB B cells were cultured with CD40L and IL-4, CD40L and IL-21, or CD40L, IL-4, and IL-21 for 4 days. The cells were then harvested and the frequency of CD38highCD27high cells (a), functional ISC (b), and CD38highCD27high cells in each division (c) was then determined. The values are the mean of three (a and c) or two (b) independent experiments. d and e, Naive (d) and IgM (e) memory splenic B cells were labeled with CFSE and cultured with CD40L alone, CD40L plus IL-21 or CD40L, IL-21, and IL-4. After 4 days, the cells were harvested and the frequency of CD38highCD27high cells per culture as well as in each division was determined. f, CB and naive and IgM memory splenic B cells were labeled with CFSE and cultured with CD40L alone (solid gray histogram), CD40L/IL-21 (solid black line), or CD40L/IL-21/IL-4 (dashed black line). After 4 or 5 days, the CFSE profiles of the cells were determined. g and h, Naive and memory B cells were cultured with CD40L alone or together with IL-4, IL-10, IL-21, or IL-4 and IL-21. After 4 days, RNA was extracted, transcribed into cDNA, and whole cell lysates were prepared. Expression of Blimp-1 and PAX5 was determined by semiquantitative PCR using GAPDH as a standard (g) and Western blotting (h); SHP-2 expression was assessed to demonstrate similar protein loading.

 
IL-4 antagonizes the effects of IL-21 on the differentiation of naive B cells by reducing the expression of Blimp-1

A key mediator of B cell commitment to the PC lineage is Blimp-1 (48). Consistent with this, IL-21 can induce the expression of Blimp-1 mRNA in activated human and murine B cells (28, 49). Because IL-4 selectively inhibited differentiation of CD40L/IL-21-stimulated naive B cells, we examined the expression of Blimp-1 in B cell subsets activated with CD40L and different cytokines for 4 days at both the mRNA and protein levels. Blimp-1 was not detected in naive B cells activated with CD40L alone or CD40L/IL-4 (Fig. 5, g and h), yet Blimp-1 mRNA was detectable following stimulation with CD40L/IL-10 (Fig. 5g). In contrast, high levels of Blimp-1 were detected in naive B cells stimulated with CD40L/IL-21 (Fig. 5, g and h). IL-21-mediated induction of Blimp-1 expression in CD40L-stimulated naive B cells was dramatically reduced by IL-4 (Fig. 5, g and h), consistent with the ability of IL-4 to suppress the differentiation of naive B cells into ISC.

In contrast to naive cells, Blimp-1 was detected in memory B cells stimulated with CD40L/IL-10 and at greater levels in those cultured with CD40L/IL-21 (Fig. 5h). Induction of Blimp-1 in CD40L/IL-21-stimulated memory B cells was accompanied by reduced expression of the transcriptional repressor PAX5 (Fig. 5, g and h). IL-21-mediated induction of Blimp-1 and loss of PAX5 still occurred in CD40L-stimulated memory B cells in the presence of both IL-4 and IL-21 (Fig. 5, g and h). Thus, activated memory B cells are insensitive to the modulating effect of IL-4 on IL-21-induced differentiation, which distinctly contrasts naive B cells.

Tonsillar T follicular helper cells induce ISC differentiation of B cells via an IL-21-dependent mechanism

CXCR5+ TFH cells represent ~50% of tonsillar CD4+ T cells (Fig. 6a) and provide help to B cells in vitro (32, 44, 50, 51). However, the exact mechanism by which they induce B cell differentiation remains unknown. Because TFH cells express IL-21 (29, 30, 31, 32), we assessed the contribution of endogenously derived IL-21 to the ability of TFH cells to activate B cells. An in vitro system was established where tonsil CD4+CXCR5 (i.e., non-TFH) and CD4+CXCR5+ (i.e., TFH) cells were cocultured with autologous B cells and T cell mitogens. The CD4+CXCR5+ T cell population is comprised of CD57 and CD57+ subsets (Fig. 6a; Ref. 44). Thus, we assessed the functional activity of both CD57 and CD57+ TFH cells. In the presence of PHA and IL-2, both CXCR5+ T cell subsets induced Ig secretion from cocultured B cells, while CXCR5CD4+ T cells had little effect (Fig. 6b). For these reasons, we focused on total CXCR5+CD4+ T cells. Next, we examined the consequences of neutralizing IL-21 with an IL-21R-Fc fusion protein on the ability of activated TFH cells to induce B cell differentiation. Because the Fc portion of the fusion protein was from human IgG, the control for these experiments was human IgG1. Consequently, IgG secretion could not be analyzed in these cultures. The high levels of IgM and IgA (Fig. 6c) and number of ISC (not shown) induced by CXCR5+ T cells were reduced 4- to 5-fold by IL-21R-Fc. Although activated CD4+CXCR5 T cells induced Ig secretion and ISC at a level equalling ~10% of CXCR5+ T cells, their efficacy was also reduced ~5-fold by IL-21R-Fc (Fig. 6c). Because B cell differentiation is division linked, we examined the effect of neutralizing IL-21 on the proliferation of CFSE-labeled B cells. In the presence of PHA/IL-2-activated TFH cells, 68.2% of B cells underwent more than one division. However, only 48% of B cells were induced to proliferate by TFH cells when endogenous IL-21 was sequestered (Fig. 6d).


Figure 6
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 6. Tonsillar TFH cells induce B cell differentiation through an IL-21-dependent mechanism. a, Tonsil CD4+ T cells were labeled with mAb to CD57 and CXCR5; the percentage of cells with a CXCR5CD57, CXCR5+CD57, or CXCR5+CD57+ phenotype was determined. b, CXCR5CD57, CXCR5+CD57, and CXCR5+CD57+CD4+ T cells were isolated from human tonsils, treated with mitomycin C, and cocultured with purified autologous B cells in the presence of PHA, IL-2, or PHA and IL-2. Secretion of IgM, IgG, and IgA was determined after 10 days. c–e, Tonsil CXCR5 and CXCR5+ CD4+ T cells were cultured with autologous B cells alone (–) or in the presence of PHA/IL-2 with or without control hIgG1 or IL-21R-Fc. After 5 days, secretion of IgM and IgA (c), proliferation of CFSE-labeled B cells (d), and T cell size/blastogenesis (e) were determined.

 
TFH cells also express IL-21R (32). It was therefore possible that IL-21 acted in an autocrine manner to activate T cells, thereby indirectly mediating B cell differentiation. Therefore, we determined whether the activation status of cocultured T cells was affected by neutralizing IL-21. For this experiment, blastogenesis was used as a readout of T cell activation. When CD4+ T cells were cultured with B cells without PHA/IL-2, they retained the morphological characteristics of resting cells. However, PHA/IL-2 increased cell size (i.e., forward scatter) by ~60%, and this increase was unaffected by IL-21R-Fc (Fig. 6e). This suggests that TFH cell-derived IL-21 acts directly on B cells and that the production of IL-21 represents a major mechanism by which TFH cells mediates the differentiation of B cells into ISC.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Over the past 5 years, several studies have demonstrated that IL-21 can induce proliferation and differentiation of human and murine B cells stimulated through CD40 (25, 26, 28, 37, 49). The data presented here significantly extend these findings. We found that IL-21 induced the secretion of vast quantities of IgM, IgG, and IgA by all subsets of mature human B cells—transitional, naive, GC, IgM-memory and isotype switched memory—isolated from CB, PB, tonsils, and spleen. Although IL-21 can induce IgM and IgG (26, 28), this is the first description of its ability to induce IgA secretion by human B cells. Notably, IL-21 induced 20- to 1000-fold more Ig secretion by CD40L-stimulated B cells than IL-10 and yielded ISC from naive B cells, a function not exhibited by IL-10. This is a significant finding, because IL-10 has been considered the most potent cytokine for ISC differentiation from human B cells (12). The ability of IL-21 to induce differentiation of naive B cells into ISC suggests that IL-21 may have a major role in primary responses to Ag.

The copious quantities of Ig induced by naive, GC, and memory B cells stimulated with CD40L and IL-21 resulted from their rapid differentiation into ISC. Induction of Blimp-1 correlated with the ability of human B cells to become ISC following stimulation with appropriate cytokines. Thus, IL-21 induced Blimp-1 expression in CD40L-stimulated naive and memory B cells, while IL-10 induced Blimp-1 only in memory cells. The rates of differentiation of CD40L/IL-21-stimulated IgM memory and isotype-switched memory B cells into ISC and the levels of Ig secreted by these cells were comparable. This is consistent with our previous findings that the proliferation rates of these B cell subsets were equivalent and exceeded that of naive B cells (23, 38, 52). Together, these data highlight the functional similarities of IgM memory and switched memory B cells and emphasize that memory cells are not dependent on the acquisition of downstream Ig isotypes for them to respond more rapidly than naive B cells.

When IL-21 was used at saturating doses, IL-2 and/or IL-10 had little effect on CD40-induced B cell differentiation. However, the stimulatory effect of IL-21 was increased by these cytokines when IL-21 was used at suboptimal doses. The net effect was a 10-fold reduction in the amount of IL-21 required to induce Ig secretion and 2-to 5-fold more Ig secreted. This highlights the potential interplay of these cytokines in vivo. IL-21 also potently up-regulated CD25 expression on activated naive and memory human B cells, akin to the ability of IL-10 to induce greater expression of CD25 on memory than on naive B cells (23, 45). In contrast to IL-2 and IL-10, IL-4 potently inhibited the stimulatory effect of IL-21. Strikingly, this inhibitory effect was restricted to naïve—CB and transitional—B cells with only a minor effect on memory cells. The selective effect of IL-4 on naive B cells is consistent with the greater expression of IL-4R on naive B cells (19, 37). IL-4 achieved this inhibitory effect by suppressing the induction of Blimp-1, which is required for commitment to the ISC lineage (48). This may have been achieved by sustaining expression of PAX5, which directly represses Blimp-1 expression (53). The rationale for the inhibitory effect of IL-4 on naive B cells stimulated with CD40L/IL-21 is unclear. It may be a mechanism operative within a GC that facilitates naive B cells to continue undergoing affinity maturation before differentiating into ISC, whereas it would be advantageous to the host for memory B cells, which presumably acquired a high-affinity Ag-specific BCR following the initial immunizing event, to rapidly differentiate into ISC without the need for additional selection events. This would be consistent with the ability of PAX5 and Blimp-1 to induce and suppress, respectively, activation-induced cytidine deaminase, which is required for somatic mutation (48). A feature of memory B cells is their ability to undergo a more rapid and robust response than naive B cells following Ag encounter (1, 2, 23, 24). One mechanism facilitating this is the differential expression of cell cycle regulators resulting in an increased restriction of entry of naive cells into division than memory cells (52). The finding that CD40L/IL-21-stimulated naive and memory B cells exhibit differential sensitivity to the inhibitory effects of IL-4 reveals another mechanism that allows memory B cells to respond with more rapid kinetics to stimulation than naive B cells. By antagonizing the function of IL-4, it may be possible to improve the responses of naive B cells during primary immune reactions in cases of infection or vaccination or even in immunodeficient patients who lack memory B cells (38, 41, 54, 55).

The potency of IL-21 on B cell differentiation suggests it may have clinical application in immunodeficiency or a pathogenic role in autoimmunity and malignancy. First, TFH cells were found to provide help for B cell differentiation by producing IL-21. Interestingly, TFH cell function is impaired in patients with inherited immunodeficiencies (41, 55, 56). These patients are hypogammaglobulinemic, requiring regular Ig replacement therapy. Thus, controlled delivery of IL-21 may restore B cell differentiation in these patients. Second, because IL-21 is the most potent differentiation factor for human B cells and signals through {gamma}c, which is mutated in X-SCID (57), it is likely that an inability to signal through the IL-21R/{gamma}c complex, rather than other {gamma}c-containing B cell tropic cytokine receptors (IL-2R, IL-4R, IL-15R), underlies profound B cell dysfunction characteristic of X-SCID patients. In contrast, IL-21 is increased in several animal models of human autoimmunity (30, 31, 49, 55), and neutralizing IL-21 reduces the severity of disease in these models (58, 59). Together, these findings reveal a potential role for IL-21 in the pathogenesis of murine autoimmune diseases and, by inference, suggest that IL-21 production or function may be dysregulated in human humoral autoimmune diseases. Interestingly, serum levels of IL-21 were recently found to be increased in a cohort of Chinese patients with Sjögren’s syndrome (60). It will be important to confirm these findings and extend them to determine whether serum levels of IL-21 are increased in patients with other autoantibody-mediated diseases such as systemic lupus erythematosus and rheumatoid arthritis.

In addition to immunodeficiency and autoimmunity, IL-21-targeted therapies may be useful in treating angioimmunoblastic T cell lymphoma (AITL), a rare CD4+ T cell lymphoma (61, 62). Recent studies that examined malignant AITL cells recognized that they have many features of TFH cells. Specifically, normal TFH and malignant AITL cells express Bcl-6, CXCR5. and CD40L and produce CXCL13 (29, 32, 63, 64, 65, 66). Hallmarks of AITL are B cell activation, hyperplastic B cell follicles, and hypergammaglobulinemia (61, 62, 67). Furthermore, within reactive lymph nodes, malignant T cells closely associate with activated B cell follicles (62, 67). For this reason it has been proposed that constitutive production of CXCL13 and CD40L by malignant TFH cells results in increased recruitment of B cells into follicles, their aberrant activation, and subsequent hypergammaglobulinemia (65, 66). It is possible that CXCL13 produced by malignant TFH cells underlies the recruitment of large numbers of B cells into the reactive lymph nodes of AITL patients. However, given the potent effects of IL-21 on the human B cell differentiation, it is highly likely that production of IL-21 rather than CXCL13 by AITL cells causes the exaggerated B cell activation and hypergammaglobulinemia characteristic of this disease. Thus, disease severity may be reduced by neutralizing IL-21. In conclusion, our study identifies IL-21 as the most potent differentiation factor for human B cells irrespective of stage of development. The potential association of aberrant production of IL-21 and dysfunctional TFH cells with several different human diseases (31, 55) suggests that strategies aimed at increasing or decreasing IL-21 function may have therapeutic benefit for conditions including humoral immunodeficiency, B cell mediated autoimmune conditions, and CD4+ T cell malignancy.


    Acknowledgments
 
We thank the staff at LifeLink Australia and Royal Prince Alfred Hospital for providing human tissue and cord blood samples, the Centenary and Garvan Institute FACS facilities for cell sorting, Dr. Grant Shoebridge and Nathan Hare for preparing human CD40L, and Drs. Elissa Deenick and Phil Hodgkin for critical review of this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the National Health and Medical Research Council of Australia. V.L.B. and K.L.G. were recipients of Postgraduate Research Awards from the University of Sydney. K.L.G. was the recipient of a Cancer Institute New South Wales Research Scholar Award. C.S.M., L.M.C., and S.G.T. are recipients of Research Fellowships awarded by the National Health and Medical Research Council. Schering Plough BioPharma is wholly funded by Schering Plough. Back

2 Current address: Leonard Wagner Laboratory of Molecular Genetics and Immunology, Rockefeller University, New York, NY 10021. Back

3 Current address: Department of Laboratory Medicine, Yale University School of Medicine, New Haven, CT 06510. Back

4 Address correspondence and reprint requests to Dr. Stuart Tangye, Immunology and Inflammation Department, Garvan Institute of Medical Research, 384 Victoria Street, Darlinghurst 2010, New South Wales, Australia. E-mail address: s.tangye{at}garvan.org.au Back

5 Abbreviations used in this paper: PC, plasma cells; AITL, angioimmunoblastic T-cell lymphoma; Blimp-1, B lymphocyte-induced maturation protein-1; CB, cord blood; GC, germinal center; ISC, Ig-secreting cell; PB, peripheral blood; TFH, T follicular helper. Back

Received for publication August 13, 2007. Accepted for publication October 3, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature 381: 751-758. [Medline]
  2. Ahmed, R., D. Gray. 1996. Immunological memory and protective immunity: understanding their relation. Science 272: 54-60. [Abstract]
  3. Banchereau, J., F. Rousset. 1992. Human B lymphocytes: phenotype, proliferation, and differentiation. Adv. Immunol. 52: 125-262. [Medline]
  4. Defrance, T., B. Vanbervliet, I. Durand, J. Briolay, J. Banchereau. 1992. Proliferation and differentiation of human CD5+ and CD5 B cell subsets activated through their antigen receptors or CD40 antigens. Eur. J. Immunol. 22: 2831-2839. [Medline]
  5. Armitage, R. J., B. M. Macduff, M. K. Spriggs, W. C. Fanslow. 1993. Human B cell proliferation and Ig secretion induced by recombinant CD40 ligand are modulated by soluble cytokines. J. Immunol. 150: 3671-3680. [Abstract]
  6. Jelinek, D. F., P. E. Lipsky. 1988. Inhibitory influence of IL-4 on human B cell responsiveness. J. Immunol. 141: 164-173. [Abstract]
  7. Defrance, T., B. Vanbervliet, J. Pene, J. Banchereau. 1988. Human recombinant IL-4 induces activated B lymphocytes to produce IgG and IgM. J. Immunol. 141: 2000-2005. [Abstract]
  8. Rousset, F., E. Garcia, J. Banchereau. 1991. Cytokine-induced proliferation and immunoglobulin production of human B lymphocytes triggered through their CD40 antigen. J. Exp. Med. 173: 705-710. [Abstract/Free Full Text]
  9. Splawski, J. B., S. M. Fu, P. E. Lipsky. 1993. Immunoregulatory role of CD40 in human B cell differentiation. J. Immunol. 150: 1276-1285. [Abstract]
  10. Vernino, L., L. M. McAnally, J. Ramberg, P. E. Lipsky. 1992. Generation of nondividing high rate Ig-secreting plasma cells in cultures of human B cells stimulated with anti-CD3-activated T cells. J. Immunol. 148: 404-410. [Abstract]
  11. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, J. Banchereau. 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19: 225-234. [Medline]
  12. Rousset, F., E. Garcia, T. Defrance, C. Peronne, N. Vezzio, D. H. Hsu, R. Kastelein, K. W. Moore, J. Banchereau. 1992. Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc. Natl. Acad. Sci. USA 89: 1890-1893. [Abstract/Free Full Text]
  13. Briere, F., C. Servet-Delprat, J. M. Bridon, J. M. Saint-Remy, J. Banchereau. 1994. Human interleukin 10 induces naive surface immunoglobulin D+ (sIgD+) B cells to secrete IgG1 and IgG3. J. Exp. Med. 179: 757-762. [Abstract/Free Full Text]
  14. Rousset, F., S. Peyrol, E. Garcia, N. Vezzio, M. Andujar, J. A. Grimaud, J. Banchereau. 1995. Long-term cultured CD40-activated B lymphocytes differentiate into plasma cells in response to IL-10 but not IL-4. Int. Immunol. 7: 1243-1253. [Abstract/Free Full Text]
  15. Dubois, B., C. Massacrier, B. Vanbervliet, J. Fayette, F. Briere, J. Banchereau, C. Caux. 1998. Critical role of IL-12 in dendritic cell-induced differentiation of naive B lymphocytes. J. Immunol. 161: 2223-2231. [Abstract/Free Full Text]
  16. Punnonen, J., G. Aversa, B. G. Cocks, A. N. McKenzie, S. Menon, G. Zurawski, R. de Waal Malefyt, J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. USA 90: 3730-3734. [Abstract/Free Full Text]
  17. Armitage, R. J., B. M. Macduff, J. Eisenman, R. Paxton, K. H. Grabstein. 1995. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J. Immunol. 154: 483-490. [Abstract]
  18. Defrance, T., B. Vanbervliet, F. Briere, I. Durand, F. Rousset, J. Banchereau. 1992. Interleukin 10 and transforming growth factor β cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175: 671-682. [Abstract/Free Full Text]
  19. Wagner, E. F., N. Hanna, L. D. Fast, N. Kouttab, P. R. Shank, A. Vazquez, S. Sharma. 2000. Novel diversity in IL-4-mediated responses in resting human naive B cells versus germinal center/memory B cells. J. Immunol. 165: 5573-5579. [Abstract/Free Full Text]
  20. Arpin, C., J. Dechanet, C. Van Kooten, P. Merville, G. Grouard, F. Briere, J. Banchereau, Y. J. Liu. 1995. Generation of memory B cells and plasma cells in vitro. Science 268: 720-722. [Abstract/Free Full Text]
  21. Arpin, C., J. Banchereau, Y. J. Liu. 1997. Memory B cells are biased towards terminal differentiation: a strategy that may prevent repertoire freezing. J. Exp. Med. 186: 931-940. [Abstract/Free Full Text]
  22. Kindler, V., R. H. Zubler. 1997. Memory, but not naive, peripheral blood B lymphocytes differentiate into Ig-secreting cells after CD40 ligation and costimulation with IL-4 and the differentiation factors IL-2, IL-10, and IL-3. J. Immunol. 159: 2085-2090. [Abstract/Free Full Text]
  23. Tangye, S. G., D. T. Avery, E. K. Deenick, P. D. Hodgkin. 2003. Intrinsic differences in the proliferation of naive and memory human B cells as a mechanism for enhanced secondary immune responses. J. Immunol. 170: 686-694. [Abstract/Free Full Text]
  24. Tangye, S. G., D. T. Avery, P. D. Hodgkin. 2003. A division-linked mechanism for the rapid generation of Ig-secreting cells from human memory B cells. J. Immunol. 170: 261-269. [Abstract/Free Full Text]
  25. Parrish-Novak, J., S. R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J. A. Gross, J. Johnston, K. Madden, W. Xu, J. West, et al 2000. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408: 57-63. [Medline]
  26. Pene, J., J. F. Gauchat, S. Lecart, E. Drouet, P. Guglielmi, V. Boulay, A. Delwail, D. Foster, J. C. Lecron, H. Yssel. 2004. Cutting edge: IL-21 is a switch factor for the production of IgG1 and IgG3 by human B cells. J. Immunol. 172: 5154-5157. [Abstract/Free Full Text]
  27. Pene, J., L. Guglielmi, J. F. Gauchat, N. Harrer, M. Woisetschlager, V. Boulay, J. M. Fabre, P. Demoly, H. Yssel. 2006. IFN-{gamma}-mediated inhibition of human IgE synthesis by IL-21 is associated with a polymorphism in the IL-21R gene. J. Immunol. 177: 5006-5013. [Abstract/Free Full Text]
  28. Ettinger, R., G. P. Sims, A. M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, P. E. Lipsky. 2005. IL-21 induces differentiation of human naive and memory B cells into antibody-secreting plasma cells. J. Immunol. 175: 7867-7879. [Abstract/Free Full Text]
  29. Chtanova, T., S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, C. R. Mackay. 2004. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J. Immunol. 173: 68-78. [Abstract/Free Full Text]
  30. Vinuesa, C. G., M. C. Cook, C. Angelucci, V. Athanasopoulos, L. Rui, K. M. Hill, D. Yu, H. Domaschenz, B. Whittle, T. Lambe, et al 2005. A RING-type ubiquitin ligase family member required to repress follicular helper T cells and autoimmunity. Nature 435: 452-458. [Medline]
  31. Vinuesa, C. G., S. G. Tangye, B. Moser, C. R. Mackay. 2005. Follicular B helper T cells in antibody responses and autoimmunity. Nat. Rev. Immunol. 5: 853-865. [Medline]
  32. Rasheed, A. U., H. P. Rahn, F. Sallusto, M. Lipp, G. Muller. 2006. Follicular B helper T cell activity is confined to CXCR5hiICOShi CD4 T cells and is independent of CD57 expression. Eur. J. Immunol. 36: 1892-1903. [Medline]
  33. Cuss, A. K., D. T. Avery, J. L. Cannons, L. J. Yu, K. E. Nichols, P. J. Shaw, S. G. Tangye. 2006. Expansion of functionally immature transitional B cells is associated with human-immunodeficient states characterized by impaired humoral immunity. J. Immunol. 176: 1506-1516. [Abstract/Free Full Text]
  34. Sims, G. P., R. Ettinger, Y. Shirota, C. H. Yarboro, G. G. Illei, P. E. Lipsky. 2005. Identification and characterization of circulating human transitional B cells. Blood 105: 4390-4398. [Abstract/Free Full Text]
  35. Tangye, S. G., Y. J. Liu, G. Aversa, J. H. Phillips, J. E. de Vries. 1998. Identification of functional human splenic memory B cells by expression of CD148 and CD27. J. Exp. Med. 188: 1691-1703. [Abstract/Free Full Text]
  36. Klein, U., K. Rajewsky, R. Kuppers. 1998. Human immunoglobulin (Ig)M+IgD+ peripheral blood B cells expressing the CD27 cell surface antigen carry somatically mutated variable region genes: CD27 as a general marker for somatically mutated (memory) B cells. J. Exp. Med. 188: 1679-1689. [Abstract/Free Full Text]
  37. Good, K. L., V. L. Bryant, S. G. Tangye. 2006. Kinetics of human B cell behavior and amplification of proliferative responses following stimulation with IL-21. J. Immunol. 177: 5236-5247. [Abstract/Free Full Text]
  38. Ma, C. S., S. Pittaluga, D. T. Avery, N. J. Hare, I. Maric, A. D. Klion, K. E. Nichols, S. G. Tangye. 2006. Selective generation of functional somatically mutated IgM+CD27+, but not Ig isotype-switched, memory B cells in X-linked lymphoproliferative disease. J. Clin. Invest. 116: 322-333. [Medline]
  39. Avery, D. T., J. I. Ellyard, F. Mackay, L. M. Corcoran, P. D. Hodgkin, S. G. Tangye. 2005. Increased expression of CD27 on activated human memory B cells correlates with their commitment to the plasma cell lineage. J. Immunol. 174: 4034-4042. [Abstract/Free Full Text]
  40. Ellyard, J. I., D. T. Avery, T. G. Phan, N. J. Hare, P. D. Hodgkin, S. G. Tangye. 2004. Antigen-selected, immunoglobulin-secreting cells persist in human spleen and bone marrow. Blood 103: 3805-3812. [Abstract/Free Full Text]
  41. Ma, C. S., N. J. Hare, K. E. Nichols, L. Dupre, G. Andolfi, M. G. Roncarolo, S. Adelstein, P. D. Hodgkin, S. G. Tangye. 2005. Impaired humoral immunity in X-linked lymphoproliferative disease is associated with defective IL-10 production by CD4+ T cells. J. Clin. Invest. 115: 1049-1059. [Medline]
  42. Tangye, S. G., B. C. van de Weerdt, D. T. Avery, P. D. Hodgkin. 2002. CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur. J. Immunol. 32: 1640-1649. [Medline]
  43. Kallies, A., J. Hasbold, D. M. Tarlinton, W. Dietrich, L. M. Corcoran, P. D. Hodgkin, S. L. Nutt. 2004. Plasma cell ontogeny defined by quantitative changes in Blimp-1 expression. J. Exp. Med. 200: 967-977. [Abstract/Free Full Text]
  44. Kim, C. H., L. S. Rott, I. Clark-Lewis, D. J. Campbell, L. Wu, E. C. Butcher. 2001. Subspecialization of CXCR5+ T cells: B helper activity is focused in a germinal center-localized subset of CXCR5+ T cells. J. Exp. Med. 193: 1373-1381. [Abstract/Free Full Text]
  45. Fluckiger, A. C., P. Garrone, I. Durand, J. P. Galizzi, J. Banchereau. 1993. Interleukin 10 (IL-10) upregulates functional high affinity IL-2 receptors on normal and leukemic B lymphocytes. J. Exp. Med. 178: 1473-1481. [Abstract/Free Full Text]
  46. Suto, A., H. Nakajima, K. Hirose, K. Suzuki, S. Kagami, Y. Seto, A. Hoshimoto, Y. Saito, D. C. Foster, I. Iwamoto. 2002. Interleukin 21 prevents antigen-induced IgE production by inhibiting germ line C{epsilon} transcription of IL-4-stimulated B cells. Blood 100: 4565-4573. [Abstract/Free Full Text]
  47. Ozaki, K., R. Spolski, C. G. Feng, C. F. Qi, J. Cheng, A. Sher, H. C. Morse, III, C. Liu, P. L. Schwartzberg, W. J. Leonard. 2002. A critical role for IL-21 in regulating immunoglobulin production. Science 298: 1630-1634. [Abstract/Free Full Text]
  48. Calame, K. L., K. I. Lin, C. Tunyaplin. 2003. Regulatory mechanisms that determine the development and function of plasma cells. Annu. Rev. Immunol. 21: 205-230. [Medline]
  49. Ozaki, K., R. Spolski, R. Ettinger, H. P. Kim, G. Wang, C. F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, et al 2004. Regulation of B cell differentiation and plasma cell generation by IL-21, a novel inducer of Blimp-1 and Bcl-6. J. Immunol. 173: 5361-5371. [Abstract/Free Full Text]
  50. Breitfeld, D., L. Ohl, E. Kremmer, J. Ellwart, F. Sallusto, M. Lipp, R. Forster. 2000. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J. Exp. Med. 192: 1545-1552. [Abstract/Free Full Text]
  51. Schaerli, P., K. Willimann, A. B. Lang, M. Lipp, P. Loetscher, B. Moser. 2000. CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J. Exp. Med. 192: 1553-1562. [Abstract/Free Full Text]
  52. Good, K. L., S. G. Tangye. 2007. Decreased expression of Kruppel-like factors in memory B cells induces the rapid response typical of secondary antibody responses. Proc. Natl. Acad. Sci. USA 104: 13420-13425. [Abstract/Free Full Text]
  53. Mora-Lopez, F., E. Reales, J. A. Brieva, A. Campos-Caro. 2007. Human BSAP and BLIMP1 conform an autoregulatory feedback loop. Blood 110: 3150-3157. [Abstract/Free Full Text]
  54. Warnatz, K., A. Denz, R. Drager, M. Braun, C. Groth, G. Wolff-Vorbeck, H. Eibel, M. Schlesier, H. H. Peter. 2002. Severe deficiency of switched memory B cells (CD27+IgMIgD) in subgroups of patients with common variable immunodeficiency: a new approach to classify a heterogeneous disease. Blood 99: 1544-1551. [Abstract/Free Full Text]
  55. Ma, C. S., K. E. Nichols, S. G. Tangye. 2007. Regulation of cellular and humoral immune responses by the SLAM and SAP families of molecules. Annu. Rev. Immunol. 25: 337-379. [Medline]
  56. Bossaller, L., J. Burger, R. Draeger, B. Grimbacher, R. Knoth, A. Plebani, A. Durandy, U. Baumann, M. Schlesier, A. A. Welcher, et al 2006. ICOS deficiency is associated with a severe reduction of CXCR5+CD4 germinal center Th cells. J. Immunol. 177: 4927-4932. [Abstract/Free Full Text]
  57. Leonard, W. J.. 2001. Cytokines and immunodeficiency diseases. Nat. Rev. Immunol. 1: 200-208. [Medline]
  58. Young, D. A., M. Hegen, H. L. Ma, M. J. Whitters, L. M. Albert, L. Lowe, M. Senices, P. W. Wu, B. Sibley, Y. Leathurby, et al 2007. Blockade of the interleukin-21/interleukin-21 receptor pathway ameliorates disease in animal models of rheumatoid arthritis. Arthritis Rheum. 56: 1152-1163. [Medline]
  59. Herber, D., T. P. Brown, S. Liang, D. A. Young, M. Collins, K. Dunussi-Joannopoulos. 2007. IL-21 has a pathogenic role in a lupus-prone mouse model and its blockade with IL-21R: Fc reduces disease progression. J. Immunol. 178: 3822-3830. [Abstract/Free Full Text]
  60. Yuan, S. L., L. Jiang, X. L. Zhang, S. F. Li, H. M. Duan, X. F. Wang. 2007. Serum IL-21 level in patients with primary Sjogren’s syndrome and clinical significance of IL-21. Chin. J. Cell. Mol. Immunol. 23: 124-126.
  61. Frizzera, G., E. M. Moran, H. Rappaport. 1974. Angio-immunoblastic lymphadenopathy with dysproteinaemia. Lancet 1: 1070-1073. [Medline]
  62. Dogan, A., A. D. Attygalle, C. Kyriakou. 2003. Angioimmunoblastic T-cell lymphoma. Br. J. Haematol. 121: 681-691. [Medline]
  63. Ree, H. J., M. E. Kadin, M. Kikuchi, Y. H. Ko, J. Suzumiya, J. H. Go. 1999. Bcl-6 expression in reactive follicular hyperplasia, follicular lymphoma, and angioimmunoblastic T-cell lymphoma with hyperplastic germinal centers: heterogeneity of intrafollicular T-cells and their altered distribution in the pathogenesis of angioimmunoblastic T-cell lymphoma. Hum. Pathol. 30: 403-411. [Medline]
  64. De Leval, L., D. S. Rickman, C. Thielen, A. Reynies, Y. L. Huang, G. Delsol, L. Lamant, K. Leroy, J. Briere, T. Molina, et al 2007. The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood 109: 4952-4963. [Abstract/Free Full Text]
  65. Krenacs, L., P. Schaerli, G. Kis, E. Bagdi. 2006. Phenotype of neoplastic cells in angioimmunoblastic T-cell lymphoma is consistent with activated follicular B helper T cells. Blood 108: 1110-1111. [Free Full Text]
  66. Grogg, K. L., A. D. Attygalle, W. R. Macon, E. D. Remstein, P. J. Kurtin, A. Dogan. 2005. Angioimmunoblastic T-cell lymphoma: a neoplasm of germinal-center T-helper cells?. Blood 106: 1501-1502. [Free Full Text]
  67. Ree, H. J., M. E. Kadin, M. Kikuchi, Y. H. Ko, J. H. Go, J. Suzumiya, D. S. Kim. 1998. Angioimmunoblastic lymphoma (AILD-type T-cell lymphoma) with hyperplastic germinal centers. Am. J. Surg Pathol. 22: 643-655. [Medline]



This article has been cited by other articles:


Home page
Int ImmunolHome page
R. Spolski and W. J. Leonard
IL-21 and T follicular helper cells
Int. Immunol., November 23, 2009; (2009) dxp112v1.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Borte, Q. Pan-Hammarstrom, C. Liu, U. Sack, M. Borte, U. Wagner, D. Graf, and L. Hammarstrom
Interleukin-21 restores immunoglobulin production ex vivo in patients with common variable immunodeficiency and selective IgA deficiency
Blood, November 5, 2009; 114(19): 4089 - 4098.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. D. Henn, J. Rebhahn, M. A. Brown, A. J. Murphy, M. N. Coca, O. Hyrien, T. Pellegrin, T. Mosmann, and M. S. Zand
Modulation of Single-Cell IgG Secretion Frequency and Rates in Human Memory B Cells by CpG DNA, CD40L, IL-21, and Cell Division
J. Immunol., September 1, 2009; 183(5): 3177 - 3187.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-O. Yoon, X. Zhang, P. Berner, B. Blom, and Y. S. Choi
Notch Ligands Expressed by Follicular Dendritic Cells Protect Germinal Center B Cells from Apoptosis
J. Immunol., July 1, 2009; 183(1): 352 - 358.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Pistoia and C. Cocco
IL-21: a new player in the control of isotype switch in Peyer's patches
J. Leukoc. Biol., May 1, 2009; 85(5): 739 - 743.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Jang, S.-H. Cho, H. Park, D.-J. Paik, J. M. Kim, and J. Youn
A Positive Feedback Loop of IL-21 Signaling Provoked by Homeostatic CD4+CD25- T Cell Expansion Is Essential for the Development of Arthritis in Autoimmune K/BxN Mice
J. Immunol., April 15, 2009; 182(8): 4649 - 4656.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Eddahri, S. Denanglaire, F. Bureau, R. Spolski, W. J. Leonard, O. Leo, and F. Andris
Interleukin-6/STAT3 signaling regulates the ability of naive T cells to acquire B-cell help capacities
Blood, March 12, 2009; 113(11): 2426 - 2433.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Konforte, N. Simard, and C. J. Paige
IL-21: An Executor of B Cell Fate
J. Immunol., February 15, 2009; 182(4): 1781 - 1787.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. A. Bubier, T. J. Sproule, O. Foreman, R. Spolski, D. J. Shaffer, H. C. Morse III, W. J. Leonard, and D. C. Roopenian
A critical role for IL-21 receptor signaling in the pathogenesis of systemic lupus erythematosus in BXSB-Yaa mice
PNAS, February 3, 2009; 106(5): 1518 - 1523.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. L. Good, D. T. Avery, and S. G. Tangye
Resting Human Memory B Cells Are Intrinsically Programmed for Enhanced Survival and Responsiveness to Diverse Stimuli Compared to Naive B Cells
J. Immunol., January 15, 2009; 182(2): 890 - 901.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. G. Tangye, M. C. Cook, and D. A. Fulcher
Insights into the Role of STAT3 in Human Lymphocyte Differentiation as Revealed by the Hyper-IgE Syndrome
J. Immunol., January 1, 2009; 182(1): 21 - 28.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
R Ettinger, S Kuchen, and P E Lipsky
Interleukin 21 as a target of intervention in autoimmune disease
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii83 - iii86.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. M. Odegard, B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft
ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity
J. Exp. Med., November 24, 2008; 205(12): 2873 - 2886.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Scholz, J. E. Crowley, M. M. Tomayko, N. Steinel, P. J. O'Neill, W. J. Quinn III, R. Goenka, J. P. Miller, Y. H. Cho, V. Long, et al.
BLyS inhibition eliminates primary B cells but leaves natural and acquired humoral immunity intact
PNAS, October 7, 2008; 105(40): 15517 - 15522.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. T. Avery, V. L. Bryant, C. S. Ma, R. de Waal Malefyt, and S. G. Tangye
IL-21-Induced Isotype Switching to IgG and IgA by Human Naive B Cells Is Differentially Regulated by IL-4
J. Immunol., August 1, 2008; 181(3): 1767 - 1779.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Tomayko, S. M. Anderson, C. E. Brayton, S. Sadanand, N. C. Steinel, T. W. Behrens, and M. J. Shlomchik
Systematic Comparison of Gene Expression between Murine Memory and Naive B Cells Demonstrates That Memory B Cells Have Unique Signaling Capabilities
J. Immunol., July 1, 2008; 181(1): 27 - 38.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits
STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation
J. Immunol., April 1, 2008; 180(7): 4805 - 4815.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bryant, V. L.
Right arrow Articles by Tangye, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bryant, V. L.
Right arrow Articles by Tangye, S. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS