The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 6596 -6603
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mise-Omata, S.
Right arrow Articles by Doi, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mise-Omata, S.
Right arrow Articles by Doi, T. S.

A Proximal {kappa}B Site in the IL-23 p19 Promoter Is Responsible for RelA- and c-Rel-Dependent Transcription

Setsuko Mise-Omata*, Etsushi Kuroda{dagger}, Junko Niikura*, Uki Yamashita{dagger}, Yuichi Obata* and Takahiro S. Doi1,*

* Technology and Development Team for BioSignal Program, Subteam for BioSignal Integration, RIKEN BioResource Center, RIKEN Tsukuba Institute, Tsukuba, Japan; and {dagger} Department of Immunology, School of Medicine, University of Occupational and Environmental Health, Kitakyusyu, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-23 is a heterodimeric cytokine composed of a unique p19 subunit and a common p40 subunit is shared with IL-12. IL-23 promotes the inflammatory response by inducing the expansion of CD4+ cells producing IL-17. The regulation of p19 gene expression has been less studied than that of p40 subunit expression, which in macrophages is well known to be dependent on NF-{kappa}B. To clarify the role of NF-{kappa}B in expression of the p19 gene, we analyzed mRNA levels in NF-{kappa}B-deficient macrophages. As reported to occur in dendritic cells, p19 expression was dramatically reduced in c-rel-deficient macrophages. Moreover, we found that p19 expression was halved in rela-deficient macrophages, but it was enhanced in p52-deficient macrophages. The p19 promoter contains three putative {kappa}B sites, located at nt –642 to –632 ({kappa}B–642), nt –513 to –503 ({kappa}B–513), and nt –105 to –96 ({kappa}B–105), between the transcription start site and –937 bp upstream in the p19 promoter region. Although EMSA analysis indicated that both {kappa}B–105 and {kappa}B–642, but not {kappa}B–513, bound to NF-{kappa}B in vitro, luciferase-based reporter assays showed that the most proximal {kappa}B site, {kappa}B–105, was uniquely indispensable to the induction of p19 transcription. Chromatin immunoprecipitation demonstrated in vivo association of RelA, c-Rel, and p50 with {kappa}B–105 of the p19 promoter. These results provide the evidence that the association of RelA and c-Rel with the proximal {kappa}B site in the p19 promoter is required to induce of p19 expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin 23, a heterodimeric cytokine, is composed of a p40 subunit, which is shared with IL-12, and a p19 subunit that is related to the p35 subunit of IL-12 (1, 2, 3). IL-12 is a key cytokine for the differentiation of naive T cells toward IFN-{gamma}-producing Th1 cells, which are important for host defense against bacterial infection and for tumor suppression (4). In contrast, IL-23 promotes differentiation toward IL-17 producing T cells (5, 6), the precursors of which are distinct from those of Th1 and Th2 (7, 8). IL-17 is a proinflammatory cytokine that induces the production of inflammatory molecules, including IL-6, IL-8, G-CSF, and MCP-1 (9). The importance of IL-23 in inflammatory responses has been demonstrated in experimental autoimmune diseases. Mice deficient in the p19 subunit of IL-23 are resistant to experimental autoimmune encephalomyelitis and collagen-induced arthritis, although autoantigen-specific IFN-{gamma} producing Th1 cells are able to differentiate (10, 11). Transgenic mice overexpressing p19 show multiorgan inflammation and premature death (12).

Regulation of p40 expression has been well studied. Multiple transcription factors, such as NF-{kappa}B, CCAAT-enhancer-binding protein β/LAP, ets-2, PU.1, AP-1, and IFN consensus sequence binding protein, are recruited to the promoter of the p40 gene and up-regulate its transcription (13, 14, 15, 16, 17, 18). Regulation of p19 has been less well studied than p40 gene regulation. IL-23 is produced predominantly by macrophages and dendritic cells (19). IL-23 production is induced by various stimuli such as Gram-negative bacteria (20) and its component LPS (20, 21), Staphylococcus aureus peptidoglycan (22), Sendai virus (23), and the inflammatory cytokines, IL-1β and TNF-{alpha} (24). Several pieces of evidence have emerged indicating that expression of the p19 gene is regulated by NF-{kappa}B transcription factor. Overexpression of I{kappa}B-{alpha} blocks the expression of the p19 subunit (24). Recently, Carmody et al. (25) have reported that p19 expression in dendritic cells is dependent on c-Rel, one of the NF-{kappa}B molecules. Utsugi et al. (26) demonstrated that short interfering RNA against RelA reduced the expression of the p19 gene in a human macrophage cell line.

The NF-{kappa}B family of transcription factors is crucial to the immune responses; it is composed of five different members, RelA (p65), c-Rel, RelB, p50 (NF-{kappa}B1), and p52 (NF-{kappa}B2), which are maintained as homo- and heterodimeric complexes in the cytoplasm until their nuclear translocation occurs after cell stimulation. In the cytoplasm, NF-{kappa}B complexes are bound to inhibitory proteins such as I{kappa}B or the preprocessed NF-{kappa}B precursors, p105 or p100 (27). Whereas RelA, c-Rel, and RelB contain transactivation domains, which are required for gene transcription, p50 and p52 do not contain transactivation domains; thus, p50- and p52-homodimers are trancriptionally inactive (27). NF-{kappa}B is a transcription factor critical not only for p40 expression but also for expression of many cytokines, such as TNF-{alpha}, -β, IL-1β, IL-2, IL-6, IL-8, and IL-12 p35 (28).

To clarify the role of NF-{kappa}B molecules in expression of the p19 subunit, we analyzed mRNA levels of the p19 gene in rela-, c-rel-, or p52-deficient macrophages. Expression of the p19 subunit was decreased in rela-deficient macrophages and in c-rel-deficient macrophages, whereas it was enhanced in p52-deficient macrophages. In contrast to the report by Carmody et al., our luciferase assay indicated that the most proximal {kappa}B site in p19 promoter was uniquely responsible for expression of the p19 gene. In this study, we provided the evidence that transcription of the p19 gene is required for association of NF-{kappa}B transcription factor with the proximal {kappa}B site.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice and macrophages

c-rel-deficient C57BL/6 mice were provided by Dr. S. Gerondakis (The Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria, Australia); p52-deficient C57BL/6 mice were supplied by Bristol-Myers Squibb Company (New York, NY). rela-deficient C57BL/6 mice were generated previously (29) and are maintained in the Experimental Animal Division, RIKEN BioResource Center (BRC No. 00300, Tsukuba, Japan); they are embryonic lethal at ED14, so rela–/– macrophages were obtained from mice that had received adoptive transfer of fetal liver cells at ED13.5, as described previously (29). In brief, C57BL/6 CD45.1 mice were irradiated with a lethal dose of X-rays, and received i.v. injection of rela+/+ or rela–/– fetal liver cells. One month after transplantation, bone marrow cells were harvested, and CD45.2 positive cells derived from fetal liver cells were purified by using biotinylated anti-CD45.2 mAb (104, eBioscience) and anti-biotin Ab-coupled microbeads (Miltenyi Biotec). After purification, >95% of the cells were CD45.2 positive. Bone-marrow-derived macrophages (BMDMs)2 were grown for 7 days in RPMI 1640 containing 20% FBS, 10 mM HEPES, 1 mM sodium pyruvate, and 5 x 10–5 M 2-ME, and supplemented with 10 ng/ml GM-CSF (Pepro Tech). Nonadherent cells were discarded, and adherent cells were used for the experiments. The murine macrophage cell lines RAW 264 and J774 were obtained from the Cell Engineering Division, RIKEN BioResource Center (Tsukuba, Japan). These cell lines were maintained in DMEM supplemented with 10% FBS.

Analysis of IL-12 and IL-23 RNA expression

Macrophages were stimulated with 1 µg/ml LPS (055:B5, Sigma-Aldrich) or LPS plus mouse rIFN-{gamma} (e-Bioscience) at 1 ng/ml. Six hours after stimulation, total RNA was prepared by using TRIzol Reagent (Invitogen Life Technologies). Semiquantitative RT-PCR was performed as described previously (30). Primer sequences were: p19, sense: AAGTTCTCTCCTCTTCCCTGTCGC and antisense: TCTTGTGGAGCAGCAGATGTGAG; p35, sense: ATTATTCCTGCACTGCTGAAGAC and antisense: TTCACTCTGTAAGGGTCTGCTTC; p40, sense: GAGGTGGACTGGACTCCC CGA and antisense: CAAGTTCTTGGGCGGGTCTG; and hypoxanthine-guanine phosphoribosyltransferase (HPRT), sense: GTTGGATACAGGCCAGACTTTGTTG and antisense: GAAGGGTAGGCTGGCCTATAG GCT. Quantitative PCR was performed with qPCR MasterMix Plus for SYBR Green I (Eurogentec) and ABI PRISM 7900 (Applied Biosystems). The primers used for the analyses of p19 and p35 expression were: p19, sense: TATCCAGTGTGAAGATGGTTGTG and antisense: CACTAAGGGCTCAGTCAGAGTTG; and p35, sense: AAATGAAGCTCTGCATCCTGC and antisense: TCACCCTGTTGATGGTCACG. For p40 and HPRT expression, the same primer sets as for semiquantitative PCR were used. The levels of expression of cytokine genes in NF-{kappa}B-deficient macrophages relative to those in wild type macrophages were calculated by the {Delta}{Delta}Ct method.

5' RACE and luciferase-based reporter gene construction

Total RNA was prepared from LPS-stimulated BMDMs, and poly(A)+ RNA was purified with a Takara Oligotex-dT30 mRNA purification kit (Takara). The 5' region of the p19 transcript was determined with GeneRacer for full-length, RNA ligase-mediated rapid amplification of the 5' and 3' cDNA ends (Invitrogen Life Technologies) in accordance with the manufacturer’s instructions. The sequence of the gene-specific primer used for 5' RACE was CTTGTGGGTCACAACCATCTTCAC. For the reporter assay, a mouse IL-23 p19 genomic fragment from nt –3027 to +477 was obtained by PCR amplification using the RPCI-23 MM BAC clone 346G15 (Invitrogen Life Technologies) as a template. The downstream primer contained an XhoI restriction site. The PCR fragment was digested by SacI (–2993) and XhoI, and inserted into the pGL3-Basic vector (Promega). 5'-deletion mutants were generated by PCR by using an upstream primer containing a NheI restriction site and a downstream primer containing an XhoI restriction site. Nucleotides in the {kappa}B sites were deleted with a QuikChange II site-directed mutagenesis kit (Stratagene).

Luciferase assay

RAW 264 cells (7.5 x 106) were transiently transfected with 20 µg of reporter gene and 10 µg of β-galactosidase expression vector by using Lipofectamine 2000 reagent (Invitrogen Life Technologies). Twenty-four hours after transfection, cells were left unstimulated or stimulated with IFN-{gamma} (1 ng/ml), LPS (1 µg/ml), or LPS plus IFN-{gamma} in a flat-bottom 96-well-plate. Luciferase and β-galactosidase assays (Promega) were performed in accordance with the manufacturer’s instructions. Luciferase activity was measured with a Wallac 1420 ARVOsx multilabel counter (PerkinElmer) and normalized to β-galactosidase values.

EMSA

BMDMs were left unstimulated or stimulated with LPS for 30 min. The cells were lysed in RIPA buffer (10 mM Tris-HCl (pH 7.4), 1% Nonidet P-40, 0.1% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, and 1 mM EDTA) containing Complete Proteinase Inhibitors Cocktail Tablets (Roche) and centrifuged at 14,000 rpm for 15 min; supernatants were used as cell extracts. The sequences of the probes used for EMSA were; {kappa}B, 5'-AGTTGAGGGGACTTTCCCAGGC-3'; {kappa}B–105, 5'-TAGGGAGGGGAATCCCACCTGC-3', {kappa}B–513, 5'-AAGAAGGAAATGCCTTGGTCTT-3', {kappa}B–642, 5'-TCACCCGGGGAATGCCCTTACTT-3', mu{kappa}B–105, 5'-TAGGGAGCCCAATCCCACCTGC-3', and mu{kappa}B–642, 5'-TCACCCGCCCAATGCCCTTACTT-3'. The probes were radiolabeled with T4 polynucleotide kinase (Takara). EMSA was performed with 10 µg of extract, 0.1 µg of poly(dI-dC), and 0.035 pmol of 32P-labeled oligonucleotides in 30 µl of reaction mixture (10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 3.3 mM MgCl2, 1 mM EDTA, 5% glycerol, and 47 mM 2-ME). For the competition assays, a 50-fold excess of unlabeled probe was added. For supershift assays, 1 µg of anti-RelA, anti-c-Rel, or anti-p50 polyclonal Ab (Santa Cruz Biotechnology) was added to the reaction mixture. Samples were loaded onto 5.28% nondenatured polyacrylamide gels with 0.25x Tris borate electrophoresis buffer. After electrophoresis, the gels were dried and were exposed to Kodak BioMax MS film (Kodak).

Chromatin immunoprecipitation (ChIP) assay

ChIP analysis was performed with ChIP-IT Enzymatic (Active Motif) in accordance with the manufacturer’s instructions. In brief, BMDMs were cultured in three 15-cm culture dishes and then either stimulated with 1 µg/ml LPS plus 1 ng/ml IFN-{gamma} for 4 h or left unstimulated. After cross-linking by the addition of 1% formaldehyde, nuclei were prepared and enzymatically digested. The chromatin fraction was precleared with protein-A agarose beads followed by immunoprecipitation with 3 µg of anti-RelA, anti-c-Rel, or anti-p50 polyclonal Ab (Santa Cruz Biotechnology). Cross-linking was reversed overnight at 65°C and was followed by proteinase K digestion. Input DNA and precipitated DNA were purified and PCR amplified by primers encompassing the {kappa}B–105 in the promoters of p19 (sense: GGCTCTCCAAAGAGGGAGAT and antisense: CCACCTCCTTTGGTTCTGAG). They were also amplified by primers encompassing the {kappa}B sites in the promoters of p35 (sense: CCTCCAAATTACAGCTT GTC and antisense: GAGAAGATTTCAGCAGCAGT), p40 (sense: GTATCTCTGCCTCCTTCCTT and antisense: CTGATGGAAACCCAAAG TAG), and IL-6 (sense: GACATGCTCAAGTGCTGAGTCAC and antisense: AGATTGCACAATGTGACGTCG) as a positive control. The PCR products were analyzed by electrophoresis on 2% agarose gel.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Expression of the IL-23 p19 subunit is decreased in rela- and c-rel-deficient macrophages

To reveal the role of NF-{kappa}B transcription factor in the expression of IL-12 and IL-23 genes, we compared the expression of mRNAs of the p19, p35, and p40 subunits in macrophages deficient in the NF-{kappa}B molecules, RelA, c-Rel, or p52 with those in wild-type macrophages. Semiquantitative PCR revealed that LPS induced expression of the p19, p35, and p40 subunits in wild-type macrophages, and the addition of IFN-{gamma} enhanced this expression (Fig. 1A). As seen in dendritic cells (25), a marked decrease in expression of p19 subunit mRNA was detected in c-rel–/– macrophages. p35 mRNA expression, as well as p40 mRNA expression as described by Sanjabi et al. (13), was also decreased in c-rel–/– macrophages. Expression of p19 and p35 mRNAs in rela–/– macrophages was also decreased compared with that in wild-type macrophages. Unlike in rela–/– and c-rel–/– macrophages, the expression of these subunits in p52–/– macrophages was increased compared with that in wild-type macrophages when the cells were stimulated with LPS; however, when p52-deficient and sufficient cells were stimulated with LPS plus IFN-{gamma}, there was no difference in the expression of the cytokines. To confirm the results of semiquantitative PCR, we analyzed the mRNA expression by real-time PCR (Fig. 1B). Because we could not always detect the mRNA of every subunit in unstimulated cells even after 55 cycles of PCR amplification, we compared the mRNA levels between NF-{kappa}B-deficient cells and NF-{kappa}B-sufficient cells after LPS stimulation. mRNA expression in NF-{kappa}B-deficient cells relative to that in NF-{kappa}B-sufficient cells was calculated; a relative expression of one (as indicated by the bold line in Fig. 1B) indicated no difference between NF-{kappa}B-deficient and -sufficient cells. Real time PCR gave relative levels of expression of p19, p35, and p40 in c-rel–/– cells of 0.07 ± 0.01, 0.02 ± 0.02, and 0.002 ± 0.001 (mean ± SD), respectively. A significant decrease in p19 mRNA expression was also detected in rela–/– macrophages; the level of expression was about half that of rela+/+ cells (the relative expression is 0.47 ± 0.33). p35 mRNA expression was also significantly decreased; the relative expression level was 0.01 ± 0.01. In contrast, the level of p40 mRNA expression in rela–/– macrophages was not decreased. In p52–/– macrophages, significant increases in p19, p35, and p40 mRNA expression of ~9-fold, 3-fold, and 8-fold, respectively, were detected. Thus, expression of the p19 gene is dependent on c-Rel and RelA but not p52 in NF-{kappa}B molecules.


Figure 1
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 1. Expression of p19, p35, and p40 subunits in NF-{kappa}B-deficient macrophages were analyzed by semiquantitative RT-PCR (A) and real-time PCR (B). A, BMDMs were stimulated with LPS alone or LPS plus IFN-{gamma}, and the expression of each subunit in rela–/–, c-rel–/–, or p52–/– macrophages was compared with that in wild type cells. Expression of HPRT was measured as an internal control. The data presented are representative of at least four different mice. B, Levels of mRNA was quantified by real-time PCR. The expression of each subunit in NF-{kappa}B-deficient macrophages stimulated with LPS relative to that in wild-type macrophages was calculated by the {Delta}{Delta}Ct method. A relative expression level of 1 (indicated by the bold line) means that the level of expression in NF-{kappa}B-deficient cells is the same as that in wild-type cells. Data are presented as means ± SD of at least four different mice. *, p ≤ 0.01; **, p ≤ 0.05.

 
Expression of p19 is dependent on the proximal NF-{kappa}B motif

To examine whether the expression of p19 was regulated through NF-{kappa}B, we analyzed the promoter of the p19 gene. First, we used the 5'-RACE method to determine the actual transcription start site. The arrowhead in Fig. 2A indicates a transcription start site located at 39 bp upstream of the first exon described in the data from UCSC Genome Bioinformatics. To analyze the promoter region of p19, we used a luciferase-based reporter assay. We first used PCR amplification to isolate the fragment from nt –2993 to +477 (relative to the initiation of exon 1), which includes exon 1 and intron 1, by using the RPCI-23 MM BAC clone 346G15 as a template, and we inserted this fragment into the pGL3-Basic vector. This reporter gene responds to LPS, exhibiting about a 5-fold increase in transcription after LPS treatment, compared with pretreatment levels (data not shown). We also prepared reporter constructs that contained the sequences from –1490 to +477 and –1490 to +16; these respectively showed ~8-fold and 15-fold increase in transcription after LPS stimulation (data not shown). These results suggest that transcription of p19 may not be modulated through exon 1 or intron 1. Treatment with IFN-{gamma} alone failed to induce promoter activity in all of the reporter gene constructs, and the addition of IFN-{gamma} did not enhance LPS-induced promoter activity.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
FIGURE 2. The proximal {kappa}B site ({kappa}B–105) is necessary for expression of p19 promoter reporter construct. A, Sequence of p19 promoter from –1000 to +200 (relative to the initiation of exon 1 described in the data from UCSC Genome Bioinformatics). Arrowhead indicates the transcription start site determined by 5' RACE analysis. Three putative {kappa}B sites (nt –624 to –632, nt –513 to –503, and –105 to –96, indicated by bold underlines) were identified in the sequences between nt –937 and the start site of transcription by use of the TFSEARCH program (31 ). Parentheses indicate the {kappa}B site nucleotides deleted for the reporter assay shown in Fig. 2, C and D. B, A series of 5'-deletions of the –937 to +16 reporter construct was created. The deletion mutants were transiently transfected into RAW264 cells, which were stimulated with IFN-{gamma}, LPS, or LPS plus IFN-{gamma} for 24 h. The luciferase activities of the transfected constructs were then measured and normalized against that of an internal cotransfected β-galactosidase reporter. The data presented are representative of three independent experiments. C and D, Reporter constructs from which three or four nt were deleted from {kappa}B–642, {kappa}B–513, and {kappa}B–105 were transfected into RAW264 cells and evaluated in luciferase assays, as described in Fig. 2B.

 
We then used TFSEARCH, a computer program for searching transcription factor binding sites (31), to analyze the promoter region of the p19 gene from nt –937 to the transcriptional start site, because the construct containing a fragment spanning from nt –937 to +16 exhibited the same induction (~15-fold) of luciferase activity after LPS stimulation as did that containing the fragment corresponding to nt –1490 to +16. Three putative {kappa}B sites, at nt –642 to –632 ({kappa}B–642), nt –513 to –503 ({kappa}B–513), and nt –105 to –96 ({kappa}B–105), were identified (Fig. 2A). To determine which {kappa}B sites were responsible for p19 promoter activity, we prepared a series of 5'-deletion mutations of the p19 promoter (Fig. 2B). Deletion of nt –937 to –584 had minimal effect on luciferase activity despite the lack of {kappa}B–642. However, deletion of nt –584 to –484 markedly decreased luciferase activity (Fig. 2B). Gradual deletion from nt –484 to –184 gradually decreased luciferase activity, but the reporter construct containing nt –184 to +16 still demonstrated 4.7-fold of induction after LPS stimulation. In contrast, the construct with sequences from nt –83 to +16 was completely unresponsive to LPS stimulation.

Next, we prepared mutants that had 3- or 4-nt deletions at putative {kappa}B sites, as described in the parentheses in Fig. 2A. We examined about the most distal {kappa}B site ({kappa}B–642) and the proximal one ({kappa}B–105) (Fig. 2C). Mutation of {kappa}B–642 of the –937 to +16 reporter construct did not reduce its promoter activity, whereas similar mutation of {kappa}B–105 markedly impaired promoter activity. Mutation at both sites gave the same level of promoter activity as mutation at {kappa}B–105 alone. Therefore, in disagreement with the recent report by Carmody et al. (25), {kappa}B–642 is dispensable for p19 promoter activity. Mutation of {kappa}B–513 of the –584 to +16 reporter construct also did not reduce promoter activity, whereas that of {kappa}B–105 did (Fig. 2D). Mutation of {kappa}B–105 of the –184 to +16 reporter gene also markedly decreased promoter activity. The –154 to +16 reporter construct, which did not contained putative transcription factor binding sites other than {kappa}B–105, retained considerable promoter activity, showing a 3.3-fold induction of luciferase activity after LPS stimulation. These results show that the proximal {kappa}B site ({kappa}B–105), but not the distal ones ({kappa}B–513 and {kappa}B–642), is indispensable for transcription of the p19 gene.

NF-{kappa}B binds to {kappa}B–105 and {kappa}B–642 in vitro

To determine whether NF-{kappa}B associated with these putative {kappa}B sites in the promoter of the p19 gene, we prepared oligonucleotide probes of nt –111 to –90 ({kappa}B–105), nt –518 to –497 ({kappa}B–513), and nt –648 to –626 ({kappa}B–642). We used the {kappa}B consensus sequence as a positive control. On EMSA analysis, {kappa}B–105 and the consensus {kappa}B oligonucleotides, but not {kappa}B–513, were shifted by interacting with factors induced by LPS treatment (Fig. 3A). Two oligonucleotide-protein complexes (indicated by arrows A and B in Fig. 3A) were formed. The interaction between oligonucleotides and proteins was weaker in untreated cells than in LPS-stimulated cells. Although {kappa}B–642 is dispensable to p19 promoter activity, the {kappa}B–642 oligonucleotide was also shifted by the interaction.


Figure 3
View larger version (51K):
[in this window]
[in a new window]

 
FIGURE 3. EMSA analyses in which p19 promoter oligonucleotides were used as probes. A, Each of 32P-labeled probes indicated was mixed with an aliquot of cell extract corresponding to 10 µg protein from wild-type BMDMs cultured in medium alone or containing 1 µg/ml LPS. Arrows indicate shifted bands. B, Competition assay in which 32P-labeled consensus {kappa}B oligonucleotide was used as a probe. The probe was mixed with cell extracts from stimulated BMDMs in the absence or the presence of a 50-fold excess of the unlabeled oligonucleotides indicated. Competition assay between {kappa}B–105 and {kappa}B–642 oligonucleotides was also performed. 32P-labeled {kappa}B–105 or {kappa}B–642 oligonucleotide was mixed with cold {kappa}B–642 or {kappa}B–105 oligonucleotides, respectively. C, NF-{kappa}B molecules bind to p19 promoter. 32P-labeled {kappa}B–105 or {kappa}B–642 oligonucleotide was mixed with cell extracts from stimulated BMDMs in the presence of anti-p50, anti-RelA, or anti-c-Rel polyclonal Ab. Arrowheads indicate supershifted bands.

 
To examine whether the proteins interacting with the {kappa}B–105 and {kappa}B–642 oligonucleotides were NF-{kappa}B, we performed a competition assay in which we mixed 32P-labeled consensus {kappa}B oligonucleotide with excess unlabeled oligonucleotides and cell extract. Excess unlabeled {kappa}B–105 and {kappa}B–642 oligonucleotides disrupted the interaction between the probe and proteins (Fig. 3B); {kappa}B–642 oligonucleotide was less effective than {kappa}B–105 oligonucleotide in inhibiting the interaction. This disruption also occurred when {kappa}B–105 and {kappa}B–642 oligonucleotides were used as a probe: cold {kappa}B–105 oligonucleotide interfered totally with the interaction between {kappa}B–642 probe and proteins, whereas cold {kappa}B–642 oligonucleotide partly interfered the interaction of {kappa}B–105 probe and proteins. {kappa}B–513 oligonucleotide did not interfere with probe-proteins interactions at all (data not shown). We assessed the inhibition in the case of mutated oligonucleotides in which the GGGGAATCCC of {kappa}B–105 and the GGGGAATGCCC of {kappa}B–642 were respectively changed to GCCCAATCCC (mu{kappa}B–105) and GCCCAATGCCC (mu{kappa}B–642). The mutations led to the loss of inhibition of the interaction.

To confirm that NF-{kappa}B molecules interacted with the {kappa}B–105 and {kappa}B–642 oligonucleotides, we performed supershift assays using specific Abs. All NF-{kappa}B Abs used in the experiments supershifted the oligonucleotide-protein complexes when {kappa}B–105 and {kappa}B–642 oligonucleotides were used as probes (Fig. 3C). Anti-p50, anti-RelA, and anti-c-Rel Abs led to formation of the supershifted bands 1, 2, and 3, respectively; and anti-RelA Ab gave the strongest supershifted band. Lower exposure revealed that anti-p50 diminished the lower oligonucleotide-protein complex (band A), whereas the anti-RelA and c-Rel Abs diminished the upper complex (band B) (data not shown). This result suggests that complex A may be a homodimer of p50 and that complex B may be a heterodimer composed of p50 and RelA or p50 and c-Rel. EMSAs using extracts from RAW264 cells yielded similar results, except that the band supershifted by anti-RelA Ab (band 2) was weaker in RAW264 cells than in BMDMs (data not shown).

NF-{kappa}B interacts with the p19 promoter in vivo

To determine whether NF-{kappa}B molecules interacted with the proximal {kappa}B site {kappa}B–105 in the p19 promoter in vivo, we performed ChIP analysis. Chromatin was prepared from untreated BMDM s and from BMDMs stimulated with LPS and IFN-{gamma} and then precipitated with anti-p50, anti-RelA, and anti-c-Rel Abs. As NF-{kappa}B molecules are reported to associate with the IL-6 promoter (32), as a positive control we used sets of primers that encompassed the {kappa}B sites in the IL-6 to confirm that precipitation was successful. Anti-RelA, anti-c-Rel, and anti-p50 precipitated the IL-6 promoter of stimulated cells, but not untreated cells (Fig. 4). PCR-amplification of the immunoprecipitates using primers encompassing {kappa}B–105 of the p19 promoter revealed that RelA, c-Rel, and p50 associated with {kappa}B–105 in the stimulated cells. We also amplified the immunoprecipitates using primers encompassing {kappa}B–642, but specific bands for immunoprecipitates from anti-NF-{kappa}B Abs could not be detected (data not shown). Anti-NF-{kappa}B Abs also precipitated the p35 and p40 promoter sequences from the stimulated cells. These findings indicate that endogenous RelA, c-Rel, and p50 interact with {kappa}B–105 in the p19 promoter and with {kappa}B sites in the p35 and p40 promoters and that the stimulation induces these interactions.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 4. NF-{kappa}B molecules bind to the p19 promoter in vivo. ChIP analysis using wild-type BMDMs cultured in medium alone or containing LPS plus IFN-{gamma} was performed. Input DNA and the DNA precipitated with anti-RelA, anti-c-Rel, or anti-p50 Ab, or rabbit IgG as a negative control, were amplified by use of the primers indicated, which encompassed the NF-{kappa}B sites.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Our data indicate that expression of the p19 subunit of IL-23 is dependent on c-Rel and RelA in the NF-{kappa}B transcription factor, and that the proximal {kappa}B site located at nt –105 to –96 is responsible for the transcription of the p19 gene. First, expression of the p19 subunit was markedly reduced in c-rel-deficient macrophages, as also described in dendritic cells by Carmody et al. (25). We also found that p19 expression in rela-deficient macrophages was also decreased, to half that in wild-type macrophages (Fig. 1). Second, mutation of a putative {kappa}B site located at nt –105 to –96, but not at nt –624 to –632 or nt –513 to –503, abolished activation of the p19 promoter (Fig. 2). Third, EMSA analysis revealed that the sequence of {kappa}B–105 interacts with NF-{kappa}B and that LPS stimulation induces the interaction (Fig. 3). We characterized the proteins that complexed with {kappa}B–105 oligonucleotide as NF-{kappa}B, because the oligonucleotide disrupted interaction with a consensus {kappa}B oligonucleotide (Fig. 3B) and because the protein-nucleotide complex were supershifted by anti-RelA, anti-c-Rel, and anti-p50 polyclonal Abs (Fig. 3C). Although the sequence of {kappa}B–642 also interacted with NF-{kappa}B, the interaction seems to be less strong than that of {kappa}B–105, as discussed below. Fourth, ChIP analysis showed that endogenous NF-{kappa}B molecules interacted with the proximal {kappa}B site in the p19 promoter region in vivo (Fig. 4).

Although {kappa}B–642 interacted with NF-{kappa}B molecules in vitro, we could not prove that {kappa}B–642 was a functional {kappa}B site by luciferase assay (Fig. 2). 5'-deletion of nt –937 to –584 did not reduced the promoter activity of p19 gene, and mutation of {kappa}B–642 did not affect luciferase activity. These results are completely opposite to those reported by Carmody et al. (25), who showed that mutation of either {kappa}1 (corresponding to {kappa}B–105) or {kappa}2 (corresponding to {kappa}B–642) site abolished p19 promoter activity. Our EMSA analyses suggested that the interaction of {kappa}B–642 with the NF-{kappa}B molecules was less strong than that of {kappa}B–105, because cold {kappa}B–105 oligonucleotide inhibited consensus {kappa}B oligonucleotide-proteins interaction more strongly than did {kappa}B–642 oligonucleotide (Fig. 3B). Moreover, although {kappa}B–105 oligonucleotide completely inhibited {kappa}B–642 oligonucleotide-proteins interaction, only partial inhibition was seen in the case of the reciprocal exchange of probe and competitor. Because a very close sequence similarity between the two {kappa}B sites (the only difference being one G insertion at the eighth nucleotide in {kappa}B–642) exists, it was not surprising that an in vivo inactive {kappa}B site would bind to NF-{kappa}B in vitro. We could not demonstrate the in vivo association of the {kappa}B–624 site with NF-{kappa}B molecules by ChIP analysis, even after several trials with several sets of primers encompassing {kappa}B–642 sites (data not shown).

As is the case for {kappa}B–642, we have no evidence that the {kappa}B–513 site is a functional {kappa}B site. Although 5'-deletion of nt –584 to –485 markedly reduced the p19 promoter activity, specific mutation at the {kappa}B–513 site did not impair promoter activity. There may be additional elements within nt –584 to –485 that regulate p19 promoter activity. For example, the TFSEARCH program identified a putative binding site for GATA-1, –2, and –3 at nt –554 to –544. Further, the sequence of {kappa}B–513 neither bound to NF-{kappa}B molecules nor competed with a consensus {kappa}B sequence for interaction with NF-{kappa}B molecules (Fig. 3). The {kappa}B–105 site was located at 57 nt upstream from the transcription start site, as determined by 5' RACE analysis (Fig. 2). We did not detect p19 gene transcripts of other lengths. Therefore, the proximity of this site to the transcription start site may be responsible for its action as a functional {kappa}B site, as seen in other cytokine genes, such as IL-6 and IL-8 (28).

The profile of cytokine gene expression in c-rel-deficient macrophages has been well studied (13). Whereas the expression of proinflammatory cytokines (such as IL-6, IL-1β, and TNF-{alpha}) is not impaired by a deficiency of c-Rel, expression of the IL-12 p40 subunit is impaired in c-rel-deficient macrophages (13). As seen in c-rel-deficient dendritic cells (25, 33), we found that expression of p19 and p35 is markedly decreased in BMDMs.

Unlike the case with c-Rel knockout mice, little is known about the RelA knockout mice, because these mice are embryonic lethal at ED14. We therefore transferred rela-deficient fetal liver cells at ED13.5 into lethally irradiated CD45.1-positive congenic mice. Moreover, because rela-deficient macrophages undergo apoptosis 24 h after LPS stimulation (Ref. 13 and our unpublished observation), we were unable to examine IL-23 protein production. However, rela-deficient macrophages are apparently alive 6 h after LPS stimulation, and we detected a normal level of HPRT mRNA, an internal control. Under these conditions we also detected reduced expression of p19 and p35 mRNAs in rela-deficient macrophages, whereas the mRNA level of the p40 subunit was less affected (Fig. 1). Therefore, RelA may be necessary for expression of the p19 and p35 subunits but not the p40 subunit. These results are consistent with those of a report showing short interfering RNA against RelA suppresses expression of the p19 subunit but not of p40 (26). However, p19 expression in rela-deficient macrophages was reduced to a lesser extent than in c-rel-deficient macrophages; its level was half that in wild-type cells. It may not be due to contamination with wild-type cells because >95% of the cells were CD45.2-positive, which derived from transplanted fetal liver cells. It may be due to contamination with cells other than macrophages, in which p19 expression is not affected by RelA deficiency. Alternatively, we could not exclude the possibility that RelA-deficiency might indirectly affect the p19 expression. c-Rel may be more important than RelA for expression of the p19 subunit, although EMSA analysis indicated that RelA was more accessible to the {kappa}B–105 oligonucleotide than were c-Rel and p50 in vitro.

Unlike with RelA and c-Rel, expression of the subunits of IL-12 and IL-23 in p52-deficient cells was enhanced compared with that in wild-type cells. p52-deficiency leads to loss of formation of the p52 homodimer, which lacks transactivation domains and acts as a negative regulator of transcriptional activation (34). Alternatively, p100, which is a precursor gene product of p52, shows strong I{kappa}B-like activity by sequestering the RelA in the cytosol of cells (35). In fact, overexpression of p100 inhibits IL-6 promoter activity in monocytes (36). Speirs et al. (37) also demonstrated that IL-12 production after the stimulation with LPS but not anti-CD40 mAb was enhanced by deficiency of p52. Therefore, p52 is dispensable for the expression of IL-23 as well as IL-12 after LPS stimulation. If anti-p52 Ab were available for EMSA and ChIP analyses it would be interesting to examine whether p52 would participate in NF-{kappa}B complexes to induce of p19 expression. Unfortunately, we could not examine p19 expression in p50-deficient macrophages, because p50 knockout mice do not have a C57BL/6 background. We intend to backcross p50 knockout mice with C57BL/6 mice.

In contrast to the fact that c-Rel is needed to induce the expression of all subunits of IL-12 and IL-23, RelA is necessary for the p19 and p35 subunits but not the p40 subunit. Thus, expression of each subunit may be differentially regulated. For example, expression of the p35 but not the p40 subunit requires IFN regulatory factor 1 (38). Erk MAPK negatively regulates the p40 subunit, whereas negative regulation of the p35 subunit occurs via a calcium-dependent, but Erk-independent mechanism (39). Recently, it was reported that Rac1, a small GTPase, negatively regulates p19 expression but not p40 expression (26). Further, different stimuli induce different subunits. For example, Bordetella pertussis (40) and Francisella tularensis (41) induces high levels of expression of the p40 and p19 subunits but fails to induce p35 expression. Expression of the p35 subunit is induced by TLR4 agonist but not by TLR2 agonist, whereas expression of the p40 subunit is induced by both TLR agonists (22). It would be interesting to clarify the mechanism by which different stimuli induce different pathway of signal transduction and distinct sets of transcription factors to induce the expression of specific genes.

Although expression of the IL-12 p35 (38) and p40 subunits (14, 17, 18, 42) is augmented by the addition of IFN-{gamma} when the cells are stimulated with LPS, our luciferase-based reporter assays showed that IFN-{gamma} did not enhance p19 promoter activity (Fig. 2). The IFN-{gamma}-priming effect on the p35 promoter is mediated via IFN regulatory factor 1 (38), and, in the case of p40, IFN-{gamma} stimulation induces recruitment of IFN consensus sequence binding protein to the est site on the p40 promoter (17). Our addition of IFN-{gamma} to LPS did enhance transcription of p19 in BMDMs (Fig. 1A), but it did not in either murine peritoneal macrophages or the macrophage cell lines, RAW264 and J774.1 (data not shown). IFN-{gamma}-priming may affect the state of activation of the cells.

Although the nature of rela as a survival gene is well known, little is known about its role in immune response. IL-23 is a key cytokine in the inflammatory reaction in autoimmune diseases (10); in fact, the c-Rel knockout mouse is resistant to the experimental autoimmune diseases, experimental autoimmune encephalomyelitis (43) and collagen-induced arthritis (44). Therefore, it is of interest to us whether rela-deficient mice are similarly resistant to experimental autoimmune disease. Experiments in mice transplanted with rela–/– fetal liver cells will enable us to examine the role of RelA in various immune responses, such as experimental autoimmune diseases and infections.


    Acknowledgments
 
We thank Dr. S. Gerondakis (The Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria, Australia) for providing c-rel–/– mice and Dr. Gioacchino Natoli (European Institute of Oncology, Milan, Italy) for the ChIP protocol.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Takahiro S. Doi, Technology and Development Team for BioSignal Program, Subteam for BioSignal Integration, RIKEN BioResource Center, 3-1-1 Koyadai, Tsukuba, Japan. E-mail address: bri{at}brc.riken.jp Back

2 Abbreviations used in this paper: BMDM, bone marrow-derived macrophages; HPRT, hypoxanthine-guanine phosphoribosyltransferase; ChIP, chromatin immunoprecipitation. Back

Received for publication December 8, 2006. Accepted for publication September 12, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Hunter, C. A.. 2005. New IL-12-family members: IL-23 and IL-27, cytokines with divergent functions. Nat. Rev. Immunol. 5: 521-531. [Medline]
  2. Trinchieri, G., S. Pflanz, R. A. Kastelein. 2003. The IL-12 family of heterodimeric cytokines: new players in the regulation of T cell responses. Immunity 19: 641-644. [Medline]
  3. Parham, C., M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, et al 2002. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rb1 and a novel cytokine receptor subunit, IL-23R. J. Immunol. 168: 5699-5708. [Abstract/Free Full Text]
  4. Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3: 133-146. [Medline]
  5. Aggarwal, S., N. Ghilardi, M. Xie, F. J. de Sauvage, A. L. Gurney. 2003. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J. Biol. Chem. 278: 1910-1914. [Abstract/Free Full Text]
  6. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: 233-240. [Abstract/Free Full Text]
  7. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6: 1123-1132. [Medline]
  8. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat. Immunol. 6: 1133-1141. [Medline]
  9. Aggarwal, S., A. L. Gurney. 2002. IL17: prototype member of an emerging cytokine family. J. Leukocyte Biol. 71: 1-8. [Abstract/Free Full Text]
  10. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, et al 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744-748. [Medline]
  11. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, D. J. Cua. 2003. Divergent pro- and anti-inflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J. Exp. Med. 198: 1951-1957. [Abstract/Free Full Text]
  12. Wiekowski, M. T., M. W. Leach, E. W. Evans, L. Sullivan, S. Chen, G. Vassileva, J. F. Bazan, D. M. Gorman, R A. Kastelein, S. Narula, S. A. Lira. 2001. Ubiquitous transgenic expression of the IL-23 subunit p19 induces multiorgan inflammation, runting, infertility, and premature death. J. Immunol. 166: 7563-7570. [Abstract/Free Full Text]
  13. Sanjabi, S., A. Hoffmann, H. Liou, D. Baltimore, S. T. Smales. 2000. Selective requirement for c-Rel during IL-12 p40 gene induction in macrophages. Proc. Natl. Acad. Sci. USA 97: 12705-12710. [Abstract/Free Full Text]
  14. Murphy, T. L., M. Cleveland, P. Kukesza, J. Magram, K. M. Murphy. 1995. Regulation of interleukin 12 p40 expression through an NF-{kappa}B half-site. Mol. Cell. Biol. 15: 5258-5267. [Abstract/Free Full Text]
  15. Gri, G., D. Savio, G. Trinchieri, X. Ma. 1998. Synergistic regulation of the human interleukin-12 p40 promoter by NF{kappa}B and Ets transcription factors in Epstein-Barr virus-transformed B cells and macrophages. J. Biol. Chem. 273: 6431-6438. [Abstract/Free Full Text]
  16. Zhu, C., K. Gagnidze, J. H. M. Gemberling, S. E. Plevy. 2001. Characterization of an activation protein-1-binding site in the murine interleukin-12 p40 promoter. J. Biol. Chem. 276: 18519-18528. [Abstract/Free Full Text]
  17. Wang, I., C. Contursi, A. Masumi, X. Ma, G. Trinchieri, K. Ozato. 2000. An IFN-{gamma}-inducible transcription factor, IFN consensus sequence binding protein (ICSBP), stimulates IL-12 p40 expression in macrophages. J. Immunol. 165: 271-279. [Abstract/Free Full Text]
  18. Plevy, S., J. H. M. Gemberling, S. Hsu, A. J. Dorner, S. T. Smale. 1997. Multiple control elements mediate activation of the murine and human interleukin 12 p40 promoters: evidence of functional synergy between C/EBP and Rel proteins. Mol. Cell. Biol. 17: 4572-4588. [Abstract/Free Full Text]
  19. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13: 715-725. [Medline]
  20. Smits, H. H., A. J. van Beelen, C. Hessle, R. Westlund, E. de Jong, E. Soeteman, A. Wold, E. A. Wierenga, M. L. Kapsenberg. 2004. Commensal Gram-negative bacteria prime human dendritic cells for enhanced IL-23 and IL-27 expression and enhanced Th1 development. Eur. J. Immunol. 34: 1371-1380. [Medline]
  21. Li, J., B. Gran, G. Zhang, E. S. Ventura, I. Siglienti, A. Rostami, M. Kamoun. 2003. Differential expression and regulation of IL-23 and IL-12 subunits and receptors in adult mouse microglia. J. Neurol. Sci. 215: 95-103. [Medline]
  22. Re, F., J. Strominger. 2001. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells. J. Biol. Chem. 276: 37692-37699. [Abstract/Free Full Text]
  23. Pirhonen, J., S. Matikainen, I. Julkunen. 2002. Regulation of virus-induced IL-12 and IL-23 expression in human macrophages. J. Immunol. 169: 5673-5678. [Abstract/Free Full Text]
  24. Zhang, Z., A. Andoh, H. Yasui, O. Inatomi, K. Hata, T. Tsujikawa, K. Kitoh, A. Takayanagi, N. Shimizu, Y. Fujiyama. 2005. Interleukin-1β and tumor necrosis factor-{alpha} upregulate interleukin-23 subunit p19 gene expression in human colonic subepithelial myofibroblasts. Int. J. Mol. Med. 15: 79-83. [Medline]
  25. Carmody, R. J., Q. Ruan, H. Liou, Y. H. Chen. 2007. Essential roles of c-Rel in TLR-induced IL-23 p19 gene expression in dendritic cells. J. Immunol. 178: 186-191. [Abstract/Free Full Text]
  26. Utsugi, M., K. Dobashi, T. Ishizuka, T. Kawata, T. Hisada, Y. Shimizu, A. Ono, M. Mori. 2006. Rac1 negatively regulates lipopolysaccharide-induced IL-23 p19 expression in human macrophages and dendritic cells and NF-{kappa}B p65 trans activation play a novel role. J. Immunol. 177: 4550-4557. [Abstract/Free Full Text]
  27. Häcker, H., M. Karin. 2006. Regulation and function of IKK and IKK-related kinases. Sci. STKE. 17: re13
  28. Timothy, S. B., J. W. Christman. 1997. The role of nuclear factor-{kappa}B in cytokine gene regulation. Am. J. Respir. Cell Mol. Biol. 17: 3-9. [Abstract/Free Full Text]
  29. Doi, S. T., T. Takahashi, O. Taguchi, T. Azuma, Y. Obata. 1997. NF-{kappa}B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J. Exp. Med. 185: 953-961. [Medline]
  30. Kuroda, E., T. Kito, U. Yamashita. 2002. Reduced expression of STAT4 and IFN-{gamma} in macrophages from BALB/c mice. J. Immunol. 168: 5477-5482. [Abstract/Free Full Text]
  31. Heinemeyer, T., E. Wingender, I. Reuter, H. Hermjakob, A. E. Kel, O. V. Kel, E. V. Ignatieva, E. A. Ananko, O. A. Podkolodnaya, F. A. Kolpakov, N. L. Podkolodny, N. A. Kolchanov. 1998. Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res. 26: 364-370.
  32. Saccani, S., S. Pantano, G. Natoli. 2001. Two waves of nuclear factor {kappa}B recruitment to target promoters. J. Exp. Med. 193: 1351-1359. [Abstract/Free Full Text]
  33. Grumont, R., H. Hochrein, M. O’Keeffe, R. Gugasyan, C. White, I. Caminschi, W. Cook, S. Gerondakis. 2001. c-Rel regulates interleukin 12 p70 expression in CD8+ dendritic cells by specifically inducing p35 gene transcription. J. Exp. Med. 194: 1021-1031. [Abstract/Free Full Text]
  34. Schmitz, M. L., P. A. Baeuerle. 1991. The p65 subunit is responsible for the strong transcription activating potential of NF-{kappa}B. EMBO J. 10: 3805-3817. [Medline]
  35. Sun, S., P. A. Ganchi, C. Béraud, D. W. Ballard, W. C. Greene. 1994. Autoregulation of the NF-{kappa}B transactivator RelA (p65) by multiple cytoplasmic inhibitors containing ankyrin motifs. Proc. Natl. Acad. Sci. USA 91: 1346-1350. [Abstract/Free Full Text]
  36. de Wit, H., W. H. A. Dokter, S. B. Koopmans, C. Lummen, M. van der Leij, J. W. Smit, E. Vellenga. 1998. Regulation of p100 (NFKB2) expression in human monocytes in response to inflammatory mediators and lymphokines. Leukemia 12: 363-370. [Medline]
  37. Speirs, K., J. Caamano, M. H. Goldschmidt, C. A. Hunter, P. Scott. 2002. NF-{kappa}B2 is required for optimal CD40-induced IL-12 production but dispensable for Th1 cell differentiation. J. Immunol. 168: 4406-4413. [Abstract/Free Full Text]
  38. Liu, J., S. Cao, L. M. Herman, X. Ma. 2003. Differential regulation of interleukin (IL)-12 p35 and p40 gene expression and interferon (IFN)-{gamma}-primed IL-12 production by IFN regulatory factor 1. J. Exp. Med. 198: 1265-1276. [Abstract/Free Full Text]
  39. Goodridge, H. S., W. Harnett, F. Y. Liew, M. M. Harnett. 2003. Differential regulation of interleukin-12 p40 and p35 induction via Erk mitogen-activated protein kinase-dependent and independent mechanisms and the implications for bioactive IL-12 and IL-23 responses. Immunology 109: 415-425. [Medline]
  40. Fedele, G., P. Stefanelli, F. Spensieri, C. Fazio, P. Mastrantonio, C. M. Ausiello. 2005. Bordetella pertussis-infected human monocyte-derived dendritic cells undergo maturation and induce Th1 polarization and interleukin-23 expression. Infect. Immun. 73: 1590-1597. [Abstract/Free Full Text]
  41. Butchar, J. P., M. V. S. Rajaram, L. P. Ganesan, K. V. L. Parsa, C. D. Clay, L. S. Schlesinger, S. Tridandapani. 2007. Francisella tularensis induces IL-23 production in human monocytes. J. Immunol. 178: 4445-4454. [Abstract/Free Full Text]
  42. Ma, X., J. M. Chow, G. Gri, G. Carra, F. Gerosa, S. F. Wolf, R. Dzialo, G. Trinchieri. 1996. The interleukin 12 p40 gene promoter is primed by interferon {gamma} in monocytic cells. J. Exp. Med. 183: 147-157. [Abstract/Free Full Text]
  43. Hilliard, B. A., N. Mason, L. Xu, J. Sun, S. Lamhamedi-Cherradi, H. Liou, C. Hunter, Y. Chen. 2002. Critical roles of c-Rel in autoimmune inflammation and helper T cell differentiation. J. Clin. Invest. 110: 843-850. [Medline]
  44. Campbell, I. K., S. Gerondakis, K. O’Donnell, I. P. Wicks. 2000. Distinct roles the NF-{kappa}B1 (p50) and c-Rel transcription factors in inflammatory arthritis. J. Clin. Invest. 105: 1799-1806. [Medline]



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
K. M. Gillooly, M. A. Pattoli, T. L. Taylor, L. Chen, L. Cheng, K. R. Gregor, G. S. Whitney, V. Susulic, S. H. Watterson, J. Kempson, et al.
Periodic, Partial Inhibition of I{kappa}B Kinase {beta}-Mediated Signaling Yields Therapeutic Benefit in Preclinical Models of Rheumatoid Arthritis
J. Pharmacol. Exp. Ther., November 1, 2009; 331(2): 349 - 360.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Liu, X. Ouyang, J. Yang, J. Liu, Q. Li, Y. Gu, M. Fukata, T. Lin, J. C. He, M. Abreu, et al.
AP-1 Activated by Toll-like Receptors Regulates Expression of IL-23 p19
J. Biol. Chem., September 4, 2009; 284(36): 24006 - 24016.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Mise-Omata, E. Kuroda, T. Sugiura, U. Yamashita, Y. Obata, and T. S. Doi
The NF-{kappa}B RelA Subunit Confers Resistance to Leishmania major by Inducing Nitric Oxide Synthase 2 and Fas Expression but Not Th1 Differentiation
J. Immunol., April 15, 2009; 182(8): 4910 - 4916.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Al-Salleeh and T. M. Petro
Promoter Analysis Reveals Critical Roles for SMAD-3 and ATF-2 in Expression of IL-23 p19 in Macrophages
J. Immunol., October 1, 2008; 181(7): 4523 - 4533.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mise-Omata, S.
Right arrow Articles by Doi, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mise-Omata, S.
Right arrow Articles by Doi, T. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS