The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 6845-6855
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Komen, J. S.
Right arrow Articles by Rodgers, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Komen, J. S.
Right arrow Articles by Rodgers, W.

Early and Dynamic Polarization of T Cell Membrane Rafts and Constituents Prior to TCR Stop Signals1

Jeffrey S. Van Komen*, Sudha Mishra*, Jennifer Byrum*, Gurunadh R. Chichili*, Jane C. Yaciuk{dagger},{ddagger}, A. Darise Farris{dagger},{ddagger},§ and William Rodgers2,*,{ddagger},§

* Cardiovascular Biology Research Program; {dagger} Arthritis and Immunology Program, Oklahoma Medical Research Foundation, {ddagger} Department of Microbiology and Immunology; § Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Polarization of membrane rafts and signaling proteins to form an immunological synapse is a hallmark of T cell stimulation. However, the kinetics of raft polarization and associated proteins in relation to the initial contact of the T cell with the APC are poorly defined. We addressed this question by measuring the distribution of membrane-targeted fluorescent protein markers during initial T cell interactions with B cell APCs. Experiments with unpulsed B cells lacking cognate Ag demonstrated an MHC class II-independent capping that was specific to membrane raft markers and required actin rearrangements and signals from Src kinases and PI3K. By live cell imaging experiments, we identified a similar specific polarization of membrane raft markers before TCR-dependent stop signals, and which occurred independently of cognate peptide-MHC class II. T cells conjugated to unpulsed B cells exhibited capping of CD4 and microclusters of the TCR {zeta}-chain, but only the CD4 enrichment was cholesterol dependent. Furthermore, raft association of CD4 was necessary for its efficient targeting to the Ag-independent caps. Interestingly, anergic Vβ8+ T cells isolated from staphylococcal enterotoxin B-injected mice did not exhibit Ag-independent capping of membrane rafts, showing that inhibition of these early, Ag-independent events is a property associated with tolerance. Altogether, these data show that membrane raft capping is one of the earliest events in T cell activation and represents one avenue for promoting and regulating downstream peptide-MHC-dependent signaling within the T cell.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Stimulation of T cells by the peptide-MHC (pMHC)3 complex results in a large-scale reorganization of the plasma membrane, culminating in a morphologically distinct region termed the immunological synapse (IS). The IS exhibits unique biological and physical properties (1, 2, 3), including an enrichment of the glycolipid-enriched membrane "rafts" (4, 5, 6, 7). Polarization of rafts at the IS occurs through their association with the underlying actin cytoskeleton (8, 9, 10), and the rafts represent one mechanism for targeting molecules to the TCR for cell signaling (5, 6, 11).

Membrane rafts contain signaling proteins, and one model is that they serve as a platform for hosting signaling events in the plasma membrane (12). Consistent with this hypothesis, disrupting membrane rafts by extracting cholesterol inhibits cell activation (13, 14), although this may represent a nonspecific inhibition from perturbing cell membranes (15). In T cells, rafts are enriched with molecules that function in TCR-proximal signaling, including Lck, Fyn, CD4, and linker for activation of T cells (LAT) (16, 17, 18, 19). In many cases, this association is necessary for TCR signaling to occur and the IS to form (18, 20, 21). Interestingly, in anergic T cells, LAT is excluded from membrane rafts and it fails to enrich in the IS, and this coincides with a failure of these cells to respond to Ag (22).

The important role of membrane rafts in T cell signaling raises questions regarding the kinetics with which they concentrate in the T cell plasma membrane during Ag stimulation. For example, engagement of the TCR with pMHC is typically preceded by serial and transient interactions between motile T cells and surrounding APCs as T cells scan their environment for Ag (23, 24, 25). When Ag is present, stop signals from the TCR halt the T cell, resulting in continued adhesion to an APCs and sustained T cell stimulation (23). However, it is not established whether interactions between the T cell and APCs before the TCR stop signal are sufficient to polarize the T cell rafts and associated signaling molecules. Significantly, one earlier study showed capping of membrane proteins in T cells bound to dendritic cells in the absence of cognate Ag (26). However, the mechanism of the capping and its kinetics in relation to Ag-dependent signaling was not determined. Importantly, polarization of T cell rafts early during interactions with the APCs is one potential avenue for promoting or regulating T cell activation.

Using fluorescence imaging of T cells labeled with membrane-anchored fluorescent proteins and interacting with B cell APCs, we show that a specific capping of membrane raft markers in primary and effector T cells takes place due to Ag-independent signals and before TCR stop signals. The Ag-independent capping is actin dependent and requires Src family kinase and PI3K activity. Furthermore, T cell anergy inhibits the Ag-independent capping. Altogether, these data identify the kinetics of T cell raft capping during early encounters with APCs and identifies an Ag-independent capping of T cell rafts as an early step in cell activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell culture and preparation

D10 T cells and CH27 B cells were maintained as described previously (27). All mice were purchased from The Jackson Laboratory. Primary T cells collected from spleens of B10.BR mice were enriched using nylon wool. Briefly, harvested cells were first passed through a 70-µm nylon cell strainer, followed by one wash with 0.14 M NH4Cl in 17 mM Tris (pH 7.2) and two washes with complete medium containing DMEM supplemented with 10% FCS and 0.01% 2-ME. The cells were then applied to a prepared nylon wool column, incubated for 1 h at 37°C, and then eluted using complete medium. MHC II–/– B cells were isolated by negative selection (StemCell Technologies) from the spleen of MHC-deficient mice (strain B6.129-H2d1Ab1-Ea/J), which lack the entire MHC class II (MHC II) locus (28).

Gene construction and expression

L10-GFP and S15-GFP in pWay20 have been described elsewhere (29). Cherry-labeled actin was provided by Dr. D. Knecht (University of Connecticut, Storrs, CT). A fusion protein containing the pleckstrin homology (PH) domain of Akt fused to the C terminus of enhanced GFP (GFP-PHAkt) was cloned by amplifying the sequence encoding the PH domain of Akt using RT-PCR (iScript cDNA Synthesis Kit; Bio-Rad). Mouse total RNA was the template and the primers were: AACAACAACAACAACCCGATCACCATCAACAACTTCCGT (coding), and CTAATTCATGGTCACGCGGTGCTTGG (noncoding). The PHAkt PCR product was subcloned into the SmaI site of the GFP expression vector pWay20 (30). CD4 fusion genes containing CFP were generated by subcloning PCR amplification products into the SmaI site of pWay20_cyan fluorescent protein (CFP), which contains the enhanced GFP coding sequence of pWay20 replaced with that of CFP. Wild-type CD4 and the C422,424S mutant were amplified using cDNA provided by Dr. J. K. Rose (Yale University School of Medicine, New Haven, CT) as the template and the following primers: AGAATGAACCGGGGAGTCCCTTT (coding) and AATGGGGCTACATGTCTTCT (noncoding). A tailless CD4 encoding residues 1 through 418 and lacking the membrane proximal palmitoylation sites was generated using the above coding primer and the following primer for the noncoding strand: GAAGAAGATGCCTAGCCCAA. The TCR {zeta}-chain-YFP fusion gene was constructed by first amplifying DNA encoding {zeta}-chain by RT-PCR using mouse total RNA as the template. The primers used for the amplification were: ACATCATCTAGAATGAAGTGGAAAGTGTCT (coding) and TCTAGTGAATTCGTTGTTGTTGTTGTTGAGCTGGGAGCTGCTACT (noncoding). The underlined residues represent an XbaI and EcoRI site that was introduced into the coding and noncoding primers, respectively. Following amplification, the product was subcloned into pcDNA3.1 (Invitrogen Life Technologies) using the XbaI and EcoRI sites of the vector. DNA encoding YFP was placed downstream and in-frame to {zeta}-chain, flanked by the XbaI and KpnI sites of the vector. Primers used for amplifying YFP have been described previously (11). All clones were verified by DNA sequencing.

Cell conjugation

T cell-B cell conjugates were prepared as described elsewhere (27). For stimulation of D10 T cells with conalbumin-pulsed B cells, CH27 B cells were pulsed with Ag and incubated with D10 T cells as previously described (27). Pretreatments of D10 cells included the following: 10 µM 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2; Calbiochem) for 15 min, 10 µM wortmannin (Calbiochem), 5 µM latrunculin B (Lat B; Calbiochem) for 1 h, 10 mM methyl-β-cyclodextrin (MβCD; Sigma-Aldrich) for 30 min, and 5 µg/ml filipin (Sigma-Aldrich) for 30 min. All pretreatments were performed at 37°C at a cell density of 107/ml in RPMI 1640 containing 50 mM HEPES (pH 7.4). Additions were made from 100x stock solutions in DMSO. Blocking of I-Ak in CH27 cells was performed by incubating 106 cells with 1.5 µg of Ab (11-5.2; BD Biosciences) in 100 µl of DMEM containing 50 mM HEPES (pH 7.4) at 37°C for 10 min, followed by washing and mixing with D10 cells.

Fluorescence labeling of cells

T cells were labeled with Indo-1 by incubating cells at a density of 5 x 106/ml for 20 min at 37°C in HBSS (pH 7.4) that contained 1.0 g/L glucose plus 1.0 mM CaCl2, and Indo-1/AM (Invitrogen Life Technologies) at a final concentration of 6 µM, before washing and resuspending cells in RPMI 1640 containing 10% FCS and 50 mM HEPES (pH 7.4). D10 T cells were labeled with DiIC12 or DiIC16 (Invitrogen Life Technologies) by incubating 106 cells for 5 min on ice with 4 µg/ml of either dye in 100 µl of RPMI 1640 containing 50 mM HEPES (pH 7.4).

For immunofluorescence staining, the samples were first fixed using 2% paraformaldehyde. Staining was performed using 0.5–1.0 µg of Ab in 1.0 ml of PBS containing 10 mM glycine for 45 min. Phosphotyrosine residues were labeled using biotinylated 4G10 (Upstate Cell Signaling Solutions), followed by Texas Red-conjugated streptavidin (Jackson ImmunoResearch Laboratories). GM1 and CD4 were stained using biotinylated cholera toxin B subunit (Ctx; Sigma-Aldrich) and mAb (clone RM4-5; BD Biosciences), respectively, and Texas Red-conjugated streptavidin (Jackson ImmunoResearch Laboratories). Vβ8 was detected by staining with a FITC-conjugated mAb (F23.1; BD Biosciences). TCR{zeta} was detected by staining with a FITC-conjugated mAb (6B10.2; Santa Cruz Biotechnology).

Fluorescence microscopy and image analysis

Confocal microscopy was performed using a Zeiss LSM 510 META microscope. Image processing and measurement were performed using IP Labs software (BD Biosceinces). For detection of GFP and Alexa 488, the samples were excited at 488 nm and wavelengths 530–560 nm were collected in the emission. Texas Red and Cherry were imaged by 543-nm excitation and collection of wavelengths 600–660 nm. Detection of the Ca2+ changes by Indo-1 fluorescence was performed by sample excitation at 364 nm and collecting the Indo-1 fluorescence in two channels: channel A (382–478 nm) and channel B (489–542 nm). Increases in the intracellular Ca2+ were quantitated by dividing channel A by channel B following subtraction of the respective background signals. In some instances, images were collected by wide-field fluorescence microscopy (see Fig. 9, D–F) using a Nikon Eclipse E400 microscope equipped with a 100x objective (aperture 1.3), and an Olympus DP70 camera for detection. GFP fluorescence was excited between 465 and 495 nm, CFP fluorescence at 425–455 nm, and Texas Red between 540 and 580 nm. Emission wavelengths collected for detection were 505–555, 470–500, and 600–660 nm emission for the GFP, CFP, and Texas Red, respectively. The images were deconvoluted using the IP Labs software.

Capping of the fluorescent probes in the fixed conjugates was quantitated by measuring the average fluorescence intensity of the outer membrane at the cell interface versus that of the remaining plasma membrane. For scoring of capping in the conjugates, a cap was defined as when the average fluorescence intensity at the cell interface was at least 1 SD greater than the average intensity of the remaining membrane.

Induction and preparation of anergic and nonanergic CD4+ T cells

Seven week-old sex-matched C57BL/6 mice were injected i.p. with 50 µg of staphylococcal enterotoxin B (SEB; Sigma-Aldrich) or PBS alone as described (31, 32). CD4+ T cells were isolated by negative selection on an AutoMACS (Miltenyi Biotec) magnetic cell sorter using a CD4 T cell isolation kit (Miltenyi Biotec). The untouched CD4+ T cells were resuspended in DMEM containing 50 mM HEPES. T cell proliferation was tested as described using either plate-bound anti-Vβ8-specific mAb or anti-CD3 Abs (125-C11; BD Biosciences) (33).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Specific capping of T cell membrane rafts bound to unpulsed B cells

Association of T cells with APCs include receptor-ligand interactions other than the TCR and pMHC, and these may provide sufficient signals to polarize T cell membrane rafts in the absence of cognate Ag. We tested this hypothesis by measuring for an Ag-independent capping of T cell membrane rafts by B cell APCs using D10 cells bound to unpulsed CH27 cells. D10 T cells recognize residues 134–146 of hen egg conalbumin in the context of I-Ak (34), which is expressed on the CH27 B cells. We prepared the samples by first cosedimenting the cells, followed by a brief 2-min incubation at 37°C, and then fixation. Flow cytometry showed that ~10% of the T cells conjugated to the B cells in these conditions, and this was approximately half the conjugation frequency measured for samples containing conalbumin-pulsed B cells and incubated for 20 min before measurement (data not shown). Similar conjugation frequencies for T cells bound to B cell APCs have been noted by others (35).

For detection by confocal microscopy, the T cells were labeled by expressing fusion genes encoding GFP and a minimal membrane-anchoring signal, represented by either the first 10 aa of Lck (L10) or the first 15 aa of Src (S15). The L10 sequence targets GFP to the detergent-resistant membrane raft fraction and the S15 signal limits GFP to the Triton X-100-soluble (TX-100), nonraft membrane pools (29). Approximately 40% of the L10-GFP and <1% of the S15-GFP associated with the detergent-resistant raft fraction in D10 T cells (data available at http://www.omrf.ouhsc.edu/ OMRF/Research/15/LMSF/homepage.html).

Data presented in Fig. 1 show a specific polarization or capping of L10-GFP in D10 cells conjugated to the unpulsed B cells. For example, the confocal images in Fig. 1A (left and middle) show enrichment of L10-GFP, but not S15-GFP, at the contact site between separate D10 and CH27 cells. Quantitating the capping in populations of cell conjugates (Materials and Methods) showed the capping frequency of the T cells labeled with L10-GFP was approximately three times that of the T cells labeled with S15-GFP (Fig. 1B). Furthermore, in Fig. 1B are data showing pretreating the D10 cells with MβCD inhibited the capping, thus demonstrating it was cholesterol dependent. However, returning treated T cells to medium containing serum resulted in a capping frequency for the L10-GFP similar to untreated samples, indicating that the T cells were viable following the initial cholesterol extraction by MβCD. Note the small but significant increase in the frequency of capping for the samples in the add-back experiment (Fig. 1B), which may arise from activation of the T cells following serum starvation during incubation with the MβCD. Similar to the D10 cells, we observed a cholesterol-dependent capping of Ctx in labeled mouse primary T cells conjugated to unpulsed CH27 cells (Fig. 1, A and B). Thus, the results with the D10 cells were not unique to this T cell line.


Figure 1
View larger version (32K):
[in this window]
[in a new window]

 
FIGURE 1. Visualization of T cell raft capping in fixed conjugates with unpulsed B cells. A, Confocal and differential interference contrast (DIC) images of fixed conjugates containing D10 cells (left and middle) or primary T cells (right) bound to unpulsed CH27 cells. The D10 cells expressed either L10-GFP or S15-GFP. The primary T cell was stained with biotinylated Ctx before conjugation and then Texas Red-labeled streptavidin following fixation. The samples were incubated for 2 min following conjugation and before fixation. B, Capping frequencies of L10-GFP and S15-GFP in D10 cells and Ctx in primary cells conjugated to unpulsed CH27 cells. Capping was scored based on the relative enrichment of fluorophore at the cell interface (Materials and Methods), measured for 60–70 cell conjugates, and averaged from three or more separate trials. Each conjugate was scored as exhibiting capping only when the average fluorescence intensity of the T cell plasma membrane was 1 SD or greater than the average intensity of the remaining outer membrane. Pretreatments of the D10 cells were either 10 mM MβCD for 30 min or MβCD followed by serum add-back (MβCD + serum). The untreated cells contained vehicle alone. The bars represent the average capping frequency for each sample ± SEM. **, p < 0.01; ***, p < 0.001, determined by Student’s t test using the capping frequency of the untreated L10-GFP and untreated Ctx samples as the reference for the D10 and primary T cells, respectively. C, D10 cells double-labeled with L10-GFP and either DiIC16 (top) or DiIC12 (bottom) before conjugation. The graph on the right of each image set in is a plot of the fluorescence intensity of the plasma membrane for L10-GFP (green) and DiIC16 or DiIC12 (red) that was measured around the perimeter of the corresponding T cell. The y-axis represents relative fluorescence intensity of the pixels and has arbitrary units that range in value between 0 and 255. The x-axis represents the distance around the periphery of the cell. The vertical lines indicate the region of the T cell that contacted the B cell. D (left), Confocal and DIC images of detergent-resistant membranes in a T cell conjugated to an unpulsed B cell. Jurkat T cells expressing L10-GFP were conjugated to unpulsed Raji B cells for 2 min and then extracted with 1% TX-100 for 10 min at 4°C. To measure for extraction of the TX-100-soluble fraction, the sample was fixed and immunostained with Ab specific to CD45 and Texas Red-conjugated secondary Ab. (right) Detection of CD45 in untreated Jurkat cells. The arrowheads in A–D indicate where the T cells contacted the B cells. The scale bars represent 5 µm.

 
We performed additional controls to determine whether the T cell capping by unpulsed B cells is specific to membrane rafts and not an artifact due to membrane ruffling or changes in cell morphology. First, D10 cells expressing L10-GFP were double-labeled with either DiIC16 or DiIC12. These dyes preferentially label the raft and nonraft fractions of cell membranes, respectively (36), and we observed cocapping of only the DiIC16 with L10-GFP (Fig. 1C). In a separate experiment, we treated conjugates containing unpulsed B cells with a chilled 1% TX-100 solution to visualize the detergent-resistant membrane fraction (9). Fig. 1D shows the L10-GFP was retained at the cell interface following extraction. Note in Fig. 1D the staining with Ab to CD45 shows the treatment with TX-100 was effective at removing proteins in the TX-100-soluble fraction.

Capping in T cells occurs independently of MHC

APCs can stimulate T cells with noncognate Ag or self-ligands (37), which could account for the capping in Fig. 1 by unpulsed B cells. We therefore tested this possibility by determining whether the capping that we observed in conjugates with conalbumin-free B cells was MHC II-dependent. First, D10 T cells were conjugated to primary B cells isolated from MHC II-deficient mice, in which case capping of L10-GFP in the T cells was still evidenced (Fig. 2A), and the frequency of capping was unchanged relative to conjugates containing B cells expressing MHC II (Fig. 2C). Moreover, cocapping of I-Ak in the CH27 cells with T cell L10-GFP, which is a signature of Ag presentation (Fig. 2B, top) (27), was absent in conjugates containing unpulsed B cells (Fig. 2B, bottom). In another experiment, CH27 cells were preincubated with Ab to I-Ak to block interactions with the TCR, and this treatment also had no effect on the frequency of capping in T cell-B cell conjugates (Fig. 2C). Importantly, the conditions for Ab blocking of I-Ak were sufficient as evidenced by effective inhibition of a conalbumin-dependent increase in capping frequency (20-min conjugations with Ag; Fig. 2C) and L10-GFP enrichment in the caps (Fig. 2D). These data therefore establish that early T cell capping in the absence of added Ag occurs independently of MHC II.


Figure 2
View larger version (33K):
[in this window]
[in a new window]

 
FIGURE 2. MHC II-independent capping of rafts in T cells. A and B, Confocal images of D10 cells expressing L10-GFP and bound to either a (A) MHC II–/– primary B cell or (B) conalbumin-pulsed (top) or unpulsed (bottom) CH27 cells. The samples in B were stained with Ab to I-Ak and a Texas Red-labeled secondary Ab following conjugation and fixation. The unpulsed and pulsed conjugates were incubated for 2 and 20 min, respectively, before fixing. C, Measured capping frequencies of D10 cells expressing L10-GFP and conjugated to either Ag-pulsed or unpulsed CH27 cells. In one sample, the D10 cells were conjugated to MHC II-deficient primary B cells (MHC II–/–). {alpha}I-Ak represents samples where MHC II was blocked with Ab before conjugation to the T cells. Each sample represents the measurement of ~70 conjugates in three separate trials. The 2-min conjugates containing unpulsed CH27 cells and control samples without pretreatments are presented in Fig. 1. The error bars represent ± SEM. **, p < 0.01, determined by Student’s t test using the capping frequency of the untreated L10-GFP sample as reference. D, Histograms of the relative L10-GFP enrichment at the cell interface measured in D10 cells conjugated to either unpulsed (–Ag) or Ag-pulsed (+Ag) CH27 cells and incubated for either 2 or 20 min following conjugation and before fixation. The relative enrichment of L10-GFP at the cell interface was calculated for each conjugate by dividing the average fluorescence intensity of the T cell outer membrane where it contacted the B cell by the average intensity of the remaining plasma membrane.

 
MHC-independent capping of T cell membrane rafts requires actin polymerization and signals from Src kinases and PI3K

Because capping of T cell rafts is actin dependent (11), we next measured for an Ag-independent capping of T cell actin by unpulsed B cells. Using D10 cells coexpressing Cherry-labeled actin (Cherry-actin) and L10-GFP, we observed a cholesterol-dependent cocapping of these molecules by unpulsed CH27 cells (Fig. 3A). Furthermore, pretreating the T cells, unpulsed B cells, or both with latrunculin B (Lat B) before conjugation effectively inhibited the Ag-independent capping of L10-GFP in the D10 cells (Fig. 3B). The inhibition mediated by pretreating the B cells with Lat B correlates with earlier studies showing that T cell activation requires an intact APC cytoskeleton (27, 38). Altogether, these data show that the Ag-independent capping in T cells requires an intact actin cytoskeleton in both cells of the conjugates.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 3. Ag-independent capping of L10-GFP is actin dependent and requires signals from Src family kinases and PI3K. A, Confocal and DIC images of D10 cells that coexpressed L10-GFP and Cherry-actin. The T cells were conjugated to an unpulsed (–Ag) CH27 cell for 2 min or an Ag-pulsed (+Ag) CH27 cell for 20 min. In the bottom row, the T cell was pretreated with MβCD before conjugating to an unpulsed CH27 cell for 2 min. The arrowheads indicate where the T cells contacted the B cells, and the scale bar represents 5 µm. The accompanying graphs (right) are a plot of the GFP (green) and Cherry (red) fluorescence intensity values measured around the circumference of the T cells. The vertical bars indicate the boundaries of where the T cells contacted the B cells. Note in the MβCD-treated sample an increase in the cytoplasmic signal of the Cherry-actin. This is representative of other cells in the sample because the average cytoplasmic signal of the Cherry-actin increased from 40 to 80% following pretreatment with MβCD and suggests that removal of cholesterol disrupts signals that are necessary for maintaining the actin cytoskeleton. B, Capping frequencies of L10-GFP in D10 cells bound to unpulsed CH27 cells. The T cells, B cells, or both were treated with Lat B prior to conjugation. The values represent the average of three separate trials totaling >70 conjugates for each sample. The error bars represent ± SEM. C, D10 T cells expressing L10-GFP and bound to unpulsed CH27 cells. Following conjugation and fixation, the samples were immunostained with biotinylated 4G10 and Texas Red-labeled streptavidin. The samples were either untreated (left) or pretreated with PP2 (right). These data are representative of ~30 separate T cell-B cell conjugates, where the PP2 caused a 4-fold decrease in the frequency of conjugates containing phosphotyrosine-enriched caps from 63% in untreated samples to 13% in those treated with the PP2. D, Capping frequencies of L10-GFP in D10 cells pretreated with either PP2 or wortmannin (WM) and bound to unpulsed CH27 cells. The values represent the average of three separate trials totaling >70 conjugates for each sample. For B and D, the untreated samples are also represented in Fig. 1. ***, p < 0.001 and **, p < 0.01 determined by Student’s t test, using L10-GFP in untreated samples as the reference. E, Confocal and DIC images of D10 cells expressing GFP-PHAkt. The T cells were conjugated to either unpulsed (middle) or Ag-pulsed (bottom) or CH27 cells. The top panel contains a control showing a D10 cell alone. The arrowheads indicate where the T cell contacted the B cell. Approximately 25% of the total fluorescence signal occurred in the outer membrane in T cells conjugated to either pulsed or unpulsed B cells, but only 10% of the signal was membrane associated in the unconjugated T cells.

 
One interpretation of the data in Fig. 3, A and B, is that the unpulsed B cells promote T cell signaling events that drive capping of the T cell actin cytoskeleton and cocapping of membrane rafts (4, 9). Consistent with this hypothesis, a PP2-sensitive enrichment of phosphotyrosine signals cocapped with L10-GFP where T cells contacted unpulsed CH27 cells (white arrowheads, Fig. 3C). We also observed that capping of the phosphotyrosine signals was cholesterol dependent, because pretreating T cells with filipin reduced the frequency of conjugates with phosphotyrosine-enriched caps from 63% in untreated cells (n = 25) to only 16% (n = 25) in the treated samples. Finally, the PP2 also inhibited the capping of L10-GFP in T cells bound to unpulsed B cells (Fig. 3D), thus indicating the Ag-independent capping requires the phosphotyrosine signals detected in Fig. 3C.

We also observed an inhibition of the Ag-independent L10-GFP capping by pretreating the T cells with wortmannin (Fig. 3D), thus suggesting it is PI3K dependent. We therefore further tested for PI3K activation during Ag-independent T cell-B cell interactions by measuring the relative phosphatidylinositol 3,4,5-triphosphate (PIP3) levels in the T cell plasma membrane. Particularly, a GFP fusion protein that contained the pleckstrin homology (PH) domain of Akt (GFP-PHAkt), which specifically binds to PIP3 (39) was expressed in T cells. In Fig. 3E are representative data showing recruitment of GFP-PHAkt to the outer membrane of only the D10 cells bound to either Ag-pulsed or unpulsed B cells, thus indicating an increase in PIP3 in these conditions. In some cases, we observed enrichment of the probe at the cell interface in the conjugates (Fig. 3E, middle), but this was not a consistent finding. Altogether, Fig. 3, CE shows T cells undergo activation signals when bound to unpulsed B cells and this results in an actin-dependent capping of the T cell rafts.

MHC-independent capping of T cell membrane rafts is transient and precedes TCR stop signals

To better resolve the kinetics of the Ag-independent capping in relation to Ag-dependent events, we performed live cell imaging experiments using L10-GFP- and S15-GFP-labeled D10 cells added to either unpulsed or conalbumin-pulsed CH27 cells. In experiments with unpulsed B cells, the T cells adhered briefly to the B cells for 60–80 s, after which they disengaged and migrated to another cell (supplemental videos 1–34). In contrast, in experiments with Ag-pulsed B cells, the T cells remained adhered to the B cells for many minutes (supplemental video 4), thus indicating that the brief T cell adherence to unpulsed B cells is due to a lack of pMHC-dependent TCR stop signals. Nonetheless, the T cell interactions with unpulsed B cells were sufficient to cause a transient capping of the L10-GFP, but not S15-GFP (Fig. 4, A and B, Fig. 5, and supplemental videos 1 and 2). Pretreating the T cells with filipin showed that the transient capping was cholesterol dependent (Fig. 4C, Fig. 5, and supplemental video 3). Statistically, we observed that ~65% of the T cells expressing L10-GFP and that bound to unpulsed B cells longer than 30 s exhibited the transient capping, and Student t tests showed that the enrichment of L10-GFP was significant compared with that of the zero time point (p < 0.001; Fig. 5).


Figure 4
View larger version (61K):
[in this window]
[in a new window]

 
FIGURE 4. L10-GFP undergoes a specific and cholesterol-dependent transient capping during initial T cell interactions with B cells. A–D, DIC (top) and confocal (bottom) images of labeled D10 cells during binding to unpulsed (A–C) or conalbumin-pulsed CH27 cells (D). In the confocal images, the fluorescence intensities are represented by pseudocolor, and the color assignment for intensity values is shown in the bottom left panel. The D10 cells were labeled with either L10-GFP (A, C, and D) or S15-GFP (B). The sample in C was pretreated with 5 µg/ml filipin for 30 min before adding to the B cells. The arrowheads indicate the region of the T cell outer membrane contacting the B cell. The indicated times are from when the cells first contacted. The scale bar represents 5 µm.

 

Figure 5
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 5. Kinetics of L10-GFP clustering during early T cell-B cell interactions. Averaged results of live cell imaging experiments measuring time-dependent changes in the fluorescence enrichment of labeled D10 T cells by CH27 B cells. The D10 cells were labeled with either L10-GFP (grey, black, dashed grey) or S15-GFP (dashed black). In one sample, the T cells were pretreated with filipin (blue). In another sample, the B cells were pulsed with conalbumin (black). The relative enrichment of L10-GFP at the cell interface was calculated for each frame in the experiment as described in Materials and Methods. The plots represent the averaged values of ~15 separate trials for each experiment. Time 0 represents when the cells made initial contact. The error bars represent ±SEM. ***, p < 0.001; **, p < 0.01; and *, p < 0.05 determined by Student’s t test. The reference for the samples with cells expressing L10-GFP (grey, black, and dashed grey) was the corresponding time point of the S15-GFP sample (dashed black). The reference for the remaining experiments was the corresponding time in the untreated sample expressing L10-GFP and without Ag. The inset is the sample with Ag extended to >200 s and showing substantially greater enhancement of L10-GFP occurred with Ag stimulation of the T cells.

 
Interestingly, we observed that Ag had no effect on either the kinetics or the amount of the transient capping relative to that in experiments with unpulsed samples (Fig. 4D, Fig. 5, and supplemental video 4). Nevertheless, samples with Ag exhibited a recapping of the L10-GFP at later time points, which evolved into a morphologically distinct IS. These data are therefore evidence that the transient capping occurs independent of pMHC-dependent signals in the T cell. Similarly, a statistically significant increase in the intracellular Ca2+ (p < 0.05), indicative of TCR-dependent signaling, did not occur until immediately before the recapping and after the transient capping was complete (Fig. 6, A and B, and supplemental video 5). This finding is consistent with the Ca2+ providing signals for the robust actin rearrangements and membrane capping that form the IS (23), but shows that it is not necessary for the initial transient capping. Finally, pretreating the T cells with filipin blocked the sustained adhesion and recapping (Fig. 7, A and B, supplemental video 6), when Ag was present suggesting that the Ag-independent capping is necessary for generation of TCR-dependent stop signals.


Figure 6
View larger version (54K):
[in this window]
[in a new window]

 
FIGURE 6. Transient capping of T cell rafts does not require the pMHC-dependent Ca2+ flux. A, DIC (top), confocal (middle), and Indo-1 ratio images (bottom) of an L10-GFP-labeled D10 cell during stimulation by an Ag-pulsed CH27 cell. The times represent after the cells first contacted. B, Averaged results from 11 separate experiments measuring time-dependent changes in L10-GFP capping and intracellular Ca2+ during Ag presentation. The Indo-1 ratio was calculated as described in Materials and Methods and the values were normalized by dividing by the maximum value measured in each trial. The x-axis represents time after the cells first contacted. The error bars represent ±SEM. Student t tests were performed using time 0 for each set as the reference and ***, p < 0.001; **, p < 0.01; and *, p < 0.05.

 

Figure 7
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 7. Inhibition of early T cell raft capping and TCR stop signals by filipin. A, DIC (top) and confocal (bottom) images of a D10 T cell expressing L10-GFP and added to an Ag-pulsed CH 27 cell. The T cell was pretreated with filipin. The averaged results from 15 separate trials are plotted in B (red) with the data from Fig. 6 using untreated T cells (black). The arrowheads indicate the interface between the T cell and B cell. The error bars represent ±SEM. ***, p < 0.001; **, p < 0.01; and *, p < 0.05, determined by Student’s t test using the corresponding time in the untreated sample as the reference.

 
Ag-independent capping of CD4 and TCR{zeta}

Because the TCR coreceptor CD4 associates with membrane rafts (18), we tested whether the Ag-independent capping functioned in concentrating CD4 at the APCs in cell conjugates. First, immunostaining of T cells conjugated to unpulsed B cells showed a cholesterol-dependent capping of CD4 (Fig. 8, A and B). Next, we measured for Ag-independent capping of a CD4 tailless which lacks its cytoplasmic domain and does not associate with membrane rafts (18). In Fig. 8C are data showing the tailless mutant exhibited significantly less Ag-independent capping than wild-type protein. Next, to determine whether the CD4 capping in Fig. 8, A and B, was Lck dependent, we measured the C422,424S mutant of CD4, which does not associate with Lck but maintains raft association (18). Fig. 8C shows that efficient capping of the C422,424S occurred in T cell conjugates with unpulsed B cells. Thus, CD4 association with membrane rafts, but not its association with Lck, is necessary for efficient capping during Ag-independent interactions with B cells.


Figure 8
View larger version (47K):
[in this window]
[in a new window]

 
FIGURE 8. Ag-independent capping of CD4 and TCR {zeta}-chain. A, Confocal and DIC images of primary T cells conjugated to unpulsed CH27 cells. Following fixation, the T cells were stained with Ab specific to CD4 and Alexa 488-conjugated secondary Ab. B, Capping frequencies of CD4 in untreated or MβCD-treated (+MβCD) primary T cells bound to unpulsed CH27 cells. C, Capping frequencies of wild-type CD4, CD4 tailless, and C422,424S mutants. Each CD4 contained CFP fused at its C terminus for detection. The CD4 genes were expressed in Jurkat T cells and conjugated to unpulsed Raji B cells. B and C, the error bars represent ±SEM and ***, p < 0.001 and *, p < 0.05. D, Fluorescent and DIC images of D10 cells conjugated to either CH27 cells (top, third, and bottom rows) or a MHC II-deficient primary B cell (second row). Only the sample in the third row contained an Ag-pulsed B cell. The T cell in the bottom row was pretreated with 10 mM MβCD. {zeta}-Chain was detected either by immunostaining with FITC-labeled Ab to {zeta}-chain (top, third, and bottom rows) or by expressing a YFP-labeled {zeta}-chain (second row). The filled arrowheads indicate where the T cells contacted the B cells and the open arrowheads indicate microclusters of {zeta}-chain at the cell interface. The accompanying graphs (right) are plots of the fluorescence intensity values measured around the circumference of the T cells. The white bars in A and D represent 5 µm.

 
We also observed an Ag-independent membrane enrichment of TCR {zeta}-chain in conjugates with unpulsed B cells and B cells deficient in MHC II, but which occurred as microclusters rather than the broad caps often observed with CD4 and other membrane raft markers (Fig. 8D). Fig. 8D (second row) also shows Ag-independent microclusters of a YFP-labeled {zeta}-chain, demonstrating that the microclustering of {zeta}-chain was not an artifact from immunostaining. T cells conjugated to either MHC II-deficient B cells (Fig. 8D, second row) or MHC II-blocked CH27 cells (data not shown) also exhibited {zeta}-chain microclusters. Thus, the microclustering occurred independent of pMHC II complexes. Similar microclusters of the TCR {zeta}-chain have been reported in T cells stimulated by binding to planar membranes containing pMHC (40, 41) and the microclusters were also evident in Ag-stimulated D10 cells (Fig. 8D, third row). The microclusters were the same size in the stimulated T cells and those bound to unpulsed B cells, but they were more abundant in the stimulated cells (average of 10 for pulsed samples and 3 for unpulsed). Similarly, an average of three microclusters were present in T cells bound to either MHC II-blocked CH27 cells or MHC II-deficient primary B cells. Interestingly, the {zeta}-chain microclusters were not sensitive to MβCD (Fig. 8D, bottom) and the clustering occurred as frequently in the MβCD-treated T cells (61%, n = 25) as that in untreated samples (60%, n = 28).

Ag-independent capping of T cell membrane rafts is inhibited in anergic T cells

Anergic T cells unresponsive to Ag exhibit a poor recruitment of protein kinase {theta} and LAT to the IS (22). To determine whether T cell anergy also affects the Ag-independent capping, Ag-free conjugates were prepared using anergic primary T cells. T cell anergy was generated by exposing B6 mice to SEB superantigen by i.p. injection, which results in the nondeleted CD4+Vβ8+ cells becoming anergic as defined by a failure to respond to cross-linking of Vβ8 (Fig. 9A) (33). Mice injected with PBS alone served as the control. We isolated CD4+ T cells from control and SEB-injected mice by depletion 1 wk postinjection and detected Vβ8+ cells by immunostaining. By staining the rafts with Ctx, we observed that the Ag-independent capping of rafts was inhibited in anergic Vβ8+ T cells compared with control groups represented by Vβ8+ T cells from PBS-injected mice (Fig. 9B) and Vβ8 T cells from SEB-injected animals (Fig. 9C). Conjugates with anergic T cells also exhibited an inhibition in the Ag-independent clustering of phosphotyrosine signals (Fig. 9D). Quantitation showed 59% (n = 30) of the conjugates with control Vβ8+ T cells exhibited capping of phosphotyrosine signals, but only 22% of the Vβ8+ conjugates from anergic T cells (n = 32). From these experiments, we conclude that the distinct properties of anergic T cells include an inhibition of Ag-independent capping and associated phosphotyrosine signals.


Figure 9
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 9. Ag-independent capping of L10-GFP was inhibited in anergic T cells. Measurement of total CD4+ splenic T cells isolated by negative selection from B6 mice. The mice were injected with either PBS or SEB 7 days before each experiment. A, [3H]thymidine proliferation assays of purified CD4+ T cells from PBS ({blacksquare})- or SEB (Figure 9)- injected mice. Data are reported as average cpm ± SD and the measurements were performed in triplicate. Cells were bound to plates containing either no Ab (untreated) or Ab to either CD3 or Vβ8. B, Fluorescence and DIC images of purified CD4+ T cells bound to unpulsed CH27 cells. The T cells were doubled-labeled with Texas Red-conjugated Ctx and FITC-conjugated Ab specific to Vβ8. The T cells were from either PBS- or SEB (+SEB)-injected mice. The T cell in the lower panel was Vβ8, thus indicating that it was not part of the anergic population of T cells in the sample. The arrowheads indicate the T cell outer membrane where it contacted the B cell. C, Capping frequencies of GM1 in either Vβ8+ or Vβ8 primary T cells from SEB-injected mice or Vβ8+ T cells from mice injected with PBS. The error bars represent ±SEM and **, p < 0.01, determined by Student’s t test with the PBS sample as the reference. D, Primary T cells from either PBS- or SEB-injected mice conjugated to unpulsed CH27 cells and immunostained with biotinylated 4G10 and Texas Red-labeled streptavidin. Vβ8 was detected by costaining as in B. The scale bars represent 5 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In vivo stimulation of T cells by Ag presentation is preceded by brief, serial interactions between the T cell and surrounding APCs as the T cell samples its environment for Ag (24, 42, 43). In this study, we show that these transient interactions are sufficient to polarize the T cell toward the APCs represented by a specific and Ag-independent capping of fluorescent membrane raft markers in the T cell outer membrane. Importantly, the T cell raft capping was also representative of a raft-dependent capping of CD4 and coincided with a cholesterol-independent microclustering of the TCR {zeta}-chain. Thus, the early T cell capping events establish a membrane environment with a composition favorable for TCR signaling. Finally, anergic T cells exhibited an inhibited Ag-independent capping, indicative of a novel signaling defect associated with T cell tolerance.

One recent study identified a T cell activation during adhesion to immature dendritic cells in the absence of cognate Ag and attributed this to presentation of self-Ag (37). However, our findings show that the T cell raft capping by unpulsed B cell APCs occurs independently of MHC II, and thus is unlikely to depend on presentation of self-Ag. For example, we observed capping in T cells conjugated to MHC II-deficient B cells, and blocking interactions between the MHC II and TCR with Ab did not affect the capping (Fig. 2). Furthermore, coenrichment of MHC II in the B cells with T cell rafts is a signature of Ag presentation (27, 44), but we detected no evidence of cocapping of I-Ak with the L10-GFP in the D10 cells (Fig. 2). We also observed capping in primary T cells from B6 (H-2b) mice when bound to unpulsed CH27 cells (H-2k) (Fig. 1), demonstrating that the observed capping did not depend on MHC restriction. Finally, experiments with both fixed conjugates and live cells showed that Ag-dependent capping events occurred significantly later than the capping from unpulsed or MHC II-blocked B cells (Figs. 2, 4, and 5).

Pretreatment of the T cells with filipin had no affect on the initial T cell-B cell adhesion, yet it inhibited both the Ag-independent capping and later TCR-dependent stop signals (Figs. 4–7). One interpretation of these data is that the Ag-independent capping is necessary for efficient signaling from the TCR to generate stop signals when Ag is present. This could occur by enriching the T cell plasma membrane with CD4 and other raft-associated TCR effectors at the site of presentation of Ag to the TCR. However, further studies are necessary to better define the functional properties of the Ag-independent capping toward TCR-dependent signaling, such as whether the observed clustering contributes to the magnitude or kinetics of signaling from the Ag receptor.

Interestingly, quantitation of the live cell imaging experiments show that the Ag-independent capping is transient in nature even when Ag is present. This finding contrasts with the notion that the early capping represents a structure that evolves directly into the IS. However, dissipation of the caps in these conditions may be the outcome of other signaling events, such as internalization of membrane or expansion of the cell surface due to delivery of membrane from intracellular structures (45).

The cholesterol-dependent nature of the Ag-independent capping of CD4 and the reduced frequency of capping with the CD4 tailless mutant illustrate a role for the membrane rafts in concentrating CD4 in the T cell at the APCs. However, the cholesterol-independent microclustering of the TCR {zeta}-chain shows that mechanisms other than membrane rafts likely participate in forming the {zeta}-chain complexes during Ag-independent interactions with the APCs. Similarly, the distinct distribution of the TCR {zeta}-chain relative to CD4 is consistent with their enrichment at the cell interface occurring by separate mechanisms. Structurally, the microclusters may represent discrete protein complexes that are set within a cholesterol-rich lipid environment at the cell interface. With this arrangement, the membrane rafts could serve as a reservoir of molecules that surround and support TCR signaling within the {zeta}-chain-enriched complexes. However, further studies are necessary to better resolve the nanodistribution and dynamics of the separate protein- and lipid-rich membrane structures.

The failure of anergic T cells to cap membrane rafts during Ag-independent interactions with B cells may reflect a mechanism for maintaining T cell tolerance. For example, one prediction is that blockage of Ag-independent capping and associated signaling molecules raises the threshold of Ag required to stimulate the T cell. Similarly, it is interesting to note that chronic lymphocytic choriomeningitis virus infections are associated with an up-regulation of program death-1 in the effector T cells (46). As an inhibitory coreceptor, activation of program death-1 may serve to inhibit the early Ag-independent capping. Accordingly, further studies are required to better establish the functional significance of these findings in relation to TCR-dependent signaling, T cell tolerance, and the onset of chronic infections.

Experiments with PP2, wortmannin, and the PIP3-binding PH domain of Akt show that the Ag-independent capping occurs downstream of discrete signaling events in the T cell. PIP3 is a frequent intermediate in pathways leading to actin capping, and the PP2-dependent nature of the capping may reflect PI3K activity that is downstream of Src family kinase activity during Ag-independent T cell-APC interactions. Accordingly, T cell costimulatory receptors that activate Src family kinases and PI3K represent a likely source of the initial signals that bring about the Ag-independent capping.

Our data also show a filipin-sensitive capping of phosphotyrosine signals in the Ag-independent conjugates, and this is consistent with the notion that the membrane rafts serve as a platform for signaling events important for membrane and actin capping. However, we still detected phosphotyrosine signals in the filipin-treated T cells when conjugated to unpulsed B cells, although the signals were not enriched at the cell interface (data not shown). Whether the filipin-insensitive phosphotyrosine labeling represents early signaling events that occur upstream of the membrane raft capping represents an important question for future study.

In conclusion, our data show that initial adhesion and scanning of the APCs by the T cell is characterized by a marked capping of T cell raft molecules at the site of cell contact, independent of signals initiated by presentation of Ag. Experiments with fixed conjugates showed that the capping was actin dependent and occurred following Ag-independent signaling events in the T cell. Furthermore, we did not observe the Ag-independent capping in anergic T cells, suggesting that the earliest, MHC-independent stages of interaction between the T cells and APCs regulate the T cell response to Ag. Finally, experiments demonstrating Ag-independent CD4 capping and TCR {zeta}-chain microclustering show the early interactions between T cells and APCs concentrate signaling proteins spatially proximal to the site of Ag presentation, which likely augments TCR signaling once it binds pMHC.


    Acknowledgment
 
We thank G. Yosten for her technical assistance in this work.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the National Institutes of Health (P50 RR015577), R01 GM070001 (to W.R.), and R01 AI 48097 (to A.D.F.) and the Oklahoma Center for the Advancement of Science and Technology Grants HR02-009 (to W.R.) and HR02-48 (to A.D.F.). Back

2 Address correspondence and reprint requests to Dr. William Rodgers, Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, 825 NE 13th Street, MS 45, Oklahoma City, OK 73104. E-mail address: william-rodgers{at}omrf.ouhsc.edu Back

3 Abbreviations used in this paper: pMHC, peptide-MHC; CFP, cyan flourescent protein; Ctx, cholera toxin B subunit; DIC, differential interference contrast; IS, immunological synapse; LAT, linker for activation of T cells; Lat B, latrunculin B; PIP3, phosphatidylinositol 3,4,5-triphosphate; MβCD, methyl-β-cyclodextrin; PP2, 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine; TX-100, Triton X-100; PH, pleckstrin homology. Back

4 The online version of this article has supplemental material. Back

Received for publication May 3, 2007. Accepted for publication August 30, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Monks, C. R., B. A. Freiberg, H. Kupfer, N. Sciaky, A. Kupfer. 1998. Three-dimensional segregation of supramolecular activation clusters in T cells. Nature 395: 82-86. [Medline]
  2. Bromley, S. K., W. R. Burack, K. G. Johnson, K. Somersalo, T. N. Sims, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen, M. L. Dustin. 2001. The immunological synapse. Annu. Rev. Immunol. 19: 375-396. [Medline]
  3. Gaus, K., E. Chklovskaia, B. Fazekas de St Groth, W. Jessup, T. Harder. 2005. Condensation of the plasma membrane at the site of T lymphocyte activation. J. Cell Biol. 171: 121-131. [Abstract/Free Full Text]
  4. Viola, A., S. Schroeder, Y. Sakakibara, A. Lanzavecchia. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283: 680-682. [Abstract/Free Full Text]
  5. Janes, P. W., S. C. Ley, A. I. Magee. 1999. Aggregation of lipid rafts accompanies signaling via the T cell antigen receptor. J. Cell Biol. 147: 447-461. [Abstract/Free Full Text]
  6. Villalba, M., K. Bi, F. Rodriguez, Y. Tanaka, S. Schoenberger, A. Altman. 2001. Vav1/Rac-dependent actin cytoskeleton reorganization is required for lipid raft clustering in T cells. J. Cell Biol. 155: 331-338. [Abstract/Free Full Text]
  7. Burack, W. R., K. H. Lee, A. D. Holdorf, M. L. Dustin, A. S. Shaw. 2002. Quantitative imaging of raft accumulation in the immunological synapse. J. Immunol. 169: 2837-2841. [Abstract/Free Full Text]
  8. Moran, M., M. C. Miceli. 1998. Engagement of GPI-linked CD48 contributes to TCR signals and cytoskeletal reorganization: a role for lipid rafts in T cell activation. Immunity 9: 787-796. [Medline]
  9. Jordan, S., W. Rodgers. 2003. T cell glycolipid-enriched membrane domains are constitutively assembled as membrane patches that translocate to immune synapses. J. Immunol. 171: 78-87. [Abstract/Free Full Text]
  10. Rodgers, W., D. Farris, S. Mishra. 2005. Merging complexes: properties of membrane raft assembly during lymphocyte signaling. Trends Immunol. 26: 97-103. [Medline]
  11. Rodgers, W., J. Zavzavadjian. 2001. Glycolipid-enriched membrane domains are assembled into membrane patches by associating with the actin cytoskeleton. Exp. Cell Res. 267: 173-183. [Medline]
  12. Simons, K., D. Toomre. 2000. Lipid rafts and signal transduction. Nat. Mol. Cell Biol. Rev. 1: 31-39.
  13. Xavier, R., T. Brennan, Q. Li, C. McCormack, B. Seed. 1998. Membrane compartmentation is required for efficient T cell activation. Immunity 8: 723-732. [Medline]
  14. Schade, A. E., A. D. Levine. 2002. Lipid raft heterogeneity in human peripheral blood T lymphoblasts: a mechanism for regulating the initiation of TCR signal transduction. J. Immunol. 168: 2233-2239. [Abstract/Free Full Text]
  15. Munro, S.. 2003. Lipid rafts: elusive or illusive?. Cell 115: 377-388. [Medline]
  16. Rodgers, W., B. Crise, J. K. Rose. 1994. Signals determining protein tyrosine kinase and glycosyl-phosphatidylinositol-anchored protein targeting to a glycolipid-enriched membrane fraction. Mol. Cell. Biol. 14: 5384-5391. [Abstract/Free Full Text]
  17. Shenoy-Scaria, A. M., D. J. Dietzen, J. Kwong, D. C. Link, D. M. Lublin. 1994. Cysteine3 of Src family protein tyrosine kinase determines palmitoylation and localization in caveolae. J. Cell Biol. 126: 353-363. [Abstract/Free Full Text]
  18. Fragoso, R., D. Ren, X. Zhang, M. W. Su, S. J. Burakoff, Y. J. Jin. 2003. Lipid raft distribution of CD4 depends on its palmitoylation and association with Lck, and evidence for CD4-induced lipid raft aggregation as an additional mechanism to enhance CD3 signaling. J. Immunol. 170: 913-921. [Abstract/Free Full Text]
  19. Zhang, W., R. P. Trible, L. E. Samelson. 1998. LAT palmitoylation: its essential role in membrane microdomain targeting and tyrosine phosphorylation during T cell activation. Immunity 9: 239-246. [Medline]
  20. Kabouridis, P. S., A. I. Magee, S. C. Ley. 1997. S-acylation of LCK protein tyrosine kinase is essential for its signalling function in T lymphocytes. EMBO J. 16: 4983-4998. [Medline]
  21. Balamuth, F., J. L. Brogdon, K. Bottomly. 2004. CD4 raft association and signaling regulate molecular clustering at the immunological synapse site. J. Immunol. 172: 5887-5892. [Abstract/Free Full Text]
  22. Hundt, M., H. Tabata, M. S. Jeon, K. Hayashi, Y. Tanaka, R. Krishna, L. De Giorgio, Y. C. Liu, M. Fukata, A. Altman. 2006. Impaired activation and localization of LAT in anergic T cells as a consequence of a selective palmitoylation defect. Immunity 24: 513-522. [Medline]
  23. Negulescu, P. A., T. B. Krasieva, A. Khan, H. H. Kerschbaum, M. D. Cahalan. 1996. Polarity of T cell shape, motility, and sensitivity to antigen. Immunity 4: 421-430. [Medline]
  24. Miller, M. J., A. S. Hejazi, S. H. Wei, M. D. Cahalan, I. Parker. 2004. T cell repertoire scanning is promoted by dynamic dendritic cell behavior and random T cell motility in the lymph node. Proc. Natl. Acad. Sci. USA 101: 998-1003. [Abstract/Free Full Text]
  25. Bousso, P., E. Robey. 2003. Dynamics of CD8+ T cell priming by dendritic cells in intact lymph nodes. Nat. Immunol. 4: 579-585. [Medline]
  26. Revy, P., M. Sospedra, B. Barbour, A. Trautmann. 2001. Functional antigen-independent synapses formed between T cells and dendritic cells. Nat. Immunol. 2: 925-931. [Medline]
  27. Gordy, C., S. Mishra, W. Rodgers. 2004. Visualization of antigen presentation by actin-mediated targeting of glycolipid-enriched membrane domains to the immune synapse of B cell APCs. J. Immunol. 172: 2030-2038. [Abstract/Free Full Text]
  28. Madsen, L., N. Labrecque, J. Engberg, A. Dierich, A. Svejgaard, C. Benoist, D. Mathis, L. Fugger. 1999. Mice lacking all conventional MHC class II genes. Proc. Natl. Acad. Sci. USA 96: 10338-10343. [Abstract/Free Full Text]
  29. Rodgers, W.. 2002. Making membranes green: construction and characterization of GFP-fusion proteins targeted to discrete plasma membrane domains. BioTechniques 32: 1044-1051. [Medline]
  30. Lo, W., W. Rodgers, T. Hughes. 1998. Making genes green: creating green fluorescent protein (GFP) fusions with blunt-end PCR products. BioTechniques 25: 94-96, 98. [Medline]
  31. Kurella, S., J. C. Yaciuk, I. Dozmorov, M. B. Frank, M. Centola, A. D. Farris. 2005. Transcriptional modulation of TCR, Notch and Wnt signaling pathways in SEB-anergized CD4+ T cells. Genes Immun. 6: 596-608. [Medline]
  32. Pan, Z. J., K. Davis, S. Maier, M. P. Bachmann, X. R. Kim-Howard, C. Keech, T. P. Gordon, J. McCluskey, A. D. Farris. 2006. Neo-epitopes are required for immunogenicity of the La/SS-B nuclear antigen in the context of late apoptotic cells. Clin. Exp. Immunol. 143: 237-248. [Medline]
  33. Rellahan, B. L., L. A. Jones, A. M. Kruisbeek, A. M. Fry, L. A. Matis. 1990. In vivo induction of anergy in peripheral Vβ8+ T cells by staphylococcal enterotoxin B. J. Exp. Med. 172: 1091-1100. [Abstract/Free Full Text]
  34. Kaye, J., S. Porcelli, J. Tite, B. Jones, C. A. Janeway, Jr. 1983. Both a monoclonal antibody and antisera specific for determinants unique to individual cloned helper T cell lines can substitute for antigen and antigen-presenting cells in the activation of T cells. J. Exp. Med. 158: 836-856. [Abstract/Free Full Text]
  35. Huang, J., K. Sugie, D. M. La Face, A. Altman, H. M. Grey. 2000. TCR antagonist peptides induce formation of APC-T cell conjugates and activate a Rac signaling pathway. Eur. J. Immunol. 30: 50-58. [Medline]
  36. Hao, M., S. Mukherjee, F. R. Maxfield. 2001. Cholesterol depletion induces large scale domain segregation in living cell membranes. Proc. Natl. Acad. Sci. USA 98: 13072-13077. [Abstract/Free Full Text]
  37. Meraner, P., V. Horejsi, A. Wolpl, G. F. Fischer, G. Stingl, D. Maurer. 2007. Dendritic cells sensitize TCRs through self-MHC-mediated Src family kinase activation. J. Immunol. 178: 2262-2271. [Abstract/Free Full Text]
  38. Al-Alwan, M. M., R. S. Liwski, S. M. Haeryfar, W. H. Baldridge, D. W. Hoskin, G. Rowden, K. A. West. 2003. Cutting edge: dendritic cell actin cytoskeletal polarization during immunological synapse formation is highly antigen-dependent. J. Immunol. 171: 4479-4483. [Abstract/Free Full Text]
  39. Costello, P. S., M. Gallagher, D. A. Cantrell. 2002. Sustained and dynamic inositol lipid metabolism inside and outside the immunological synapse. Nat. Immunol. 3: 1082-1089. [Medline]
  40. Yokosuka, T., K. Sakata-Sogawa, W. Kobayashi, M. Hiroshima, A. Hashimoto-Tane, M. Tokunaga, M. L. Dustin, T. Saito. 2005. Newly generated T cell receptor microclusters initiate and sustain T cell activation by recruitment of Zap70 and SLP-76. Nat. Immunol. 6: 1253-1262. [Medline]
  41. Varma, R., G. Campi, T. Yokosuka, T. Saito, M. L. Dustin. 2006. T cell receptor-proximal signals are sustained in peripheral microclusters and terminated in the central supramolecular activation cluster. Immunity 25: 117-127. [Medline]
  42. Bousso, P., E. Robey. 2003. Dynamics of CD8+ T cell priming by dendritic cells in intact lymph nodes. Nat. Immunol. 4: 579-585. [Medline]
  43. Mempel, T. R., S. E. Henrickson, U. H. Von Andrian. 2004. T-cell priming by dendritic cells in lymph nodes occurs in three distinct phases. Nature 427: 154-159. [Medline]
  44. Hiltbold, E. M., N. J. Poloso, P. A. Roche. 2003. MHC class II-peptide complexes and APC lipid rafts accumulate at the immunological synapse. J. Immunol. 170: 1329-1338. [Abstract/Free Full Text]
  45. Kay, J. G., R. Z. Murray, J. K. Pagan, J. L. Stow. 2006. Cytokine secretion via cholesterol-rich lipid raft-associated SNAREs at the phagocytic cup. J. Biol. Chem. 281: 11949-11954. [Abstract/Free Full Text]
  46. Barber, D. L., E. J. Wherry, D. Masopust, B. Zhu, J. P. Allison, A. H. Sharpe, G. J. Freeman, R. Ahmed. 2006. Restoring function in exhausted CD8 T cells during chronic viral infection. Nature 439: 682-687. [Medline]



This article has been cited by other articles:


Home page
JEMHome page
O. Anton, A. Batista, J. Millan, L. Andres-Delgado, R. Puertollano, I. Correas, and M. A. Alonso
An essential role for the MAL protein in targeting Lck to the plasma membrane of human T lymphocytes
J. Exp. Med., December 22, 2008; 205(13): 3201 - 3213.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Komen, J. S.
Right arrow Articles by Rodgers, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Komen, J. S.
Right arrow Articles by Rodgers, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS