|
|
||||||||
B Activation by IL-17A in Enhancing Cytokine Expression in Human Airway Epithelial Cells1Center for Comparative Respiratory Biology and Medicine, University of California, Davis, CA 95616
| Abstract |
|---|
|
|
|---|
B activation. For PI3K signaling, increases of cellular PIP3 and phosphorylation of downstream molecules, such as Akt and glycogen synthase kinase-3β (GSK3β) (S9), were detected. Induced gene expression and HBD-2 promoter activity were attenuated by LY294002, p110
small-interfering RNA (siRNA), as well as by an overexpression of constitutively active GSK3β(S9A) or wild-type phosphatase and tensin homolog. Increased phosphorylation of JAK1/2 after IL-17A treatment was detected in primary normal human bronchial epithelium cells. Transfected siRNAs of JAK molecules and JAK inhibitor I decreased IL-17A-induced gene expression and GSK3β(S9) phosphorylation. However, both JAK inhibitor I and PI3K inhibitor had no effect on the DNA-binding activities of p65 and p50 to NF-
B consensus sequences. This result suggested a JAK-associated PI3K signaling axis is independent from NF-
B activation. With siRNA to knockdown STIR (similar expression to fibroblast growth factor and IL-17R; Toll-IL-1R)-related signaling molecules, such as Act1, TNFR-associated factor 6 (TRAF6), and TGF-β-activated kinase 1 (TAK1), and transfection of A52R, an inhibitor of the MyD88/TRAF6 complex, or dominant-negative TAK1, IL-17A-inducible gene expression and HBD-2 promoter activity were reduced. Additionally, IL-17A-induced p65 and p50 NF-
B activations were confirmed and their nuclear translocations were down-regulated by siRNAs of TRAF6 and TAK1. These results suggest that two independent and indispensable signaling pathways—1) JAK1-associated PI3K signaling and 2) Act1/TRAF6/TAK1-mediated NF-
B activation—are stimulated by IL-17A to regulate gene induction in human airway epithelial cells. | Introduction |
|---|
|
|
|---|
IL-17A has been detected in various cell types such as neutrophils and macrophages, but the major source of IL-17A is CD4+ T cells (3, 4). A subtype of CD4+ T cells termed Th-17 or Th-IL-17 has recently been identified to have a distinct function of producing IL-17A (5, 6, 7, 8). Some research groups have reported that IL-23, but not IL-12, facilitates IL-17A production during a secondary immune response (9, 10). Both IL-23 and IL-17A were shown to contribute to the pathogenesis of several autoimmune diseases, such as inflammatory bowel disease and rheumatoid arthritis in humans and experimental autoimmune encephalomyelitis in mice (11, 12, 13, 14, 15, 16). Although IL-17A is produced by T cells, it coordinates local tissue inflammation through modulating cytokine and chemokine production by epithelial, endothelial, and fibroblast cells (17, 18). To our interest, IL-17A is a key factor for host defense against microbial infection in the pulmonary system. The importance of IL-17A has been demonstrated in the study using IL-17 receptor A (IL-17AR) knockout mice, which fail to develop a complete neutrophil response and bacterial clearance after Klebsiella pneumoniae infection in the airways (2). Moreover, the presence of IL-17A in the airway lumen is a hallmark of several inflammatory lung disorders, such as chronic obstructive pulmonary disease and asthma (19, 20, 21).
Despite the obvious presence of IL-17A in inflamed airways, little information is known regarding its biological function and related cell signaling in the lung. Studies from our laboratory have recently shown that IL-17A is one of the most potent cytokines among a panel of 21 cytokines (IL-1
, 1β, 2–13, 15, 16, 18, IFN-
, GM-CSF, and TNF-
) to stimulate the expression of mucins, human β-defensin 2 (HBD-2),3 and CCL-20 (MIP-3
) in primary human airway epithelial cells (22, 23, 24). Additionally, Linden and colleagues (25, 26) have shown that IL-17A induced CXCL-6 (granulocyte chemotactic protein (GCP)-2), CXCL-1 (growth-related oncogene (GRO)-
), and IL-8 (CXCL-8) production by human bronchial epithelial cells. However, the common signaling pathway involved in IL-17A-induced gene expression is still unclear. Recent studies have identified a SEFIR (similar expression to fibroblast growth factor and IL-17R Toll-IL-1R domain in IL-17AR (8, 27). The fact that the SEFIR domain belongs to the STIR superfamily (SEFIR and (TIR)) (28, 29) suggests a connection between TIR-signaling molecules such as TNFR-associated factor 6 (TRAF6) and TGF-β-activated kinase 1 (TAK1) and IL-17AR signal pathways. Recently, several studies have shown the potential involvement of Act1, another SEFIR-domain containing protein, and TRAF6, a TIR-associated protein, in IL-17AR-mediated signaling transduction in various cell lines and embryonic fibroblasts in vitro (28, 29, 30).
In this study, we sought to characterize the proinflammatory nature of IL-17A on the targeted airway epithelial cells and to examine the signaling pathways that are involved in IL-17A-induced gene expression. Through DNA microarray and real-time RT-PCR studies, we have identified several inducible cytokine genes, including IL-19, CXCL-2 (GRO-β), CXCL-3 (GRO-
), and CXCL-5, in addition to previously described HBD-2, CCL-20, CXCL-1, CXCL-6, and IL-8 (22, 23, 24, 25, 26) in well-differentiated primary normal human bronchial epithelial (NHBE) cells. Signal transduction analyses demonstrated the involvement of both the activation of the PI3K-signaling pathway and the nuclear translocation of NF-
B in IL-17A-induced gene expression. In this study, we demonstrated two independent signaling pathways for IL-17A-induced gene expression: one is related to the JAK-associated PI3K signaling pathway, and the other involves Act1/TRAF6/TAK1/NF-
B activation. Both of them are required for IL-17A-induced gene expression and HBD-2 promoter activity.
| Materials and Methods |
|---|
|
|
|---|
Human bronchial tissues were obtained with informed consent from the University of California–Davis (Medical Center, Sacramento, CA) and the National Disease Research Interchange (Philadelphia, PA). The University Human Subjects Review Committee approved and periodically reviewed the procedures in the tissue procurement. Tissue was not collected from patients diagnosed with lung-related diseases (30). Protease-dissociated bronchial epithelial cells were plated on transwell chambers (Corning; 25 mm) at 1–3 x 104 cells/cm2 in a Hams F12/DMEM (1:1) with the addition of the following eight factors: transferrin (5 µg/ml), insulin (5 µg/ml), cholera toxin (10 ng/ml), epidermal growth factor (10 ng/ml), dexamethasone (0.1 µM), bovine hypothalamus extract (15 µg/ml), BSA (0.5 mg/ml), and all-trans-retinoic acid (30 nM). After a week in an immersed culture condition, these primary NHBE were transferred to an air-liquid interface culture condition, which facilitates mucociliary differentiation. Primary cell cultures reaching full differentiation at day 14–21 after plating were used in this study. At full confluence, the cells in the chamber achieved an elevated transepithelial resistance as measured by voltmeter (Millicell-ERS; Millipore), as previously described (14). Immortalized NHBE cell line, HBE-1, was used for most of the transfection experiments. The culture condition for HBE-1 was described in previous studies (31).
DNA plasmid constructs and small-interfering RNA (siRNA)
The construction of the HBD-2 promoter (2 kb) in the pGL-3 basic vector was described in the previous study (23). The wild-type phosphatase and tensin homolog (wt-PTEN), which was well-studied as a negative regulator of the PI3K pathway, and its phosphatase mutant PTEN (mut-PTEN) were provided by Dr. G. B. Mills (M. D. Anderson Cancer Center, Houston, TX). phRL-TK (Promega) was used as the internal control for normalizing transfection efficiency. The clone of A52R, a vaccinia virus protein with inhibitory effects on the MyD88-TRAF6 complex, was ffered by Dr. L. A. ONeill (Trinity College, Dublin, Ireland). The dominant-negative TAK1 (dnTAK1) clone was provided by Dr. X. Li (Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH). The constitutively active (ca)-GSK3β(S9) clone was provided by Dr. M. C. Hung (M. D. Anderson Cancer Center, Houston, TX). siRNAs of JAK1, 2, 3, TAK1, p110
, TRAF6, Act1, and random oligomer (RO) were purchased from Ambion Biotech.
Transient transfection of HBE-1 cells
Transfection of HBE-1 cells with HBD-2 promoter-luciferase construct, phRL-TK, and other expression constructs or siRNA was conducted by FuGENE 6-based (Roche Diagnostics) or Lipofectamine 2000-based gene transfer methods (Invitrogen Life Technologies) according to the manufacturers specifications. Briefly, cells were plated onto 12-well plates at 40–60% (FuGene 6) or 95% (Lipofectamine 2000) confluency. One day after the plating, cultured cells were washed twice by Opti-MEM (Invitrogen Life Technologies) before transfection. The cells were incubated at 37°C with the mixture of DNA constructs/siRNA and FuGene 6/Lipofectamine 2000 in Opti-MEM for 16 h. One day before IL-17A addition, transfected cultures were incubated in hormone-depleted and serum-free medium. One more day after IL-17A treatment, cells were harvested by luciferase lysis buffer (25 mM Tris-phosphate (pH 7.8); 8 mM MgCl2; 1 mM DTT; 1% Triton X-100; 15% glycerol). A dual luciferase reporter assay kit (Promega) was used for analyzing the firefly luciferase activity of the HBD-2 promoter and Renilla luciferase activity of the internal control. The firefly luciferase activity of HBD-2 promoter-pGL3-basic construct-transfected cells was calculated by subtracting away the luciferase activity of the promoterless pGL3-basic plasmid transfected cells, and then normalized to the control (Renilla luciferase) activity.
For siRNA transfection, cells were plated at 40–60% density a day before transfection. An Oligofectamine-based transfection kit (Invitrogen Life Technologies) was used according to the manufacturers instruction. Six hours after transfection, the siRNA transfection mix was replaced with fresh culture medium. Two days later, cultures were depleted of hormonal supplements 24 h before IL-17A treatment. At various times after the treatment, cells were harvested for protein and gene expression analyses.
Cytokine inhibitor treatment
Recombinant human IL-17 (or IL-17A) was purchased from R&D Systems, and was dissolved in PBS with 0.1% BSA and used at 20 ng/ml, unless specified in the text. LY294002, a PI3K-specific inhibitor, and helenalin (Calbiochem), an NF-
B inhibitor, were dissolved in DMSO before use. These inhibitors and their corresponding vehicles (<0.1%) were added to the cultures 3 h before IL-17A treatment. We observed no cell cytotoxicity of these inhibitors at the doses used in this study. This was based on the nuclear dye exclusion assay (data not included).
RNA isolation and real-time RT-PCR
Total RNA was extracted with RNA TRIzol reagent (Invitrogen Life Technologies) and cDNA was generated from an equal amount of RNA by Moloneys murine leukemia virus-reverse transcriptase (Promega) using oligo(dT) as the primer. SYBR Green Master Mix (Applied Biosystems) and the ABI7900HT Detection System (Applied Biosystems) were used following the manufacturers protocol for real-time PCR analysis. The relative mRNA amount of each sample was calculated based on its threshold cycle, Ct, in comparison to the Ct of housekeeping genes, such as GAPDH and β-actin, as described before (23, 24). The results were presented as 2(Ct of gene of interest – Ct of GAPDH or β-actin) in arbitrary units. The purity of amplified product was determined as a single peak of dissociation curve. Throughout the study, there was no observable fluctuation in the Ct values of GAPDH and β-actin from different treated cells (data not included). For data presentation, the relative mRNA level of each gene of interest was normalized with GAPDH in this study.
The primer sequences of GAPDH and HBD-2 for real-time PCR were described in our previous study (23). For CXCL-1, -2, -3, -5, -6, HBD-2, IL-19, TAK1, TRAF6, p110
, JAK1, 2, 3, and Act1, the primer sequences are listed below. The specificity of the primers for each gene was determined by dissociation curve for each gene-specific PCR product. CXCL-1 forward, AGATTCTATGTTAATATTTTAGGTGTAAAATAAT; CXCL-1 reverse, AACTAACTTGGGGTTGACATTTC; CXCL-2 forward, CTTCTATTTATTTATTTATTTATTTATTTGTTTGTTTT; CXCL-2 reverse, GAACTAACTTGGGTTTGACCTAAA; CXCL-3 forward, TGAAAAAGAGAACAGCAGCTTTCT; CXCL-3 reverse, AGGAACTGAGCTATGTTTGATGA AACA; CXCL-5 forward, TGGCCCCTTTCACAGAGTAG; CXCL-5 reverse, CTAAAAACCCGACAGGCATC; CXCL-6 forward, AGTTTACAGCTCAGCTAATGAAGTACTAAT; CXCL-6 reverse, CGGTAAGACTTTAAGGAATGTATGATA; IL-19 forward, CAGGAACAGAGGCAGTGTCA; IL-19 reverse, CAGGGATTTAATGGCAGCA; TAK1 forward TGCCCAAACTCCAAAGAATC; TAK1 reverse, TGGTCCTTTTCATCCTGGTC; TRAF6 forward, CCAATTCCATGCACATTCAG; TRAF6 reverse GGGCCAACATTCTCATGTGT; PIK3CA forward, ACGTGTGCCATTTGTTTTGA; PIK3CA reverse, GATTGGCATGCTGTCGAATA; JAK1 forward AGACTTGTGAATACGTTAAAAGAAGGA; JAK1 reverse, AAAGCTTGTCCGATTGGATG; JAK2 forward, GATGGATGCCCAGATGAGAT; JAK2 reverse TTGATCCACTCGAAGAGCTAGA; Act1 forward, AACAAGGAAGCATGAATTTCAGA; Act1 reverse, ATTCTTGGGCCAGCTGTAGA.
Microarray analysis
The TRIzol-extracted total RNA was submitted to our Institutes core microarray facility. cRNA samples were prepared and hybridized to the array (Affymetrix Hg-U133A); its signals were then scanned using the protocols suggested by the manufacturer. Detailed data analysis is described in our previous publication (32).
Immunoblotting
Total protein lysates from different treatments were harvested by modified RIPA buffer (50 mM Tris-HCl (pH 7.4); 1% Nonidet P-40; 0.25% sodium deoxycholate; 150 mM NaCl; 1 mM EDTA; 1 mM PMSF; and 1 mg/ml each of aprotinin, leupeptin, pepstatin; 1 mM Na3VO4; and 1 mM NaF), followed by sonification. Cell pellets were removed after centrifugation. Nuclear protein was obtained by a nuclear extraction kit. The concentration of the total protein or nuclear protein from each sample was measured by a protein assay kit (Bio-Rad). Equal amount of total protein from each sample was subjected to SDS-PAGE (3% bis-acrylamide upper gel and 12.5% lower bis-acrylamide gel) and then transferred to polyvinylidene difluoride membrane (Millipore) for Western blotting according to the standard protocol. For Western blot analysis, the following Abs were used: anti-phospho-Ser429 Akt rabbit mAb, anti-phospho-Thr308 Akt rabbit polyclonal Ab, anti-phospho-Ser9 GSK3β, anti-p110
PI3K, anti-phospho-JAK1 (Tyr1022/1023), anti-phospho-JAK2 (Tyr1007,1008) polyclonal Abs (Cell Signaling Technology); anti-I
B-
mAb (BD Biosciences); anti-p65 mAb, anti-JAK1, anti-JAK2, and anti-TRAF6 rabbit polyclonal Ab (Santa Cruz Biotechnology); anti-p50 mAb (Biolegend); anti-TAK1 rabbit polyclonal Ab (Upstate Biotechnology); and anti-nucleolin mAb and anti-β-tubulin mAb (Sigma Aldrich).
ELISA-based transcription factor and DNA-binding assay
Bindings of p65 and p50 NF-
B subunits to their consensus DNA sequences were determined quantitatively by the ELISA-based Mercury Transfactor kit (BD Biosciences) following the manufacturers protocol. Briefly, equal amounts of nuclear extract from each cell sample were loaded on a 96-well plate, which was coated with DNA of the consensus sequences for p65 and p50. After a 1-h incubation, the unbound protein was washed away, and the primary Ab to the target transcription factor was applied. The amount of the Ab bound to transcription factor was detected by HRP-conjugated secondary Ab and its substrate (Pierce Biotechnology). Color absorbance was measured by a standard microtiter plate reader at 655 nm wavelength.
PI(3,4,5)P3 quantitation
A PIP3 Mass ELISA kit was purchased from Echelon Biosciences. HBE-1 of 10, 30 min after IL-17A and insulin (as a positive control) treatments were harvested and precipitated by trichloroacetic acid. PIP3 lipid was extracted twice from the trichloroacetic acid precipitated fraction by methanol:chloroform (2:1), according to the manufacturers specification. After acidification, organic-phase lipids were used for PIP3 quantitation, based on the protocol came with the ELISA kit. Briefly, the lipid extract from cultured cells were first mixed with the PIP3-specific detector protein, which was then incubated in a PIP3-coated mircroplate for competitive binding. After several washes, the microplate was then incubated with a HRP-linked secondary detector and tetramethylbenzidine substrate for color development. To stop further color development, 2 M H2SO4 solution was then added. Microplates were read at 450 nm wavelength for absorbance. A series of different dilutions of PIP3 standards were used for establishing a standard curve for each reaction. Cellular PIP3 amounts could be estimated by comparing the absorbance in the wells with the values in the standard curve. Experiments were conducted in triplicate dishes and repeated in two independent cultures with cell density >5 million cells per 100-mm dish.
Statistical analyses
Data from at least triplicate dishes and transwell chambers were used to determine mean ± SE of mRNA expression of cytokines and chemokines. The results were repeated for at least three representative cultures derived from different donors or passages. Group differences were calculated by Students t test as described in figures. Value of p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
The proinflammatory nature of IL-17A has been well-recognized, but the extent of this effect on airway epithelial cells has not been demonstrated. DNA microarray analysis that compares the expression values between the control and IL-17A-treated NHBE cells showed >2-fold induction of several chemokine/cytokine genes (Fig. 1). In addition to the previously known induction of HBD-2, CCL-20, IL-8, CXCL-1, CXCL-6, CSF-3, and CSF-2 (22, 23, 24, 33, 34), we have found that IL-19, CXCL-2, -3, and -5 were highly stimulated by IL-17A in primary NHBE cells. Real-time RT-PCR demonstrated a 78-, 160-, and 3- to 12-fold stimulation of HBD-2, IL-19, and various CXC chemokine messages by IL-17A, respectively (Table I). For IL-19, CXCL-2, 3, and -5, this is the first demonstration of their stimulated expression by IL-17A in human airway epithelial cells.
|
|
B activationTo reveal whether IL-17A-induced genes were regulated through a common mechanism, we first examined whether the induction depends on the interactions between IL-17AR and its ligand, IL-17A. As shown in Fig. 2A, the induction of all genes depended on the basolateral treatment of IL-17A. No stimulation was seen when IL-17A was added to the polarized cultures from the apical surface only. These results suggest a preferential presence of IL-17AR at the basolateral side of the polarized airway epithelia in vitro. This is consistent with our previous finding of anti-IL-17AR Ab staining that showed the basolateral presence of the receptor in well-differentiated NHBE cultures (24) and the in vivo lung tissue staining by the other group (33).
|
B-signaling pathways. However, to our current knowledge, CCL-20, another IL-17A inducible gene, is only sensitive to NF-
B inhibitor (24). Here, we sought to determine whether the induction of IL-19, CXCL-2, -3, and -5 are through a common mechanism as well. Through inhibitor screening, we found that JAK inhibitor I, LY294002, and helenalin, significantly attenuated IL-17A-induced cytokine expression (Fig. 2, B–D, respectively). The inhibitory effects of JAK inhibitor I and helenalin on HBD-2 induction have been reported before by our group (23). As shown in Fig. 2B, JAK inhibitor I blocked IL-17A-dependent IL-19; CXCL-1, -2, -3, -6 induction. In addition, both LY294002 (Fig. 2C) and helenalin (Fig. 2D) were strong blockers for most of the IL-17A-mediated gene induction in primary NHBE. Throughout the experiments, we observed no cytotoxicity caused by these inhibitors at doses used in this study. The Ct values of housekeeping genes, such as GAPDH and β-actin, were not changed by the treatment of the inhibitors (data not shown). These results demonstrated the potential involvement of JAK and PI3K signaling and NF-
B activation in IL-17A-dependent gene induction in airway epithelial cells. The requirement of the PI3K-signaling pathway by IL-17A-induced gene expression
To further elucidate the role of PI3K signaling, we first measured the increase of PIP3 lipid in HBE-1 after IL-17A treatment. Using a commercial PIP3 ELISA Mass kit, we found that IL-17A stimulated the PIP3 production within 10 min, and then declined after 30 min (Fig. 3A). This PIP3 elevation is about one-third of insulin (a known ligand)-stimulated PI3K activation. Western blot analysis showed increased phosphorylation of PI3K downstream signaling molecules, such as Akt and GSK3β, in IL-17A-treated NHBE and HBE-1 cells (Fig. 3, B and C, respectively). Phosphorylations at serine 473 (S473) and threonine 308 (T308) on Akt and serine 9 (S9) of GSK3β were detected within 15–30 min after IL-17A treatment, but transiently declined after 60–120 min. Interestingly, JAK inhibitor I suppressed the phosphorylation of GSK3β(S9) (Fig. 3C), suggesting a potential role of JAK in PI3K-signaling pathways.
|
siRNA transfection significantly decreased p110
protein (lower panel) as well as the IL-17A-induced HBD-2 and IL-19 mRNA. The same inhibitory effect was also observed in HBD-2 promoter activity (Fig. 4B).
|
JAK1 and 2 are required for IL-17A-induced gene expression
As described above, JAK inhibitor I effectively suppressed IL-17A-induced gene expression (Fig. 2) and down-regulated GSK3β(S9) phosphorylation (Fig. 3C). These data suggest the importance of the JAK family in the regulation of IL-17A signaling. We therefore examined whether JAK1 and JAK2 protein are phosphorylated upon IL-17A stimulation in primary NHBE cells. In Fig. 5A, primary NHBE cells were treated with IL-17A in a time course (left panel) with IL-13 as a positive control (right panel) for JAK phosphorylation. Western blot was used to analyze the phosphorylation of JAK1 at Tyr1022/1023 and JAK2 at Tyr1007/1008. Upon IL-17A stimulation, phosphorylations of both JAK1 and JAK2 were detected from 5 min to 2 h with the peak time of around 10–20 min after treatment. The induction of phospho-JAK1/2 by IL-17A and IL-13 can be abolished by JAK inhibitor I (right panel). The necessity of JAK1 and JAK2 for signaling was further confirmed by siRNA approach in HBE-1 cells. As shown in Fig. 5, B, C, and E, siRNAs of JAK1 and JAK2 decreased IL-17A-dependent HBD-2 (Fig. 5B) and IL-19 (Fig. 5C) induction, as well as their own protein expression (Fig. 5E). The specificity of siRNA was confirmed in Fig. 5E as siRNA of both JAK1 and JAK2 specifically knockdown its target protein but not the other while RO has no effect on neither of the protein. Moreover, the inhibition of induced-HBD-2 by JAK1/2 siRNA is specific to IL-17A stimulation while HBD-2 gene induction by other stimulants, such as IL-1β and TNF-
, is not affected by JAK siRNAs (data not shown). Because the expression of JAK3 in airway epithelial cells is low, and minimal effect of JAK3 siRNA on IL-17A-induced IL-19 expression (data not shown), we mainly focus our study on JAK1 and JAK2 in the regulation of IL-17A signaling. Fig. 5D show that JAK1 siRNA effectively hampered IL-17A-induced HBD-2 promoter activity while JAK2 siRNA did not have much impact (Fig. 5D). These results imply that the contributions of JAK1 and JAK2 are not equal.
|
It has been reported that IL-17AR has a SEFIR domain, which belongs to the STIR superfamily (27, 28, 29). Therefore, we sought to tested the roles of other STIR-related signal molecules, such as TRAF6, TAK1, and Act-1, in IL-17A-induced gene expression regulation in our system (28, 38, 39, 40, 41). We used an siRNA knockdown approach to determine which signaling molecules are involved in IL-17A-mediated gene expression in human airway epithelial cells. As shown in Fig. 6D, the siRNAs of Act1, TRAF6, and TAK1 effectively knockdown their own mRNA expressions as compared with the RO controls. Furthermore, the siRNAs of Act1, TRAF6, and TAK1 effectively attenuated IL-17A-induced HBD-2 and IL-19 mRNA, and the induced HBD-2 promoter activity (Fig. 6, A–C, respectively). These results implicate the involvement of Act1, TRAF6, and TAK1 in IL-17A-induced signaling and gene expression.
|
TRAF6/TAK1 is responsible for IL-17A-dependent NF-
B transcriptional activation
The inhibitory effect of helenalin on IL-17A-induced genes (Fig. 2D) (23, 24) indicated the importance of NF-
B-dependent transcriptional activities in these gene induction. However, it is less clear how NF-
B is activated by IL-17A in airway epithelial cells. In Western blot analyses, we observed decreases on I
B
level in both NHBE and HBE1 total lysates within 3–10 min after IL-17A treatment (Fig. 7, A and B, respectively). This reduction was followed by an increase of nuclear translocation of p65 and p50 NF-
B subunits (Fig. 7C). Moreover, p65 and p50 nuclear translocation coincided with increases of their DNA-binding activities in nuclear fractions, which were assayed by ELISA-based Mercury Transfactor kit (Fig. 7D). Interestingly, both JAK inhibitor I and PI3K inhibitor (LY294002) had no effect on p65/p50 element-binding activity (Fig. 7D). These results suggest that neither JAK nor PI3K pathways are involved in NF-
B activation by IL-17A.
|
B induced by IL-17A. HBE-1 cells transfected with TRAF6 or TAK1 siRNA showed significant decreases of their protein production compared with the negative controls which were transfected by RO (Fig. 7C). A down-regulation of p50 and p65 nuclear translocation was also observed in HBE-1 cells transfected with TRAF6 siRNA and, to a lesser extent, TAK1 siRNA as compared with the results of RO controls. These results indicate that IL-17A-induced NF-
B translocation is through a TRAF6/TAK1-dependent pathway. In contrast, siRNA of TRAF6 had no effect on IL-17A-mediated PI3K signaling, such as the phosphorylation on GSK3β(S9) (data not shown), suggesting that PI3K pathway is independent from TRA6 activation in IL-17A-treated cells. | Discussion |
|---|
|
|
|---|
B activation (Fig. 8).
|
We also confirmed that the polarity of IL-17AR expression in airway epithelium is crucial for downstream gene activation. Our data indicate that basolateral treatment of IL-17A is required for the gene induction. The immunostaining of IL-17AR also confirmed its distribution in the basal region of the polarized epithelia in both culture and tissue sections (data not shown). These are all consistent with the previous findings (24, 33). Given that IL-17AR-neutralizing Ab treated at the basal region blocked the IL-17A-induced gene expressions as well as the antimicrobial activity (24, 52), our data reaffirm the significance of IL-17AR polarization in IL-17A signaling (23, 24, 33).
Following the receptor engagement, we have observed a variety of signaling pathways activated by IL-17A, including: 1) JAK1-associated PI3K/GSK3β signaling and 2) Act1/TRAF6/TAK1-dependent NF-
B activation. The sensitivity of NHBE cells to JAK, PI3K, and NF-
B inhibitors is the first evidence indicating that these pathways are crucial to IL-17A signaling. The importance of these pathways were further confirmed by various biochemical studies showing an increase of cellular PIP3 level, increases of the phosphorylation of PI3K-signaling molecules Akt and GSK3β, and the elevation of p50 and p65 NF-
B DNA-binding activities in cells after IL-17A treatment. Additionally, using siRNA knockdowns and forced expression of modified genes of JAK-, PI3K-, and STIR-related signal molecules, we were able to see the attenuation of IL-17A-induced gene expression and HBD-2 promoter activity. These studies further support the involvement of these pathways in IL-17A-induced cell signaling and gene expression. It is worthwhile to emphasize that GSK3β, a downstream target of PI3K-Akt signaling (53, 54, 55), is found to be phosphorylated at serine 9, which inactivates its kinase activity (56). Our study with the ca-GSK3β(S9A) transfection (Fig. 4E) confirms the importance of the PI3K-GSK3β axis signaling. In fact, the inactivation of GSK3β is essential to IL-17A-mediated gene expression. We also found that the phosphorylation of GSK3β was influenced by the JAK pathway (Fig. 3C) rather than TRAF6 (data not shown). These results indicate the association between JAK and PI3K signaling, which leads to GSK3β inactivation and the subsequent gene activation (Fig. 8).
For IL-17A-mediated NF-
B activation, we have identified a rapid degradation (within 3–10 min) of I
B-
in cells after IL-17A treatment, followed by the p65 and p50 nuclear translocation, and significant increases in their DNA-binding activities to NF-
B consensus sequences. These activities were inhibited by the treatment of siRNAs of TRAF6 and TAK1, but not by JAK inhibitor I or PI3K inhibitor (LY294002), suggesting a role of TRAF6/TAK1-dependent NF-
B activation. In addition, siRNA and dominant-negative gene transfection of these STIR-signaling molecules have showed that Act1, TRAF6, and TAK1 are all required in mediating IL-17A-induced gene expression.
This is the first reporting of two signaling pathways mediated by IL-17A and their roles in coordinating the gene induction in airway epithelial cells. However, why these two independent signaling pathways are needed for IL-17A-induced gene expression is unclear. The importance of NF-
B activation is obvious because most of these IL-17A-induced genes have putative NF-
B consensus sequences in their promoter regions. The role of PI3K is less clear, because it has no effect on NF-
B activation. A recent publication has shown that C/EBP promotes the transcription of IL-17A-targeting genes (57). It has also been shown that GSK3β inhibition through PI3K signaling regulates the function and phosphorylation of certain transcriptional coactivators, such as C/EBP and β-catenin, or leads to the dysfunction of some transcriptional repressors (58, 59). Therefore, it is possible that the signaling axis of JAK1-associated PI3K/Akt/GSK3β is involved in the modulation of the transcriptional coactivators (such as C/EBP) or repressors. Further studies are needed to resolve these complicated pathways.
In summary, we demonstrated a profound effect of IL-17A on the expression of several cytokines in human bronchial epithelial cells. The importance of IL-17A has been reported in a number of airway diseases including those related to microbial infection and Th2-dominated diseases (25, 60). Our study shows that the majority of these inducible gene expressions are commonly regulated through two independent and indispensable pathways: JAK1-associated PI3K/GSK3β and Act1/TRAF6/TAK1/NF-
B activation.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported in part by grants from National Institutes of Health (HL077902, HL077315, and ES00628) and T32 HL07103 (to P.T.). ![]()
2 Address correspondence and reprint requests to Dr. Reen Wu, Center for Comparative Respiratory Biology and Medicine, University of California, Genome and Biomedical Science Facility, Suite 6510, 451 East Health Science Drive, Davis, CA 95616. E-mail address: rwu{at}ucdavis.edu ![]()
3 Abbreviations used in this paper: HBD-2, human β-defensin-2; GRO, growth-related oncogene; GCP, granulocyte chemotactic protein; TIR, Toll-IL-1R; SEFIR, similar expression of fibroblast growth factor and IL-17R; STIR, SEFIR and Toll-IL-1R; TRAF6, TNFR-associated factor 6; TAK1, TGF-β-activated kinase 1; NHBE, normal human bronchial epithelium; siRNA, small-interfering RNA; wt, wild type; PTEN, phosphatase and tensin homolog; mut, mutant; ca, constitutively active; Ct, threshold cycle; GSK3β, glycogen synthase kinase-3β; RO, random oligomer. ![]()
Received for publication September 13, 2006. Accepted for publication September 5, 2007.
| References |
|---|
|
|
|---|
B-inducing kinase is a common mediator of IL-17-, TNF-
-, and IL-1β-induced chemokine promoter activation in intestinal epithelial cells. J. Immunol. 162: 5337-5344.
B signaling pathways. J. Immunol. 173: 3482-3491.
B-dependent signaling pathway. J. Immunol. 175: 6676-6685.
- and interleukin-8 release in human bronchial epithelial cells. Eur. J. Pharmacol. 462: 193-198. [Medline]
and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J. Immunol. 175: 404-412.
, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am. J. Respir. Cell. Mol. Biol. 26: 748-753.
B as well as the MAP kinase cascade in the IL-1 signalling pathway. Nature 398: 252-256. [Medline]
B activator Act1 in CD40-mediated signaling in epithelial cells. Proc. Natl. Acad. Sci. USA 99: 9386-9391.
. J. Immunol. 162: 186-194.
chemokine from mesothelial cells. J. Immunol. 165: 5814-5821.
on macrophage inflammatory protein-3
production in rheumatoid arthritis: regulation by soluble receptors and Th2 cytokines. J. Immunol. 167: 6015-6020. This article has been cited by other articles:
![]() |
N. Jacob, H. Yang, L. Pricop, Y. Liu, X. Gao, S. G. Zheng, J. Wang, H.-X. Gao, C. Putterman, M. N. Koss, et al. Accelerated Pathological and Clinical Nephritis in Systemic Lupus Erythematosus-Prone New Zealand Mixed 2328 Mice Doubly Deficient in TNF Receptor 1 and TNF Receptor 2 via a Th17-Associated Pathway J. Immunol., February 15, 2009; 182(4): 2532 - 2541. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Swaidani, K. Bulek, Z. Kang, C. Liu, Y. Lu, W. Yin, M. Aronica, and X. Li The Critical Role of Epithelial-Derived Act1 in IL-17- and IL-25-Mediated Pulmonary Inflammation J. Immunol., February 1, 2009; 182(3): 1631 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakamura, Y. Komagiri, T. Kojo, and M. Kubokawa Delayed and acute effects of interferon-{gamma} on activity of an inwardly rectifying K+ channel in cultured human proximal tubule cells Am J Physiol Renal Physiol, January 1, 2009; 296(1): F46 - F53. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Kao, C. Kim, F. Huang, and R. Wu Requirements for Two Proximal NF-{kappa}B Binding Sites and I{kappa}B-{zeta} in IL-17A-induced Human {beta}-Defensin 2 Expression by Conducting Airway Epithelium J. Biol. Chem., May 30, 2008; 283(22): 15309 - 15318. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |