The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179, 6588 -6595
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samsom, J. N.
Right arrow Articles by Kraal, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samsom, J. N.
Right arrow Articles by Kraal, G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH

Secretory Leukoprotease Inhibitor in Mucosal Lymph Node Dendritic Cells Regulates the Threshold for Mucosal Tolerance

Janneke N. Samsom1,*,{dagger}, Arnold P. J. van der Marel*, Lisette A. van Berkel*,{dagger}, Joop M. L. M. van Helvoort{ddagger}, Ytje Simons-Oosterhuis{dagger}, Wendy Jansen*, Mascha Greuter*, Rob L. H. Nelissen§, Cees M. L. Meeuwisse, Edward E. S. Nieuwenhuis{dagger}, Reina E. Mebius* and Georg Kraal*

* Department of Molecular Cell Biology and Immunology, Vrije Universiteit University Medical Center, Amsterdam, The Netherlands; {dagger} Laboratory of Pediatrics, Division Gastroenterology, Erasmus Medical Center, Rotterdam, The Netherlands; {ddagger} Genomics Laboratory, Department of Physiological Chemistry, University Medical Center Utrecht, Utrecht, The Netherlands; § Department of Pharmacology, NV Organon, Oss, The Netherlands; and Department of Molecular Design and Informatics, NV Organon, Oss, The Netherlands


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The notion that the mucosal immune system maintains a tolerogenic response to harmless Ags while continually being challenged with microbial products seems an enigma. The aim of this study was to unravel mechanisms that are involved in regulating the development of tolerance under constant microbial pressure. The tolerogenic response to Ags administered via the nasal mucosa is dependent on the organized lymphoid tissue of the cervical lymph nodes (LN). We show that cervical LN differentially express secretory leukoprotease inhibitor (SLPI) compared with peripheral LN. SLPI was expressed by dendritic cells (DCs) and because SLPI is known to suppress LPS responsiveness, it was hypothesized that its expression in mucosal DCs may be required to regulate cellular activation to microbial products. Indeed, compared with wild-type controls, bone marrow-derived DCs from SLPI–/– mice released more inflammatory cytokines and enhanced T cell proliferation after stimulation with low dose LPS. This increased sensitivity to LPS was accompanied by increased NF-{kappa}B p65 activation in SLPI–/– DCs. In vivo, nasal application of OVA with LPS to SLPI–/– mice resulted in enhanced DC activation in the cervical LN reflected by increased costimulatory molecule expression and release of inflammatory cytokines. This led to failure to maintain tolerance to nasal OVA application in the presence of low doses of LPS. We propose that expression of SLPI functions as a rheostat by controlling the level of bacterial stimuli that induce mucosal DC activation. As such, it regulates the quality of the ensuing Ag-specific immune response in the mucosa draining LN.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Encounter of nonpathogenic Ags via mucosae induces a preferential development of immunological tolerance (1, 2). A pivotal event in this process is the differentiation of regulatory T cells in the mucosa-draining lymphoid tissue, which occurs rapidly after Ag encounter (3, 4, 5, 6). Differentiation of these suppressive T cells requires a defined presentation of Ag in the mucosa-draining lymph nodes (LN)2 that is not fully understood but may include particular subsets of dendritic cells (DCs) and the interaction of specific costimulatory molecules (7, 8, 9, 10, 11). Remarkably, this mucosal Ag presentation takes place in an environment that is continually challenged with vast amounts of environmental microorganisms, which are known to stimulate DC activation and enhance T cell responses. Yet, despite this continuous microbial pressure, tolerance to harmless Ags is maintained at the mucosal surface.

It is now well-appreciated that the commensal flora that resides at many mucosal sites is not simply ignored by the mucosal immune system. Instead, small numbers of commensal bacteria are retained by mucosal DCs which migrate to the local draining lymphoid tissues and induce a protective IgA response to these bacteria in the gastro-intestinal tract (12). Moreover, active interactions between epithelial cells and normal flora are essential to maintain intestinal homeostasis (13). Although benign, this active recognition of commensals uses similar signaling pathways as those of pathogenic bacteria involving the recognition of pathogen associated molecular patterns by TLRs on APCs or epithelial cells (13). Strikingly, these TLR-mediated signals affect not only innate mucosal immune responses, but also the adaptive Th2 immune response to inhaled protein Ag depends on activation of DCs by pathogen associated molecular pattern-containing microbial pathogens (14, 15). Moreover, TLR-4 deficient mice and germfree mice are known to be impaired in acquisition of oral tolerance to particulate Ag (16, 17, 18).

Therefore, the aim of this study was to unravel mechanisms that are involved in regulating the development of tolerance under this natural microbial pressure. Previously, we have shown that removal of the nose-draining cervical LN before nasal Ag application results in loss of tolerance, which cannot be reconstituted by transplantation of peripheral LN to this site (19). This suggested that cervical LN contain intrinsic factors that regulate the maintenance of mucosal tolerance (20, 21, 22). To identify the intrinsic regulatory factors that control mucosal tolerance, we have compared the gene expression pattern in the cervical LN with the peripheral LN.

Secretory leukoprotease inhibitor (SLPI) is a 11.7-kDa nonglycosylated serine protease inhibitor that is found in fluids lining mucosal surfaces (23, 24). In the lungs, its primary function is to protect the airway epithelium from destruction by elastase and cathepsin G that are released by activated neutrophils during inflammation (25). More recently, however, a role in wound healing, as well as antiviral, antimicrobial, and anti-inflammatory properties, has been ascribed to this protein (26, 27, 28, 29, 30, 31, 32). In particular, recent studies showed that SLPI attenuates LPS-induced endotoxin shock which is related to its capacity to inhibit NF-{kappa}B by blocking degradation of IRAK, I{kappa}B{alpha}, and I{kappa}Bβ, (33) or, possibly, by its capacity to directly inhibit NF-{kappa}B binding sites (34).

In this study, we report that DCs in the cervical LN express increased amounts of SLPI when compared with DCs of peripheral LN. Our data show that the restricted expression of SLPI in DCs in the mucosa-draining LN contributes to the tailored responsiveness of the mucosal immune system to LPS, thus protecting it from responding to continuous microbial pressure.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

BALB/c and SJL mice were obtained from Charles River Laboratories or Harlan and kept in our animal facility under routine laboratory conditions. Eight- to ten-week old SLPI–/– mice on a 129/C57BL/6 background and wild-type (WT) control littermates denoted as WT were provided by Dr. S. Wahl (National Institutes of Health, Bethesda, MD). All experiments performed were approved by the animal experiments committee of the Vrije Universiteit Medical Center.

Microarrays and PCR

Total RNA was purified from LN or sorted cells using the TRIzol isolation procedure for total RNA followed by the Oligotex mRNA isolation procedure for the isolation of poly(A)+ RNA. Microarray experiments were conducted at Incyte Genomics using the mouse microarray Mouse Gem 1.26 and Mouse Unigene 1.31/1.33. All resulting data sets were analyzed using an interquartile cut-off range of 3 to evaluate differential expression of genes within every experiment.

For semiquantitative PCR, cDNA was synthesized from total RNA using oligo-dT primer (Invitrogen Life Technologies) and Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies).

For quantitative analysis of mRNA expression, RNA was isolated from FACS-sorted cells using the Qiagen RNeasy kit. First-strand cDNA was synthesized from total RNA using a cDNA synthesis kit (MBI-Fermentas). Real-time quantitative PCR was performed using an AbiPrismR 7900 Sequence Detection System (PE Applied Biosystems) based on specific primers and general fluorescence detection with SYBR green. 18S and cyclophillin was used to control for sample loading and to allow normalization between samples. cDNA from LN of naive mice was used to allow normalization between separate experiments. Specific primers were designed across different constant region exons resulting in these primers:

SLPI: 5'end primer CTCCCCTGCCTTCACCAT, SLPI: 3'end primer CATACATCTTGCCTGAGTTTTGAC; Q-SLPI: 5' end primer AGCCACAATGCCGTACTGACT, Q-SLPI 3' end primer AGGCTTCCTCCA CACTGGTTT.

Flow cytometry and cell sorting

Single cell suspensions of cervical LN from WT and SLPI–/– were prepared by straining the tissues over 100 µm gauze. LN cells, or BM-DCs that had been cultured in vitro, were washed in PBS containing 2% heat-inactivated Newborn Calf serum (BioWhittaker) (FACS-buffer) and aliquots were incubated with Abs: anti-CD86 (clone GL-1), anti-CD40 (clone 3/23), FITC conjugated anti-MHCII (clone M5/114), PE-conjugated anti-CD80 (clone 1G10), 120G8 (clone 120G8), or anti-CD11c (clone HL3). Subsequently, the cells were washed three times with FACS buffer and, when conjugate staining was necessary, the cells were incubated on ice for 30 min with PE-conjugated donkey anti-rat Ig (Jackson Laboratories) or FITC-conjugated rabbit anti-rat Ig (Vector). After incubation the cells were washed and resuspended in FACS buffer and fluorescence was measured using a FACSCalibur (Becton Dickinson). For each sample, 50000, 70000, or 250000 events were analyzed. Cells that had been incubated with isotype control and/or conjugate alone served as negative controls.

For microarray and RT-PCR, lymphocytes were isolated from LN as described above. Purified B cells (>90%) and T cells (>95%) were obtained in a single step by sorting lymphocytes stained with 6B2-Alexa488 ({alpha}-B220), GK1.5-PE ({alpha}-CD4, BD Pharmingen), and 53–6.7-PE ({alpha}-CD-8, BD Pharmingen) on a FACStarPlus (Becton Dickinson). DC were sorted on positivity for CD11c and MHC class II to >95% purity.

Mucosal tolerance induction and delayed type hypersensitivity (DTH) reaction

For induction of nasal tolerance, mice received 400 µg OVA (OVA 99% pure, Seikagaku or OVA type VII, Sigma-Aldrich)/15 µl saline intranasally (i.n). To evaluate whether tolerance had developed, 4 days after the intranasal administration, the mice were sensitized by injecting 100 µg OVA/25 µl saline/25 µl IFA (Difco Laboratories) subcutaneously at the base of the tail. As a challenge for the DTH response, 10 µg OVA/10 µl saline was injected 5 days later in the auricle of each ear. The increase of ear thickness was measured with an engineer’s micrometer (Mitutoyo) at 24 h after the challenge and compared with the ear thickness as measured before OVA injection. Measurements were performed in blinded fashion. Values were expressed as the mean increase in ear thickness of both ears at 24 h postchallenge minus the mean ear thickness before challenge. In several experiments, 25 or 100 µg LPS from Escherichia coli 0111:B4 (Difco) was i.n. administered in a maximum volume of 20 µl saline before the i.n. OVA treatment.

Dendritic cell culture

Bone marrow-derived dendritic cells (BM-DCs) were cultured from WT or SLPI–/– mice. In brief, on day 0, femurs and tibiae of adult donor mice were flushed and the resulting BM suspension was passed through a 100-µm gauze to obtain a single cell suspension. The cells were seeded at 2 x 106 per petri-dish in IMDM (Invitrogen Life Technologies) supplemented with 10% heat-inactivated FCS, 50 U/ml sodium penicillin-G (BioWhittaker), 5 x 10–5 M 2-ME (Merck), and 20 ng/ml recombinant murine GM-CSF (X63-GM-CSF producing cell line supernatant (20)). On day 3, 20 ng/ml rmGM-CSF was added in 10 ml of fresh IMDM. On day 6, 10 ng/ml rmGM-CSF was added directly to the culture. On day 8, the nonadherent cells consisting of immature and mature BM-DC were harvested and used for subsequent experiments.

NF-{kappa}B activation assay

BM-DCs were seeded in 24-well plates (Greiner) at 7.5 x 105 cells per 750 µl per well. Cells were stimulated with 0, 1, 10, and 100 ng/ml LPS for 90 min. Next, cellular extracts were isolated using the transfactor extraction kit (Becton Dickinson) according to the manufacturer’s instructions. NF-{kappa}Bp65 activation was quantified using an oligonucleotide-based ELISA (Pierce) according to the supplier’s instructions. The background was assessed by incubation with binding buffer only. Controls included stimulated Hela cells, competition with free NF-{kappa}B oligo, and competition with free mutated NF-{kappa}B oligo. Data are represented as absorbance divided by background and denoted as arbitrary units.

Mixed leukocyte reaction

DCs were collected and resuspended in IMDM at a concentration of 1 x 106 cells/ml. Spleens of SJL mice were isolated, passed through a nylon mesh to obtain a single cell suspension, and erythrocytes were lysed using ammonium chloride buffer. Splenocytes were counted using trypan blue exclusion and brought to a final concentration of 1 x 106 cells/ml. DCs were incubated with 1 x 105 splenocytes in triplicates at ratios of 1:10, 1:100, and 1:1000 and cultured for 114 h. During the last 16 h of culture, 1.0µ Ci of methyl-[3H]thymidine (Amersham Biosciences) was added per well. The methyl-[3H]thymidine incorporation was determined and expressed in thousands of cpm.

Cytokine release by LN cells

The concentration of murine TNF-{alpha}, IL-12p70, IFN-{gamma}, MCP-1, IL-10, and IL-6 in culture supernatants was determined by cytometric bead array (BD Pharmingen) according to the manufacturer’s instructions.

Western blot for murine SLPI

Protein from whole BM-DC cell lysates was separated by SDS-PAGE and transferred to nitrocellulose. Western blots were stained with goat anti-mouse SLPI (R & D Systems) and developed with HRP-conjugated secondary Abs and the ECL detection system (GE Healthcare). To block nonspecific binding the membrane was incubated with milk.

Statistics

For ear swelling responses, the mean increase in ear thickness of both ears was determined for each mouse per group. Groups were compared by ANOVA followed by a Tukey-Kramer multiple comparisons test for ear swelling responses. A p value of <0.05 was considered significant. For experiments with a small number of samples a Mann-Whitney U test was applied.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Mucosal LN DCs express SLPI in an activation-induced manner

Mucosa-draining LN may harbor intrinsic capacities that regulate active immunological tolerance while continuously encountering microbial products. To identify these factors, gene expression profiles of mucosal and nonmucosal LN were compared. In three separate experiments, nose-draining cervical LN and peripheral LN were isolated from naive BALB/c mice and compared by competitive hybridization on the Incyte mouse microarrays MouseGEM1.26 and Mouse Unigene 1.31/1.33. After statistical analysis of the data, four genes were found to be expressed at significantly higher levels in the cervical LN compared with the peripheral LN. This result was consistently observed with peripheral LN harvested from different draining sites comprising brachial, axillary, and popliteal LN (Table I). Three of the identified genes coded for immunoglobulins and one for the protease inhibitor SLPI (Table I and Fig. 1A).


View this table:
[in this window]
[in a new window]

  		Table I. Differential expression analysis of cervical LN versus individual peripheral LNa

 

Figure 1
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 1. SLPI is differentially expressed in DCs of the mucosa-draining LN but not peripheral LN. A, Microarray hybridization signal strength for SLPI in cervical and peripheral LN. The cervical LN and peripheral LN were removed from naive mice and total RNA was isolated and analyzed as described in the legend of Table I. Data are obtained from 14 experiments using Harlan (7 ) and Charles River Laboratories (7 ) mice. B, Determination of the cellular location of SLPI in these mucosa-draining nodes. B and T cells were purified from cervical LN of naive mice by flow cytometric cell sorting and compared with whole LN cells with respect to SLPI expression by semiquantitative PCR. C, Expression of SLPI in purified DCs. DCs were purified from different LN of naive mice by flow cytometric cell sorting and compared with respect to SLPI expression by semiquantitative PCR. D, SLPI expression after intranasal treatment with OVA (OVA 99% pure Seikagaku, Tokyo, Japan or OVA type VII, Sigma-Aldrich). WT mice were treated i.n. with 400 µg OVA/15 µl saline or saline as a control. At 24 h posttreatment, the cervical LN and peripheral LN of three mice were pooled and SLPI expression was determined by quantitative PCR.

 
Expression of SLPI in LN is surprising as the protein is predominantly found in fluids lining the mucosa, consistent with its role in protecting against elastase-induced damage during mucosal inflammation (35). To unravel the function of SLPI in cervical LN, we determined the cellular location of SLPI in these mucosa-draining nodes. Therefore, B cells, T cells, and CD11c+MHCII+ DCs were purified from cervical LN of naive mice by flow cytometric cell sorting and compared with whole LN homogenate with respect to SLPI expression by semiquantitative PCR. As shown in Fig. 1B, neither B nor T cells in cervical LN expressed detectable amounts of SLPI mRNA whereas it was clearly detected in whole LN homogenate. Subsequent analysis of purified DCs from cervical LN and mesenteric LN showed that these cells expressed significant amounts of SLPI RNA. The expression was limited to DCs residing in LN that drain the mucosa and was absent in peripheral LN-DC (Fig. 1C). Sorting of DC subsets from the cervical and mesenteric LN confirmed that SLPI mRNA expression was observed in CD11c+MHCII+CD8+ DC, CD11c+MHCII+CD11b+ DC as well as CD11cintMHCII+120G8+ plasmacytoid DC (data not shown). In addition, CD45– stromal cells in the cervical LN of naive mice did not express detectable amounts of SLPI (data not shown).

Intranasal treatment with soluble OVA protein increased the mRNA expression of SLPI in the cervical LN (Fig. 1D). As stimulation with microbial products has been shown to induce SLPI in mononuclear cells and as most OVA preparations are contaminated with endotoxin, a comparison was made between two OVA preparations in their capacity to induce enhanced SLPI expression in the cervical LN. The first OVA preparation was OVA grade VII from Sigma-Aldrich that contained at maximum 50 pg endotoxin per mg and increased SLPI expression by 6-fold of baseline (Fig. 1D). The second preparation was a well-defined noncontaminated OVA from Seikagaku, that was demonstrated to have no detectable endotoxin activity by failure to activate BM-DC. The increase in SLPI was dependent on endotoxin contamination as highly pure OVA (Seikagaku) enhanced SLPI expression to a lesser extent than endotoxin contaminated OVA (Sigma-Aldrich) (Fig. 1D). As the OVA preparation from Sigma enhanced SLPI expression in cervical LN but when given intranasally normally induced mucosal tolerance this preparation was used in additional experiments unless otherwise indicated.

In naive mice, SLPI expression by DC is differentially found in the mucosa draining LN. As SLPI expression can be induced by microbial products, it was hypothesized that continuous encounter with microbial products from normal flora caused SLPI expression in mucosa draining nodes. Absence of SLPI expression in DC from peripheral LN could result from absence of microbial stimulation. Therefore, it was questioned whether DC from peripheral LN could also express SLPI upon encounter with LPS and/or protein Ag. To test this, mice were treated i.m. with saline, OVA (endotoxin-free), LPS or OVA (endotoxin-free) + LPS. After 24 h, the draining LN popliteal and inguinal LN were removed and analyzed for SLPI mRNA expression within the LN. Indeed, i.m. treatment with LPS and OVA+LPS induced detectable SLPI expression in the peripheral LN when compared with saline treatment (Fig. 2A). To confirm that the SLPI in peripheral LN was also expressed by DC, CD11c+MHCII+ DC were purified by flow-cytometric sorting and analyzed for quantitative PCR analysis. As can be seen in Fig. 2B highly purified DC from the peripheral LN express SLPI after i.m. OVA+LPS exposure.


Figure 2
View larger version (12K):
[in this window]
[in a new window]

  		FIGURE 2. Effect of i.m. treatment on SLPI expression in peripheral LN. Mice were treated i.m. with saline, endotoxin-free OVA (400 µg), LPS (50 µg), or a combination of endotoxin-free OVA and LPS. At 24 h, draining popliteal and inguinal nodes were removed and pooled. SLPI, CD11c, and cyclophillin mRNA expression were determined. SLPI expression is expressed relative to CD11c (A). Mice were treated i.m. with saline or a combination of endotoxin-free OVA (400 µg) and LPS (50 µg). At 24 h, draining popliteal and inguinal nodes were removed and pooled. DC were purified by flowcytometric sorting on CD11c+MHCII+ to 95–98% purity. SLPI, CD11c, and cyclophillin mRNA expression were determined. SLPI expression in PLN DC is expressed relative to CD11c (B).

 
These data show that mucosal LN-DC express the known modulator of LPS responses SLPI, and provide evidence that this expression is regulated upon immune activation.

SLPI attenuates DC function in vitro

The capacity of SLPI to suppress LPS responsiveness by macrophages made it a candidate to regulate cellular activation of mucosal DC to microbial products. During differentiation with GM-CSF, BM-DC retain their capacity to express SLPI (data not shown) and secrete SLPI protein (Fig. 3A). To mimic the effect of microbial pressure on DC in the mucosa draining LN, BM-DCs from SLPI–/– mice and WT controls were stimulated with low dose LPS during 48 h in vitro and cytokine release was measured. When stimulated with LPS, BM-DCs from SLPI–/– mice released increased amounts of IL-12p70 compared with BM-DCs from WT mice (Fig. 3B). For TNF-{alpha}, no difference was detected. It should be noted that before stimulation SLPI–/– and WT BM-DC did not differ with respect to basal levels of cytokine release, phenotype, morphology, or TLR4 mRNA expression (data not shown). Intracellular SLPI is known to inhibit TLR 4 signaling by suppressing the activation of NF-{kappa}B by preventing the degradation of the inhibitory factor I{kappa}B (32, 36, 37). To see whether SLPI is involved in suppression of cellular activation in DCs, we compared the level of NF-{kappa}B p65 activation in LPS-stimulated WT and SLPI–/– BM-DCs. After 90 min of stimulation with 1 ng/ml LPS, SLPI–/– DC lysates contained ~2.5 times more activated NF-{kappa}B p65 than WT controls (Fig. 3C). Although the amount of activated NF-{kappa}B p65 increased in WT BM-DCs upon stimulation with higher concentrations of LPS, the level in SLPI–/– BM-DCs could not be further increased (Fig. 3C). Additionally, even though SLPI–/– BM-DCs contained higher baseline levels of activated NF-{kappa}B p65 (Fig. 3C), this did not result in cytokine production without further stimulation (Fig. 3B).


Figure 3
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 3. SLPI suppresses LPS-induced DC activation in vitro. A, BM-DCs were cultured from WT mice as indicated in Materials and Methods. On day 8, the nonadherent cells consisting of immature and mature BM-DC were harvested and cultured with medium, LPS from Escherichia coli 0111:B4 (100 ng/ml) or OVA (1 mg/ml) from Sigma-Aldrich. At 24 h of culture, the supernatant was harvested and analyzed for SLPI protein by Western blot using biotinylated goat anti-mouse SLPI (R&D Systems). B, WT or SLPI–/– BM-DCs were seeded in wells and stimulated with various concentrations of LPS. The cells were cultured at 37°C and 5% CO2. Cytokine release by 1 x 106 cells/ml at 24 h of culture with 1 ng/ml LPS. C, NF-{kappa}B p65 activation was determined in cell lysates of 7.5 x 105 BM-DCs at 90 min poststimulation with indicated concentrations of LPS. D, Induction of T cell proliferation by WT and SLPI–/– BM-DCs was measured after 24 h stimulation with 1 ng/ml LPS. DCs were irradiated and cocultured in a MLR with 1 x 105 splenocytes at ratios of 1:10, 1:100, and 1:1000 and cultured for 114 h. Proliferation was measured using [3H]thymidine; n = 3 ± SD.

 
This shows that SLPI regulates cellular activation of DCs in response to LPS. To assess whether this enhanced activation of SLPI–/– DCs translated into a functional difference in Ag presentation, mixed leukocyte reactions were performed with BM-DCs after stimulation with 1 ng/ml LPS during 24 h. Indeed, LPS-stimulated SLPI–/– BM-DCs induced increased T cell proliferation when compared with WT BM-DCs at a DC to splenocyte ratio of 1:100 (Fig. 3D). In conclusion, in response to LPS stimulation in vitro, SLPI-deficient DCs secrete more IL-12p70, contain more activated NF-{kappa}B p65, and elicit enhanced T cell proliferation. These findings indicate that DC-derived SLPI may function to dampen immune responses in the presence of LPS.

SLPI regulates activation of DCs in the mucosa draining LN

Next, we questioned whether the regulatory function of SLPI in DC activation could also be demonstrated for LN-DCs in vivo in a microenvironment with endogenous LPS. As SLPI is expressed in DCs of mucosal LN but not peripheral LN and SLPI is increased upon i.n. OVA administration, we treated WT and SLPI-deficient mice with OVA via the nasal mucosa. At 24 h after treatment, the cervical LN were removed and DCs were analyzed for costimulatory molecule expression or cytokine release after 24 h of culture.

In cervical LN cells from SLPI-deficient mice, treatment with OVA induced moderately enhanced levels of CD40, CD86, and MHC class II on CD11c+ cells in comparison with WT control mice, whereas the expression of the costimulatory molecule CD80 was comparable in both groups of mice (Fig. 4).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 4. SLPI suppresses costimulatory molecule expression by DCs in vivo. SLPI-deficient and WT mice were treated i.n. with 400 µg OVA/15 µl saline saline as a control. After 24 h, the cervical LN were removed and single cell suspensions were stained for flow cytometric analysis. Increase of costimulatory molecule expression is expressed as MFI; n = 3 ± SEM.

 
Inflammatory cytokine accumulation in total LN cell cultures confirmed a role for SLPI in regulating cellular activation. Cells from SLPI-deficient mice released higher amounts of inflammatory cytokines such as IL-12p70, MCP-1, and IL-6 after OVA treatment (Fig. 5).


Figure 5
View larger version (16K):
[in this window]
[in a new window]

  		FIGURE 5. SLPI suppresses cytokine release by DCs in vivo. SLPI-deficient and WT mice were treated i.n. with 400 µg OVA/15 µl or saline as a control. After 24 h, the cervical LN were removed, single cell suspensions were cultured for 24 h, and cytokine release into supernatant was determined using cytometric bead array analysis; n = 3 ± SEM.

 
These data show that in vivo, in a mucosal environment with endogenous LPS, SLPI controls DC activation in response to particulate Ag.

Role of SLPI in mucosal tolerance induction

DCs play a central role in the mucosal immune response by providing a balanced Ag presentation to T cells that favors induction of tolerance to harmless Ag rather than productive immunity. To assess whether the enhanced DC activation in cervical LN of SLPI-deficient mice perturbs the T cell response, we monitored the development of mucosal tolerance. Thereto, SLPI-deficient mice and WT controls received OVA or saline via the nasal mucosa and were subsequently subjected to a standard systemic DTH challenge to assess whether tolerance to OVA had developed. Similar to WT controls, SLPI-deficient mice were able to suppress a DTH response after nasal pretreatment with OVA, as can be seen from Fig. 6, where a comparable reduction in ear thickness is seen for WT and SLPI-deficient mice in the tolerized (OVA) group. These data suggest that the mucosal immune response to harmless soluble Ag is not dependent on SLPI.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 6. SLPI attenuates adjuvant activity of LPS during mucosal tolerance induction. Nasal tolerance was induced in SLPI–/– mice and WT controls by the i.n. administration of 400 µg OVA/15 µl saline. Control mice received saline. Two groups received 400 µg OVA/15 µl saline i.n. in combination with either 25 µg LPS/15 µl i.n. or 100 µg LPS/20 µl i.n. respectively. A fifth group received 100 µg LPS/20 µl saline i.n. alone. Four days later, the establishment of tolerance was assessed by sensitizing the mice with OVA/IFA subcutaneously in the tail base and 5 days later injecting 10 µg OVA protein in the auricle of each ear as a challenge for DTH response. The increase of ear thickness was measured at 24 h after the challenge and compared with the ear thickness as measured before OVA injection. Values are expressed as the mean increase in ear thickness of both ears of one mouse at 24 h postchallenge relative to the mean ear thickness before challenge; n = 7 ± SEM.

 
However, when SLPI-deficient and WT controls were treated i.n. with OVA in combination with low dose LPS, SLPI-deficient mice did not remain tolerant (Fig. 6). At a higher dose of LPS, the ear thicknesses of SLPI-deficient mice remained significantly increased compared with WT controls (Fig. 6). Crucially, i.n. LPS treatment alone did not affect the DTH response. The latter observation confirms that the i.n. LPS treatment in the absence of SLPI merely altered the response to nasal Ag treatment whereas no effect on the systemic Ag treatment occurred.

From these results we conclude that SLPI expression in DCs of the mucosa-draining LN can restrict low intensity LPS stimulation which is beneficial for the development of a regulatory response but once pathogenic amounts of LPS are encountered a productive inflammatory immune response develops.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
It is now widely accepted that microbial stimulation at mucosal surfaces is beneficial for the maintenance of homeostasis. In consequence, the intricate processes that regulate discrimination between benign microbial signals and pathogenic microbial signals are a major topic of investigation. It is thought that regulation is partially achieved by the precise immune geography of the response to commensal bacteria. This is evidenced by the observation that DCs loaded with commensal bacteria from the intestine do not penetrate any further than gut-draining mesenteric LN and cannot reach systemic secondary lymphoid organs (12, 38). Crucially, within the same mucosa-draining LN, simultaneous presentation of harmless protein Ags, such as food Ags, by DCs occurs without the development of a productive immune response. Such simultaneous presentation requires a very tight cellular regulation. We propose that SLPI expression in DCs functions as a local rheostat controlling the intensity of LPS signals leading to a tailored adaptive immune response. This control allows for protective LPS signals to orchestrate tolerance whereas pathogenic levels of LPS set off an inflammatory immune response. It is therefore not surprising that the expression of this molecule is restricted to DC of the mucosa-draining LN, sites where continuous encounter with LPS from normal flora occurs.

SLPI influences multiple aspects of the TLR mediated adaptive immune responses in the mucosa draining LN. First, it controls LPS induced cytokine secretion and costimulatory molecule expression by DC. This is consistent with our finding that in the absence of endogenous SLPI, mucosal LN-DCs expressed enhanced levels of costimulatory molecules and secreted more IL-12p70, MCP-1, and IL-6 in response to nasal Ag application. By restricting this DC activation SLPI can limit the vigor of the T cell response as is illustrated by the enhanced T cell proliferation induced by SLPI–/– DC in vitro (Fig. 2C).

Secondly, such attenuated APC activation and T cell proliferation affects the nature of the developing immune response. Previously, we have shown that within days after mucosal Ag application tolerance develops through differentiation of Ag specific regulatory T cells in the mucosa-draining LN (3, 4). Coadmistration of exogenous LPS with soluble Ag alters the kinetics of Ag-specific T cell proliferation resulting in defective regulatory T cell differentiation in the cervical LN and subsequent loss of mucosal tolerance (4). This proves that pathogenic amounts of LPS will override the balanced Ag presentation that is required for optimal Tr induction and lead to an inflammatory response instead of tolerance (4). In this study, we show that in the absence of SLPI, sensitivity to TLR-4 signaling is increased, causing a faster progression in loss of tolerance to protein Ag that is coadministered with LPS (Fig. 6). Therefore, we conclude that SLPI is involved in maintaining a high threshold to LPS at the level of the mucosa- draining LN. In consequence, SLPI can restrict low intensity LPS stimulation in the cervical LN, which is beneficial for the development of a regulatory response, but once pathogenic amounts of LPS are encountered a productive inflammatory immune response ensues.

SLPI is constitutively expressed in the mucosa-draining LN. Upon application of OVA this expression is increased. This finding may seem surprising as known inducers of SLPI are inflammatory mediators such as IFN-{gamma} and bacterial products such as LPS and PGN. There may be multiple factors that mediate this increase in expression. First, intranasal application of protein Ag may elicit enhanced translocation of mucosal DCs that contain commensal bacteria and as a result express SLPI. However, the number of recruited cells may be very low as we have previously attempted to quantify an increase in cellularity of the CLN after i.n. OVA application but could not detect changes in total cell number nor changes in DC subsets by flow cytometry (20). Secondly, as reported by other researchers, OVA protein may have a residual contamination with endotoxin (14) which may play a role in SLPI induction. Indeed OVA (Sigma-Aldrich) that contained at maximum 50 pg endotoxin per µg increased SLPI expression by 6-fold of baseline (Fig. 1D). In contrast, highly pure OVA (Seikagaku) that had no detectable endotoxin activity in priming naive BM-DC (data not shown) induced an increase of SLPI expression by 2- to 3-fold over baseline (Fig. 1D).

The mechanisms by which SLPI modulates LPS sensitivity in DCs may operate at three different levels in the LPS signaling cascade. SLPI can act in its secretory form as well as in its cytosolic form (39). The secretory form of SLPI may have direct extracellular interaction with LPS before the molecule interacts with the cells. As such, human recombinant SLPI can bind to purified endotoxin in vitro causing a decrease in binding of LPS to soluble CD14 (40). Secondly, intracellular SLPI may interfere with TLR 2 and 4 signaling by interfering with the activation of the transcription factor NF-{kappa}B by preventing the degradation of the inhibitory factor IkBa (32). Whether the inhibitory effects of SLPI on this degradation step of IkBa are dependent on a possible splice variant producing a nonsecretory form of SLPI is unclear (39). Thirdly, it has recently been established in human monocytes that SLPI can act directly in the nucleus by binding an NF-{kappa}B consensus sequence in the promoter region of the IL-8 and TNF-{alpha} gene, inhibiting subsequent binding of p65 to the NF-{kappa}B DNA binding site (34). The exact contribution of both intracellular as well as extracellular forms of SLPI in the regulation of DC function remains to be established.

Our finding that endogenous SLPI modulates DC activity and subsequent T cell responses in the mucosa-draining LN has important consequences for understanding the finesse of immune regulation at mucosal sites.


   Acknowledgments
 
We acknowledge Dr. Sharon Wahl (National Institutes of Health, Bethesda, MD) for providing us with the SLPI mutant mice. Erwin van Gelderop, Dennis Bogaert, Bianca Jongmans, Lisa van Baarsen, Rolien Raatgeep, and Martijn A. Nolte are thanked for technical assistance or animal care and we appreciate the helpful advice of Menno de Winther and Edwin Kanters for the NF-{kappa}B experiments.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Janneke N. Samsom, Laboratory of Pediatric Gastroenterology, Erasmus Medical Center, Room EE1567A, P.O. Box 2040, 3000 CA Rotterdam, The Netherlands. E-mail address: j.samsom{at}erasmusmc.nl Back

2 Abbreviations used in this paper: LN, lymph node; DC, dendritic cell; SLPI, secretory leukoprotease inhibitor; WT, wild type; DTH, delayed type hypersensitivity; i.n., intranasally; BM-DC, bone marrow-derived DC. Back

Received for publication October 30, 2006. Accepted for publication September 12, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Faria, A. M., H. L. Weiner. 1999. Oral tolerance: mechanisms and therapeutic applications. Adv. Immunol. 73: 153-264. [Medline]
  2. Mowat, A. M., J. L. Viney. 1997. The anatomical basis of intestinal immunity. Immunol. Rev. 156: 145-166. [Medline]
  3. Hauet-Broere, F., W. W. Unger, J. Garssen, M. A. Hoijer, G. Kraal, J. N. Samsom. 2003. Functional CD25– and CD25+ mucosal regulatory T cells are induced in gut-draining lymphoid tissue within 48 h after oral antigen application. Eur. J. Immunol. 33: 2801-2810. [Medline]
  4. Unger, W. W., F. Hauet-Broere, W. Jansen, L. A. van Berkel, G. Kraal, J. N. Samsom. 2003. Early events in peripheral regulatory T cell induction via the nasal mucosa. J. Immunol. 171: 4592-4603. [Abstract/Free Full Text]
  5. Samsom, J. N.. 2004. Regulation of antigen-specific regulatory T-cell induction via nasal and oral mucosa. Crit. Rev. Immunol. 24: 157-177. [Medline]
  6. Mucida, D., N. Kutchukhidze, A. Erazo, M. Russo, J. J. Lafaille, M. A. Curotto de Lafaille. 2005. Oral tolerance in the absence of naturally occurring Tregs. J. Clin. Invest. 115: 1923-1933. [Medline]
  7. Viney, J. L., A. M. Mowat, J. M. O’Malley, E. Williamson, N. A. Fanger. 1998. Expanding dendritic cells in vivo enhances the induction of oral tolerance. J. Immunol. 160: 5815-5825. [Abstract/Free Full Text]
  8. Williamson, E., J. M. Bilsborough, J. L. Viney. 2002. Regulation of mucosal dendritic cell function by receptor activator of NF-{kappa}B (RANK)/RANK ligand interactions: impact on tolerance induction. J. Immunol. 169: 3606-3612. [Abstract/Free Full Text]
  9. Chirdo, F. G., O. R. Millington, H. Beacock-Sharp, A. M. Mowat. 2005. Immunomodulatory dendritic cells in intestinal lamina propria. Eur. J. Immunol. 35: 1831-1840. [Medline]
  10. Miyamoto, K., C. I. Kingsley, X. Zhang, C. Jabs, L. Izikson, R. A. Sobel, H. L. Weiner, V. K. Kuchroo, A. H. Sharpe. 2005. The ICOS molecule plays a crucial role in the development of mucosal tolerance. J. Immunol. 175: 7341-7347. [Abstract/Free Full Text]
  11. Lin, H. H., D. E. Faunce, M. Stacey, A. Terajewicz, T. Nakamura, J. Zhang-Hoover, M. Kerley, M. L. Mucenski, S. Gordon, J. Stein-Streilein. 2005. The macrophage F4/80 receptor is required for the induction of antigen-specific efferent regulatory T cells in peripheral tolerance. J. Exp. Med. 201: 1615-1625. [Abstract/Free Full Text]
  12. Macpherson, A. J., T. Uhr. 2004. Compartmentalization of the mucosal immune responses to commensal intestinal bacteria. Ann. NY Acad. Sci. 1029: 36-43. [Medline]
  13. Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, R. Medzhitov. 2004. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 118: 229-241. [Medline]
  14. Eisenbarth, S. C., D. A. Piggott, J. W. Huleatt, I. Visintin, C. A. Herrick, K. Bottomly. 2002. Lipopolysaccharide-enhanced, toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J. Exp. Med. 196: 1645-1651. [Abstract/Free Full Text]
  15. Piggott, D. A., S. C. Eisenbarth, L. Xu, S. L. Constant, J. W. Huleatt, C. A. Herrick, K. Bottomly. 2005. MyD88-dependent induction of allergic Th2 responses to intranasal antigen. J. Clin. Invest. 115: 459-467. [Medline]
  16. Wannemuehler, M. J., H. Kiyono, J. L. Babb, S. M. Michalek, J. R. McGhee. 1982. Lipopolysaccharide (LPS) regulation of the immune response: LPS converts germfree mice to sensitivity to oral tolerance induction. J. Immunol. 129: 959-965. [Medline]
  17. Michalek, S. M., H. Kiyono, M. J. Wannemuehler, L. M. Mosteller, J. R. McGhee. 1982. Lipopolysaccharide (LPS) regulation of the immune response: LPS influence on oral tolerance induction. J. Immunol. 128: 1992-1998. [Medline]
  18. Kiyono, H., J. R. McGhee, M. J. Wannemuehler, S. M. Michalek. 1982. Lack of oral tolerance in C3H/HeJ mice. J. Exp. Med. 155: 605-610. [Abstract/Free Full Text]
  19. Wolvers, D. A., C. J. Coenen-de Roo, R. E. Mebius, M. J. van der Cammen, F. Tirion, A. M. Miltenburg, G. Kraal. 1999. Intranasally induced immunological tolerance is determined by characteristics of the draining lymph nodes: studies with OVA and human cartilage gp-39. J. Immunol. 162: 1994-1998. [Abstract/Free Full Text]
  20. Samsom, J. N., L. A. van Berkel, J. M. van Helvoort, W. W. Unger, W. Jansen, T. Thepen, R. E. Mebius, S. S. Verbeek, G. Kraal. 2005. Fc {gamma} RIIB regulates nasal and oral tolerance: a role for dendritic cells. J. Immunol. 174: 5279-5287. [Abstract/Free Full Text]
  21. van Helvoort, J. M., J. N. Samsom, D. Chantry, W. Jansen, I. Schadee-Eestermans, T. Thepen, R. E. Mebius, G. Kraal. 2004. Preferential expression of IgG2b in nose draining cervical lymph nodes and its putative role in mucosal tolerance induction. Allergy 59: 1211-1218. [Medline]
  22. Kraal, G., J. N. Samsom, R. E. Mebius. 2006. The importance of regional lymph nodes for mucosal tolerance. Immunol. Rev. 213: 119-130. [Medline]
  23. Doumas, S., A. Kolokotronis, P. Stefanopoulos. 2005. Anti-inflammatory and antimicrobial roles of secretory leukocyte protease inhibitor. Infect. Immun. 73: 1271-1274. [Free Full Text]
  24. Hiemstra, P. S., B. A. Fernie-King, J. McMichael, P. J. Lachmann, J. M. Sallenave. 2004. Antimicrobial peptides: mediators of innate immunity as templates for the development of novel anti-infective and immune therapeutics. Curr. Pharm. Des. 10: 2891-2905. [Medline]
  25. Fryksmark, U., T. Prellner, H. Tegner, K. Ohlsson. 1984. Studies on the role of antileukoprotease in respiratory tract diseases. Eur. J. Respir. Dis. 65: 201-209. [Medline]
  26. Angelov, N., N. Moutsopoulos, M. J. Jeong, S. Nares, G. Ashcroft, S. M. Wahl. 2004. Aberrant mucosal wound repair in the absence of secretory leukocyte protease inhibitor. Thromb. Haemost. 92: 288-297. [Medline]
  27. Ashcroft, G. S., K. Lei, W. Jin, G. Longenecker, A. B. Kulkarni, T. Greenwell-Wild, H. Hale-Donze, G. McGrady, X. Y. Song, S. M. Wahl. 2000. Secretory leukocyte protease inhibitor mediates non-redundant functions necessary for normal wound healing. Nat. Med. 6: 1147-1153. [Medline]
  28. Ma, G., T. Greenwell-Wild, K. Lei, W. Jin, J. Swisher, N. Hardegen, C. T. Wild, S. M. Wahl. 2004. Secretory leukocyte protease inhibitor binds to annexin II, a cofactor for macrophage HIV-1 infection. J. Exp. Med. 200: 1337-1346. [Abstract/Free Full Text]
  29. McNeely, T. B., D. C. Shugars, M. Rosendahl, C. Tucker, S. P. Eisenberg, S. M. Wahl. 1997. Inhibition of human immunodeficiency virus type 1 infectivity by secretory leukocyte protease inhibitor occurs prior to viral reverse transcription. Blood 90: 1141-1149. [Abstract/Free Full Text]
  30. Jin, F., C. F. Nathan, D. Radzioch, A. Ding. 1998. Lipopolysaccharide-related stimuli induce expression of the secretory leukocyte protease inhibitor, a macrophage-derived lipopolysaccharide inhibitor. Infect. Immun. 66: 2447-2452. [Abstract/Free Full Text]
  31. Odaka, C., T. Mizuochi, J. Yang, A. Ding. 2003. Murine macrophages produce secretory leukocyte protease inhibitor during clearance of apoptotic cells: implications for resolution of the inflammatory response. J. Immunol. 171: 1507-1514. [Abstract/Free Full Text]
  32. Greene, C. M., N. G. McElvaney, S. J. O’Neill, C. C. Taggart. 2004. Secretory leucoprotease inhibitor impairs Toll-like receptor 2- and 4-mediated responses in monocytic cells. Infect. Immun. 72: 3684-3687. [Abstract/Free Full Text]
  33. Nakamura, A., Y. Mori, K. Hagiwara, T. Suzuki, T. Sakakibara, T. Kikuchi, T. Igarashi, M. Ebina, T. Abe, J. Miyazaki, et al 2003. Increased susceptibility to LPS-induced endotoxin shock in secretory leukoprotease inhibitor (SLPI)-deficient mice. J. Exp. Med. 197: 669-674. [Abstract/Free Full Text]
  34. Taggart, C. C., S. A. Cryan, S. Weldon, A. Gibbons, C. M. Greene, E. Kelly, T. B. Low, J. S. O’Neill, N. G. McElvaney. 2005. Secretory leucoprotease inhibitor binds to NF-{kappa}B binding sites in monocytes and inhibits p65 binding. J. Exp. Med. 202: 1659-1668. [Abstract/Free Full Text]
  35. Vogelmeier, C., R. C. Hubbard, G. A. Fells, H. P. Schnebli, R. C. Thompson, H. Fritz, R. G. Crystal. 1991. Anti-neutrophil elastase defense of the normal human respiratory epithelial surface provided by the secretory leukoprotease inhibitor. J. Clin. Invest. 87: 482-488. [Medline]
  36. Henriksen, P. A., M. Hitt, Z. Xing, J. Wang, C. Haslett, R. A. Riemersma, D. J. Webb, Y. V. Kotelevtsev, J. M. Sallenave. 2004. Adenoviral gene delivery of elafin and secretory leukocyte protease inhibitor attenuates NF-{kappa}B-dependent inflammatory responses of human endothelial cells and macrophages to atherogenic stimuli. J. Immunol. 172: 4535-4544. [Abstract/Free Full Text]
  37. Lentsch, A. B., J. A. Jordan, B. J. Czermak, K. M. Diehl, E. M. Younkin, V. Sarma, P. A. Ward. 1999. Inhibition of NF-{kappa}B activation and augmentation of I{kappa}Bβ by secretory leukocyte protease inhibitor during lung inflammation. Am. J. Pathol. 154: 239-247. [Abstract/Free Full Text]
  38. Macpherson, A. J., M. B. Geuking, K. D. McCoy. 2005. Immune responses that adapt the intestinal mucosa to commensal intestinal bacteria. Immunology 115: 153-162. [Medline]
  39. Zhu, J., C. Nathan, A. Ding. 1999. Suppression of macrophage responses to bacterial lipopolysaccharide by a non-secretory form of secretory leukocyte protease inhibitor. Biochim. Biophys. Acta 1451: 219-223. [Medline]
  40. Ding, A., N. Thieblemont, J. Zhu, F. Jin, J. Zhang, S. Wright. 1999. Secretory leukocyte protease inhibitor interferes with uptake of lipopolysaccharide by macrophages. Infect. Immun. 67: 4485-4489. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samsom, J. N.
Right arrow Articles by Kraal, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samsom, J. N.
Right arrow Articles by Kraal, G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS