|
|
||||||||
,

,
* Neuroimmunology Unit, Department of Neurology, University Hospital Zurich, Zurich, Switzerland;
Ludwig Institute for Cancer Research, Brussels, Belgium;
Christian de Duve Institute of Cellular Pathology, Université Catholique de Louvain, Brussels, Belgium;
Hôpital Pitié Salpetrière, Université Pierre et Marie Curie, Institut National de la Santé et de la Recherche Médicale Unité 543, Paris, France; and
¶ Institute of Neuropathology, University Hospital Zurich, Zurich, Switzerland
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Th17 cells have received much attention lately and mice lacking IL-17A were found to be moderately resistant to EAE (10). However, in contrast to IL-17A–/– mice, IL-23-deficient mice are completely EAE resistant (1, 2). Thus, we reasoned that IL-17A is unlikely to be the only factor produced by Th17 cells involved in the inflammatory process. To identify the expression signature of IL-23-driven genes, we used high-density transcriptomics and identified IL-22 to be induced by IL-23 in autoimmune-pathogenic CD4+ T cells in a time- and dose-dependent manner. IL-22 belongs to the IL-10 superfamily of cytokines and exhibits—unlike IL-10—potent proinflammatory properties. Its recently reported role in psoriasis (11, 12, 13) combined with our finding that IL-22 is specifically induced by IL-23 points toward a relevant function of IL-22 in autoimmune inflammatory diseases. Bettelli et al. (14) further reported that IL-22 marks a particularly pathogenic population of autoreactive T cells implicating IL-22 as a major pathogenic cytokine during CNS inflammation. In addition the IL-22 gene, together with IL-26 and IFN-
on the human chromosome 12q14, are considered a prominent susceptibility locus for MS (15). We found that following IL-23 stimulation, IL-22 is specifically secreted by pathogenic Th cells. To determine the actual role of this cytokine in autoimmune inflammation, we generated IL-22–/– mice, which were found to be surprisingly fully susceptible to EAE. We show that self-reactive Th cells coexpress IL-17 and IL-22, but that the latter does not appear to be directly involved in autoimmune pathogenesis of the CNS.
| Materials and Methods |
|---|
|
|
|---|
Myelin oligodendrocyte glycoprotein (MOG)35–55 peptide (MEVGWYRSPFSRVVHLYRNGK) and OVA323–339 (ISQAVHAAHAEINEAGR) were obtained from Research Genetics. All recombinant cytokines were purchased from PeproTech and all Abs were purchased from BD Biosciences. The Ab to murine IL-22 was provided by Genentech and labeled with Alexa 488 (Invitrogen Life Technologies) according to the manufacturers directions.
Mice and induction of EAE
C57BL/6 mice, IL-12 p35–/–, and IL-12 p40–/– mice on a C57BL/6 background were purchased from The Jackson Laboratory and were bred under specific pathogen-free conditions. The 2D2 (MOG-TCR-transgenic (Tg)) mice were provided by V. Kuchroo (Harvard Medical School, Boston, MA). IL-22–/– mice were generated by targeting exons 1–3 and backcrossed onto C57BL/6 for more than eight times. The targeting vector was constructed to replace the exons 1a, 1b, 2, and a part of exon 3 of the IL-22a gene by a neomycin-resistant gene. A 5' arm of 1521 bp was amplified using a mutated sense primer with a XhoI site 5'-CTTCGGCTCGAGATGGCCAC-3' a mutated antisense primer containing also a XhoI site 5'-GCCCTCGAGACACCAGGGTT-3' to allow the direct insertion into the pPNT vector. The 3' arm consisted of a 3559-bp KpnI fragment, containing the end of exon 3 and exon 4, and was cloned. For genotyping, the targeted gene was amplified using a sense primer located upstream the 5' arm: 5'-CTGCTGTCCAACAGAGCTCT-3' and antisense primer on neomycin gene: 5'-CGCCTCCCCTACCCCGGTAGA-3', resulting in a 1.7-kb amplified sequence. The wild-type (wt) gene was amplified using a sense primer located into the 5' arm 5'-AATCTATGAAGTTGGTGGGA-3' and an antisense primer located on exon 2 5'-ACTGACTCCTCGGAACAGTT-3', resulting in a 1.2-kb amplified sequence. Mouse IL-22 RT-PCR was performed as previously described (16). EAE was induced and scored as described (17).
Histology and flow cytometry
Whole mouse brains or spinal columns were fixed in 4% paraformaldehyde in PBS, paraffin-embedded, cut and stained with H&E and Luxol-Nissl according to standard protocols. Immunohistochemical stainings on serial sections using Abs to neurofilament protein (NF, 200 kDa subunit; 1:20; Bio-Science), Iba1 (1:100; Wako Chemicals), CD3 (1:150; Labvision), and B220 (1:1000; BD Biosciences) were conducted on an automated Nexus staining apparatus (Ventana Medical Systems), following the manufacturers guidelines.
CNS-infiltrating lymphocytes were isolated as described previously (4). For flow cytometry, Abs were incubated with cells for 20 min at 4°C and then cells were analyzed with a FACSCalibur (BD Pharmingen) and FACSDiva software. Postacquisition analysis was done with FACSDiva (BD Pharmingen) or FlowJo7 software (Tree Star). For intracellular cytokine staining, cells were restimulated with 50 ng/ml PMA, 500 ng/ml ionomycin, and GolgiPlug (BD Biosciences) for 5 h. Cells were first stained for surface Ags and then permeabilized with Cytofix/Cytoperm (BD Biosciences) according to the manufacturers recommendations. Intracellular cytokine staining was performed using Abs to IFN-
, IL-17A, or IL-22 as described above.
Cell culture and in vitro assays
Mice were sacrificed using CO2, axillary and inguinal lymph nodes (LN) and spleens were collected and treated with 0.5 mg/ml DNase and 1 mg/ml Liberase (Roche) for 30 min at 37°C. Cells were cultured in RPMI 1640 supplemented with 10% FCS, 50 U/ml penicillin, and 50 µg/ml streptomycin (Invitrogen Life Technologies) in the presence or absence of the factors indicated in the figure legends and harvested at indicated time points. Where indicated, T cells were purified from splenocytes by magnetic cell sorting with MACS Beads following the manufacturers recommendation (Miltenyi Biotec).
Bone marrow (BM)-derived dendritic cells (DCs) were generated as described (4). To mature DCs, 10 µg/ml LPS (Fluka) was added to the culture for 24 h. Mature DCs were pulsed with 5 µg/ml peptide for 4 h, washed extensively, and incubated with splenocytes at a ratio of 1:4 and harvested after 48 h.
Cytokine analysis
ELISA for IL-17A (BD Pharmingen) and IL-22 (Antigenix) were performed according to the manufacturers instructions. Proliferation of MOG-reactive cells were stimulated in triplicate for 48 h with either 50 µg/ml MOG35–55, 5 µg/ml Con A, or medium, and 0.5 µCi/ml [3H]thymidine was added after 24 h for assessment of proliferative responses. Thymidine incorporation was assessed with a Filtermate Collecter (Applied Biosystems) and a scintillation and luminescence counter.
Real-time RT-PCR
Cells or tissues were homogenized in 1 ml of TRIzol reagent (Invitrogen Life Technologies). Total RNA was extracted and reverse transcription was performed using random hexamer primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies). After PCR amplification using SYBR Green PCR master mix (Invitrogen Life Technologies), quantitative values of each sample were normalized to its β-actin content and converted to relative cDNA quantities by comparison to a standard curve generated with dilutions of β-actin plasmid. Primers were purchased from Operon Technologies. The primers used were: (5'–3') β-actin forward (fw): agagggaaatcgtgcgtgac, β-actin reverse (rev): caatagtgatgacctggccgt; IL-22 fw: ttgaggtgtccaacttccagca, IL-22 rev: agccggacgtctgtgttgtta; IL-17 fw: atcaggacgcgcaaacatga, IL-17 rev: ttggacacgctgag ctttga.
| Results |
|---|
|
|
|---|
To elucidate the identity of IL-23-driven gene transcripts, we devised two reciprocal approaches for whole genome transcriptomics. We compared gene expression induced by IL-23 stimulation with those absent in Ag-driven IL-23-deficient (p40–/–) lymphocytes. In the first approach, genes up-regulated (>4-fold) by IL-23 were identified by stimulating splenocytes obtained from an unmanipulated mouse with recombinant IL-23 or IL-12 as a control. In the second approach, we immunized wt, IL-12p35–/–, and IL-12/23p40–/– mice with keyhole limpet hemocyanin and 7 days postinfection harvested lymphocytes and rechallenged them in vitro with keyhole limpet hemocyanin before harvesting the mRNA for microchip analysis (Affymetrix chip MOE430A). We used IL-12 as a control, first because IL-12-induced gene expression is well-characterized, and second to eliminate IL-12-induced target genes from our analysis. By combining both data sets, we found IL-22 to be specifically and strongly induced by IL-23 (data not shown).
To verify that IL-22 expression is specifically induced by IL-23, we treated splenocytes derived from unmanipulated C57BL/6 mice with an array of different stimuli, harvested the mRNA and measured IL-22 and IL-17A protein expression by ELISA (Fig. 1A). Other than IL-23, none of the used substances elicited significant levels of IL-22 and IL-17 expression in splenocytes after 24 h of stimulation. Different concentrations of the different stimuli were used (data not shown). Our data show that a population of splenocytes present in naive pathogen-free C57BL/6 mice respond to IL-23R engagement with IL-22 and IL-17 expression. To further characterize the kinetics and dose dependence of IL-23-induced IL-22 production, we stimulated wt lymphocytes obtained from an untreated mouse with IL-23 for different periods of time or in the presence of different concentrations of IL-23 and observed that IL-22 expression is induced in a time- and dose-dependent manner (Fig. 1B). We observed a similar expression pattern with IL-17 (data not shown). To verify the notion that Th cells and not CTLs are the main source of IL-22, we stimulated purified CD4+ as well as CD8+ T cells obtained from OVA TCR-Tg mice (OT-II and OT-I, respectively) with cognate peptide pulsed DCs for 24 h and found that only TCR-Tg CD4+ T cells made IL-22 (Fig. 1C). By intracellular cytokine staining of Th17 cells, we could show that >90% of IL-22-secreting cells also produce IL-17, while fewer IFN-
-secreting cells coexpress IL-22 (20%) (Fig. 1D). To identify whether IL-23 stimulates the secretion of IL-22 by naive or memory T cells, we purified memory T cells (CD62Llow) and naive T cells (CD62Lhigh) followed by an overnight stimulation with IL-23. Our data confirm that IL-23 primarily drives the memory T cell pool and does not influence the naive pool in regards to cytokine secretion measured (Fig. 1E).
|
To determine the induction of IL-22 and IL-17A expression in a more physiologic manner in response to cognate Ag, we isolated T cells from MOG-reactive TCR-Tg (2D2) mice and stimulated them with MOG35–55 or control peptide-pulsed mature BM-derived DCs obtained from wt, IL-12p35–/–, or IL-12/23p40–/– mice. IL-22 and IL-17A expression was subsequently measured by ELISA. MOG-reactive T cells clearly expressed high levels of IL-22 and IL-17A after encounter with their cognate Ag (Fig. 2). This response is dependent on IL-23 as reduced levels of IL-22 and IL-17 were detectable when T cells were cocultured with DCs obtained from IL-12/23p40–/– mice. We have also performed this restimulation experiment using polyclonal effector T cells isolated from MOG-immunized wt mice and confirmed that the expression of IL-22 and IL-17 is dependent on the secretion of IL-23 by APCs (data not shown).
|
and IL-17 to be expressed by splenocytes and CNS-invading lymphocytes. Most importantly, we detected a significant production of IL-22 by encephalitogenic, CNS-infiltrating lymphocytes after re-encounter with their cognate MOG Ag in vitro. Kinetic analysis of IL-22 secretion was performed by sacrificing mice at different time points after immunization with MOG/CFA. Similar to IFN-
and IL-17, IL-22 expression by CNS-infiltrating lymphocytes increased with disease severity (Fig. 3B). To study which population of polarized Th cells secrete IL-22 in peripheral organs and the inflamed CNS, we immunized C57BL/6 mice with MOG/CFA and harvested spleen, LNs, and CNS at the peak of clinical EAE (average score of 3). The mononuclear cells were then restimulated with MOG35–55 followed by intracellular cytokine staining. Cytofluorometric analysis revealed that in spleen and LN, there is a high overlap of IL-17- and IL-22-secreting T cells, while in the inflamed CNS, IL-17-secreting cells dominate over IL-22 and IL-17/22-secreting T cells (Fig. 3C).
|
Given the clear expression pattern of IL-22 associated with pathogenic Th17 cells, we sought to investigate whether IL-22 plays a role in inflammation of the CNS. To do so, we generated IL-22–/– mice by replacing the coding exons 1a, 1b, 2, and a part of exon 3 of the IL-22 gene with a neomycin-resistant gene (Fig. 4A) and verified the absence of IL-22 by genomic PCR, RT-PCR, and ELISA (Fig. 4, A and B, and data not shown). The mice do not display any obvious malformation of the hemopoietic system and developed normally (Tables I–III). When we analyzed the proliferating capacity as well as the cytokine expression profile of IL-22–/– cells after re-encounter with MOG35–55 by thymidine incorporation or ELISA, respectively, we observed that they behaved similar to wt cells (Fig. 4, C and D).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
However, despite this close correlation (3, 6, 7), several questions regarding their actual effector function remain unanswered. Foremost, the fact that IL-23 is absolutely vital for the development of autoimmune disease, whereas IL-17A alone has only a moderate impact (10), raises the question whether additional thus far unidentified IL-23-driven cytokines have pathogenic properties. We sought to resolve this question by the global analysis of IL-23-induced genes in lymphocytes. We discovered IL-22 to be the most prominent gene expressed by Th cells after IL-23 treatment. We further found that self-reactive Th cells required the presence of IL-23 for IL-22 production and that IL-23-deficient APCs were not able to properly induce IL-22 by stimulation of a population of MOG-reactive T cells. In agreement with Liang et al. (18), we found IL-22 to be highly expressed by Th17 cells. This suggested that IL-22 could potentially serve a pathogenic function during EAE. To this end, we performed a longitudinal analysis of IL-22 expression during EAE and found a strong correlation between T cell pathogenicity and IL-22 secretion. Bettelli et al. (14) recently claimed that IL-22 expression "marks" a highly pathogenic and proinflammatory population of autoaggressive T cells, heavily implicating IL-22 to exert a pathogenic function during EAE. Also, the receptor for IL-22, a heterodimer of the IL-10R2 and IL-22R1, like the IL-17A receptor is found primarily on stroma cells including endothelial cells, epithelial cells, and CNS-resident astrocytes (12, 14, 19). The close association of IL-22 and IL-17 in pathogenic Th cells, their inducibility by IL-23, and the fact that their receptors are expressed by similar cell types, implies that IL-22 too serves a proinflammatory pathogenic role in CNS inflammatory disease.
To determine whether IL-22 actually contributes to the development of EAE or whether the crisp correlation between IL-22 expression and encephalitogenicity is only an epiphenomenon, we generated IL-22–/– mice by gene targeting. To our surprise, we discovered that IL-22–/– mice develop EAE with the same severity, day of onset, and clinical manifestations as wt mice. This finding clearly dismisses IL-22 as a major pathogenic player in the development of autoimmune CNS inflammation. The function of IL-22 in autoimmunity, however, cannot be dismissed altogether. Wolk et al. (11) reported that elevated levels of IL-22 can be found in the blood of psoriatic patients and ear-skin acanthosis and inflammation induced by the application of IL-23 is slightly decreased when IL-22 is absent (11, 13).
Taken together, the notion that a cytokine is considered to have pathogenic functions cannot be based on its mere presence in a potentially pathogenic population of T cells. This line of thought had lead to a biased interpretation of the role and function of Th1 and Th2 cells in the context of autoimmune disease (5, 20, 21, 22). We were able to identify such a proinflammatory factor, namely IL-22, which is like IL-17A closely associated with an encephalitogenic phenotype. However, the fact that IL-22–/– mice develop severe EAE indicates that IL-22, just like IFN-
, is not among the proinflammatory factors mediating the tissue damage seen in EAE. The requirement of the transcription factors which drive Th1 and Th17 polarization (T-BET and ROR-
T, respectively) indicates that features, other than the main cytokines produced, are responsible for their pathogenic behavior. Although Th17 cells secrete IL-17 as well as IL-22, the report by Kebir et al. (23) suggests that cytolytic enzymes and factors that alter the integrity of the blood-brain barrier may be responsible for the encephalitogenicity of human Th17/22 cells. It is however likely that among the genes expressed by Th17 cells, a number of them may turn out to serve as biomarkers if not therapeutic targets in the treatment of autoimmune diseases in general and MS in particular.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Swiss National Science Foundation (to B.B.), the National Center for Competence in Research (to B.B.), the Swiss Multiple Sclerosis Society (to B.B.), Serono Pharmaceuticals Geneva (to B.B.), the Center for Neuroscience Research in Zurich (to K.K.), the Belgian Federal Service for Scientific, Technical, and Cultural Affairs, by the Actions de Recherche Concertées of the Communauté Française de Belgique (to J.-C.R.) and the Fonds National de la Recherche Scientifique, Belgium (to J.-C.R.), and the National Multiple Sclerosis Society (Harry Weaver Neuroscience Scholar; to B.B.). ![]()
2 Current address: Medical Research Council Human Immunology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, OX3 9DS, Oxford, U.K. ![]()
3 R.E. and L.D. contributed equally to this work. ![]()
4 J.-C.R. and B.B. contributed equally to the work. ![]()
5 Address correspondence and reprint requests to Dr. Burkhard Becher, Division of Neuroimmunology, Neurology Department, University Hospital, University of Zurich, Winterthurer Strasse 190, CH-8057, Zurich, Switzerland. E-mail address: burkhard.becher{at}neuroimm.unizh.ch ![]()
6 Abbreviations used in this paper: MS, multiple sclerosis; EAE, experimental autoimmune encephalomyelitis; MOG, myelin oligodendrocyte glycoprotein; Tg, transgenic; wt, wild type; LN, lymph node; BM, bone marrow; DC, dendritic cell. ![]()
Received for publication June 8, 2007. Accepted for publication October 7, 2007.
| References |
|---|
|
|
|---|
is required for autoimmune inflammation. Nat. Immunol. 7: 946-953. [Medline]
(IFNG) that is involved in male versus female differential susceptibility. Genes Immun. 3: 470-476. [Medline]
2 and comparison with its human counterpart. Genes Immun. 5: 330-336. [Medline]This article has been cited by other articles:
![]() |
R. Dhiman, M. Indramohan, P. F. Barnes, R. C. Nayak, P. Paidipally, L. V. M. Rao, and R. Vankayalapati IL-22 Produced by Human NK Cells Inhibits Growth of Mycobacterium tuberculosis by Enhancing Phagolysosomal Fusion J. Immunol., November 15, 2009; 183(10): 6639 - 6645. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Minegishi, M. Saito, M. Nagasawa, H. Takada, T. Hara, S. Tsuchiya, K. Agematsu, M. Yamada, N. Kawamura, T. Ariga, et al. Molecular explanation for the contradiction between systemic Th17 defect and localized bacterial infection in hyper-IgE syndrome J. Exp. Med., June 8, 2009; 206(6): 1291 - 1301. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Siegemund, N. Schutze, S. Schulz, K. Wolk, K. Nasilowska, R. K. Straubinger, R. Sabat, and G. Alber Differential IL-23 requirement for IL-22 and IL-17A production during innate immunity against Salmonella enterica serovar Enteritidis Int. Immunol., May 1, 2009; 21(5): 555 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ciric, M. El-behi, R. Cabrera, G.-X. Zhang, and A. Rostami IL-23 Drives Pathogenic IL-17-Producing CD8+ T Cells J. Immunol., May 1, 2009; 182(9): 5296 - 5305. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hamada, M. d. l. L. Garcia-Hernandez, J. B. Reome, S. K. Misra, T. M. Strutt, K. K. McKinstry, A. M. Cooper, S. L. Swain, and R. W. Dutton Tc17, a Unique Subset of CD8 T Cells That Can Protect against Lethal Influenza Challenge J. Immunol., March 15, 2009; 182(6): 3469 - 3481. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gonzalez-Garcia, Y. Zhao, S. Ju, Q. Gu, L. Liu, J. K. Kolls, and B. Lu IL-17 Signaling-Independent Central Nervous System Autoimmunity Is Negatively Regulated by TGF-{beta} J. Immunol., March 1, 2009; 182(5): 2665 - 2671. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Minegishi and H. Karasuyama Defects in Jak-STAT-mediated cytokine signals cause hyper-IgE syndrome: lessons from a primary immunodeficiency Int. Immunol., February 1, 2009; 21(2): 105 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, B. Liu, A. Maminishkis, S. P. Mahesh, S. Yeh, J. Lew, W. K. Lim, H. N. Sen, G. Clarke, R. Buggage, et al. Gene Expression Profiling in Autoimmune Noninfectious Uveitis Disease J. Immunol., October 1, 2008; 181(7): 5147 - 5157. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ochoa-Reparaz, A. Rynda, M. A. Ascon, X. Yang, I. Kochetkova, C. Riccardi, G. Callis, T. Trunkle, and D. W. Pascual IL-13 Production by Regulatory T Cells Protects against Experimental Autoimmune Encephalomyelitis Independently of Autoantigen J. Immunol., July 15, 2008; 181(2): 954 - 968. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |