The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 6395 -6402
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spillmann, F. J. X.
Right arrow Articles by Wabl, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spillmann, F. J. X.
Right arrow Articles by Wabl, M.

Differentiation and Ig-Allele Switch in Cell Line WEHI-2311

Freia J. X. Spillmann, Gabriele Beck-Engeser and Matthias Wabl2

Department of Microbiology and Immunology, University of California, San Francisco, CA 94143-0414


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Because of its susceptibility to apoptosis upon Ag receptor cross-linking and lack of IgD expression, cells of the mouse cell line WEHI-231 have been classified as immature B cells. In this study we show that early freezings of the WEHI-231 line express IgD but not CD93, which classifies the cells as more similar to mature B cells. Another, later line obviously has differentiated in culture and has all the hallmarks of activated B cells. But despite activation-induced cytidine deaminase expression, there is no switch in isotype; instead we found switching from one µ allele to the other. As a consequence of these findings, we now view the apoptosis studies in the WEHI-231 line to reflect properties of mature and activated B lymphocytes, respectively.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The cross-linking of the BCR expressed by an immature B cell simulates self-recognition and leads to growth arrest and apoptosis of the cell, whereas cross-linking of a BCR expressed by a mature B cells can cause proliferation (reviewed in Ref. 1). However, after encountering Ag, a mature B cell may increase its BCR affinity to the Ag by somatic hypermutation. This process may give rise to an autoreactive BCR and, similar to immature B cells, germinal center B cells may undergo apoptosis upon BCR cross-linking as well (2). Because it undergoes apoptosis upon stimulation of its BCR (3, 4, 5), and expresses IgM but no IgD on the cell surface (6), the cell line WEHI-231 has been classified as immature B cell line and has been intensely studied as a model for immune tolerance via apoptosis. But surface IgD expression on WEHI-231 has been reported as well (4, 7, 8), which would classify WEHI-231 as mature (perhaps activated) B cell line. Indeed, in a recent study, we described activation-induced cytidine deaminase (AID)3 expression in a WEHI-231 line (9), and it is generally agreed that AID is expressed only in mature, activated B lymphocytes located in the germinal center of lymph nodes or spleen. Because expression of AID, IgD, and germline transcripts is at variance with WEHI-231 cell classification as an immature B cell line, we undertook a more detailed analysis of marker molecules specifically expressed in immature/transitional, mature, and activated/germinal center B cells. We also reflect on the possibility that WEHI-231 cells share certain characteristics with human mantle cell lymphoma (MCL).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
WEHI-231 lines

The WEHI-231 cell line was generated by mineral oil injection of a BALB/c crossed to a New Zealand Black (NZB) mouse (BALB/c x NZB)F1 mouse) (10). (Because we found Y chromosome sequences in the cell line, the donor mouse must have been male). The line was deposited into the American Type Culture Collection (ATCC) by L. L. Lanier (University of California, San Francisco, CA) and N. L. Warner in 1982. We obtained various cell lines of low passage number from ATCC, C. Paige (cell line designated CP; University of Toronto, Toronto, Ontario, Canada), and P. Kincade (cell line PK; University of Oklahoma Health Sciences Center, Oklahoma City, OK). Furthermore, we obtained another line of unknown passage from A. DeFranco (AF; University of California, San Francisco, CA), from which we derived the clone HM. Clone HM was derived from AF, which itself, however, is not a cloned line. AF thus represents a variety of cells that are derived from the ATCC, but have undergone genetic and phenotypic variations over the years. The subclone HMS I.13 is a direct descendant of an HM cell; it was derived by selecting IgM of b allotype expressing cells in the HM clone, which expresses IgM of a allotype.

PCR

The productive (VP) and nonproductive (VNP) VDJ rearrangements were amplified from RNA using the following 5' primers: VP, 5' V-active 5'-AGGAAACAAACTGGAGTGGATGGGC; VNP, 5' V-silent 5'-ATGGTGTACACTGGGTTCGCCAG. The 3' Cµ2 exon 5'TCCACGAG-CTTCCCATCCTTTAGC with 35 cycles of 94°C for 30 s, 58.5°C for 30 s, and 72°C for 1 min using SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen Life Technologies).

From genomic DNA, VP was amplified using primers 5' V-active and 3' JH2, 5'-ACTGTGAGAGTG-GTGCCTTGGC. VNP primers were 5' V-silent and 3' JH3, 5'-AGAGTCCCTTGGCCCCAGTAAG with 35 cycles of 94°C for 1 min, 66°C for 1 min, and 72°C for 1 min using TaqDNA polymerase (Invitrogen Life Technologies).

CD45 cDNA was amplified with Taq at 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min. CD45 primers are 5'-ATGGGTTTGTGGCTCAAACTTCTGG, reverse 5'-TGTGCAGTCATGTAGCGAAAACTTGTC. GAPDH was amplified with Taq at 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min. The 5' GAPDH primer is 5'-TGAAGGTCGGTGTGAACGGATTTGGC, and 3' GAPDH primer 5'-CATG TAGGCCATGAGGTCCACCAC.

The Cµ genomic locus was amplified as follows: Cµ2 5' CµE2 forward 5'-AGATCTGCATGTGCCCATTCCAGG; 3' CµE2 reverse 5'-CATGTTCGGGTGGCATTGGCCATA with 35 cycles of 95°C for 45 s, 58°C for 45 s, and 72°C for 1.5 min using native Pfu (Stratagene). Cµ3 was amplified using 5' CµE3 forward 5'-ATGCCTAGCCCTCCCAGATTAGG, 3' CµE3 reverse 5'-AAGAGGACCTGCCCTCCCTATG with 35 cycles of 95°C for 45 s, 58°C for 45 s, and 72°C for 1.5 min. Cµ4 was amplified with 5' CµE4 forward 5'-TCCAATTGCAGGACCCTTCCCG, 3' CµE4 reverse 5'-AGAACAGGCCCGTTTGTAAGTGTCC and 35 cycles of 95°C for 45 s, 61.5°C for 45 s, and 72°C for 1.5 min. Cµ membrane exons 5' Cµ-M forward 5'-AGACTTGGCTTGACCCTCCCTC, 3' Cµ-M reverse 5'-CTGTCAACACCGCAGGAAAGGTT with 35 cycles of 95°C for 45 s, 62.6°C for 45 s, and 72°C for 1.5 min using cloned Pfu. Cµ RT-PCR at 35 cycles of 94°C for 1 min, 58.8°C for 1 min, and 72°C for 1 min using Taq.

Sµ was amplified using 5' Sµ 5'-AGGACAGTGCTTAGATCCAAGGTGAGTG, and 3' Sµ 5'-ACAGCTCAGTCTAGCACATCTGAGTCC and 35 cycles of 98°C for 10 s, 65°C for 20 s, and 72°C for 1.5 min using iProof High-Fidelity DNA Polymerase (Bio-Rad).

AID knockout genotyping 5' G3 AID KO 5'-GGGCCAGCTCATTCCTCCACTC; 5' 811 AID wild type 5'-CTGAGATGGAACCCTAAC CTCAGCC; and 3' G4 (AID E4) CACGATTTTCTACAAATGTATT CCAGC.

Quantitative PCR

First strand cDNA was synthesized using oligo(dT) primers. The cycle conditions for real-time PCR were 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. Following primers and probes were used: 5' AID 5'-GAAAATTCTGTCCGGCTAACCA, 3' AID 5'-TCGCAAGTCATCGACTTCGT; AID probe 5'-6-FAM-TCGGCGCATCCTTTTGCCCTT-TAMRA; 5' β-actin 5'-AGGTCATCACTATTGGCA ACGA, 3' β-actin 5'-CACTTCATGATGGAATTGAATGTAGTT; β-actin probe 5'-6-FAM-TGCCACAGGATTCAATACCCAAGAAGG- TAMRA.

Western blot

The primary Abs used were anti-AID, rabbit affinity purified Ab against the C terminus of AID provided by F. W. Alt (Harvard Medical School, Boston, MA) (diluted 1/250); or mouse monoclonal anti-actin (Ab-1) Ab (Oncogene). Secondary Abs used were goat anti-rabbit Ig (H+L)-HRP, human absorbed (Southern Biotechnology Associates); or polyclonal rabbit anti-Bcl-6 Ab was from Cell Signaling Technology.

Flow cytometry

The following Abs from BD Pharmingen were used: PE anti-IgMa (Igh-6a) (DS-1); PE anti-IgMb (Igh-6b) (AF6-78); FITC anti-IgDa (Igh-5a) (AMS 9.1); PE anti-IgDb; FITC goat anti-mouse {kappa} PE anti-B220 (RA3-6B2); PE anti-CD5 (Ly-1) (53-7.3); FITC anti-CD21/CD35 (7G6); PE anti-CD23 Fc{epsilon}RII (B3B4); FITC anti-GL7; allophycocyanin anti-CD19 (ID3); PE anti-CD86 B7-2 (GL-1); PE hamster anti-Fas; PE anti-CD22.2 (Lyb-8.2) (Cy34.1); hamster anti-CD79b-RPE MCA1821PE (Serotec); FITC anti-mouse CD16/CD32 (Biolegend); and allophycocyanin anti-CD93 (clone AA4.1; eBioscience).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
History of WEHI-231 lines

The WEHI-231 cell line was generated by mineral oil injection of a (BALB/c x NZB)F1 mouse (10). Deposited into the ATCC, the line has been studied and kept in culture in many laboratories. Thus one can expect a variety of cell lines due to the accumulation of variants. To exclude possible subcell line effects, we obtained various cell lines of low passage number designated ATCC, CP, and PK. Furthermore, we obtained another line of unknown passage designated AF, from which we derived the clone HM and its subclone HMS I.13.

We confirmed that the AF, CP, PK, and HM lines are descendants from the same original B lymphocyte. We concluded this confirmation from the identical VDJ rearrangements, both productive and nonproductive, as previously described for AF and HM (9). In Fig. 1A, reverse-transcribed RNA was PCR-amplified with primers specific for the VH gene segments of the productive (VP) and nonproductive (VNP) alleles and exon Cµ2. This primer combination did not yield an amplification product for the nonproductive allele in AF (Fig. 1A, lane 7). This finding is due to a deletion 3' to the JH region (see below). However, we confirmed the presence of both VP and VNP in AF, by amplifying DNA using primers specific for the respective V and J gene segments (Fig. 1B, lanes 2 and 5). Fig. 1C displays part of the nucleotide sequences of the two alleles of lines AF, HM, CP, and PK; except for one point mutation in the D region of AF, and one in the VH of HM, which we previously described, the VDJ rearrangements are identical and unmutated in CP and PK, as compared with the consensus sequence.


Figure 1
View larger version (52K):
[in this window]
[in a new window]

 
FIGURE 1. The WEHI-231 lines are derived from the same original transformed B cell. A, RT-PCR of the region between VH and Cµ2 from AF, HM, PK, and CP cell lines. VP and VNP alleles are shown for the specific VH gene segments. Size of amplification product, ~300 bp. B, Amplification of the region between VH and JH on genomic DNA extracted from AF and HM. Size of amplification product: ~300 bp. C, Nucleotide sequences of part of the µ genes of WEHI-231 lines. Parts of the VDJ segments linked Cµ gene segments of active and silent alleles. The D regions of VP and VNP rearrangements (shaded box) are indicated. DNA and cDNA sequences were determined for both alleles; only the regions of interest are presented, leaving a gap even though the contiguous sequence was determined.

 
Switched alleles in the AF line

Interestingly, apart from the mutation in the D region, we found two other somatic mutations in the Cµ region of AF (one is shown in Fig. 1, at nt position no. 412). Furthermore, the AF line differs from the parental lines in that it has undergone two other somatic changes in its H alleles that makes this line more likely a progeny of, rather than a precursor to, the PK, CP, and ATCC lines. First, the cells have lost one Cµ allele (Fig. 1A, lane 7), whereas both Cµ alleles are retained in PK, CP, and ATCC (Fig. 1A, lanes 3–5 and lanes 8–10). We confirmed changes by sequencing the DNA of the Cµ locus spanning from before Cµ1 to after the membrane exon M2 (Fig. 2A). The BALB/c and NZB alleles differ in four single nucleotides, and none of the BALB/c allele were found in AF: 7 of 17 sequences from HM were of the b allele, and 10 of the a allele. All 13 sequences from AF were from the b allele. Fig. 2A shows the positions and identities of these four single nucleotides for the b allele (Fig. 2A, above line) and for the a allele (Fig. 2A, below line). The allelic difference furthest to the left translates into an amino acid residue change that is the epitope for the allele-specific mAbs to µ chain (Fig. 3). The remaining three allelic differences are located in introns. The NZB allele is not as well defined as the one of BALB/c (a allotype) or C57BL/6 (b allotype). However, when we sequenced the Cµ locus of the NZB mouse, it showed great homology to the C57BL/6 sequence.


Figure 2
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 2. IgH locus and switched alleles. A, Cµ locus with allelic differences between NZB (above line) and BALB/c (below line) mice. At the position of the second NZB single nucleotides (G), the corresponding BALB/c allele has a deletion (:) labeled. B, Scheme of genomic loci encoding the µ locus of AF and HM, CP and PK, as compared with NZB and BALB/c germline. The a allele ({square}), the b allele ({blacksquare}), VP (oval), and VNP (saddle shape) are indicated. AF has switched alleles, so that the VP is expressed with Cµ of the b allotype. All other WEHI-231 lines have VP linked to Cµ of the a allotype, and VNP linked to Cµ of the b allotype. HMS I.13 was derived by selecting IgM of b allotype-expressing cells in the IgM of a allotype HM clone. It thus recapitulates the allele-switching event that happened independently in the AF clone.

 

Figure 3
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 3. IgM and IgD expression in WEHI-231 lines. Flow cytometry profiles of the WEHI-231 lines stained with Abs to {kappa}, and to IgM and IgD of a and b allotypes. The BALB/c, spleen cells from a BALB/c mouse, C57BL/6, spleen cells from a C57BL/6 mouse, PK, CP, and ATCC, and WEHI-231 precursor lines AF and HM, WEHI-231 progeny lines are indicated. The various markers tested are also shown. Unlike all other WEHI-231 lines, AF expresses IgM of the b allotype. Clone HM (of a allotype) was derived from AF (of b allotype), which itself is, however, not a cloned line. AF thus represents a variety of cells that are derived from the ATCC (of a allotype), but have undergone genetic and phenotypic variations over the years. Apparently one cell variant in AF outgrew HM (and other cells); but HM cells are still present, albeit at a low frequency, in the AF line. The HM line was selected for low IgM expression. Compared with the AF line, it has a 15-fold reduction, in both µ and {kappa} expression, although only a 3- to 4-fold reduction over spleen cells. Fluorescence intensity is on a logarithmic scale, and cell counts are shown.

 
The other change in AF is the switch of µ alleles. We draw this conclusion from sequences of part of the cDNA that covers the VDJ exon linked to Cµ of these cell lines. To identify the regions linked to VP and VNP VDJ alleles, we performed RT-PCR with oligonucleotides priming specifically in the VP and VNP, and in the second exon of the Cµ H chain (Cµ2) (Fig. 1A), and sequenced cDNA amplified with 5' primers specific for exon borders VPJH2 and VNPJH3 in combination with an oligo(dT) primer. Again, no amplification product was detected for the silent allele in AF. However, when we amplified the V regions with primers for VP and JH2 (productive VDJ rearrangement) and primers for VNP and JH3 (nonproductive VDJ rearrangement) on genomic DNA from AF and HM, we found the nonproductive VDJ arrangement to be present in AF (Fig. 1B). Subcloning in bacteria and sequencing of the VP and VNP of AF, HM, PK, and CP lines, respectively, showed that in AF, VP is linked to Cµb; in contrast, we found that in HM, PK, and CP, VP is linked to a, and VNP to Cµb (Fig. 1C). A summary of the alleles encoding the H chain in the WEHI-231 lines is schematically presented in Fig. 2B. This switch in µ alleles ought to manifest itself at the protein level, and this is shown in Fig. 3. Clearly, of the lines, only AF expresses µ of b allotype, whereas HM, PK, CP, and ATCC express µ of a allotype.

It is not clear whether allele switching in AF was a one-time event, or whether allele switching is more frequent. Unfortunately, because it has lost its µa allele, the AF line itself cannot be used to answer this question. In contrast, if the allele switch is AID-mediated, we cannot use any of the CP, PK, or ATCC lines either, as these lines do not express AID. The HM clone, however, has retained both alleles and has induced AID expression; and although the HM clone is low in surface IgM expression, we could select µb cells by FACS, put them in culture, and subclone them (data not shown), one representative subclone being HMS I.13. We estimate that such cells are present in HM at a frequency of 10–5. Because we thought that the switch region for Cµ (Sµ) was involved in the process of allele switching, we amplified Sµ, and found that recombination at Sµ has taken place in both AF and HM (data not shown). Furthermore, on the silent allele of AF, there is a deletion from 3' to J4 and 5' to the intronic enhancer, which spans from sequences 5' to the Sµ to exon 3 of the constant region of {delta} (data not shown). In between, there are remnants of the Sµ region; this is consistent with the deletion being a switch region-mediated event.

IgD expression in WEHI-231

Some of the controversy of differentiation stage assignment of WEHI-231 stems from the fact of discordant reports of IgD expression, a marker of mature B cells. We, therefore, reevaluated IgM and IgD expression of the various lines by flow cytometry. Because the productive VDJ rearrangement could be on either the Iga or Igb locus of the (BALB/c x NZB)F1 cells, we used mAbs to IgM or IgD of either a or b allotype. We found that except for HM, which we selected for low IgM expression, all WEHI-231 lines express high levels of IgM (Fig. 3). In agreement with earlier reports (4, 7, 8) ATCC, CP, and PK express IgD (we also cloned {delta} H chain message from the CP line, data not shown); however, AF and HM did not express IgD (Fig. 3). The level of IgD expression in ATCC, CP, and PK is lower than in small mature B cells from the spleen, which is common in mouse cell lines that express IgD. Although the presence of surface IgD is inconsistent with the definition of a classical B cell immature stage, its absence on AF (and HM) is not. However, AF and HM are clearly descendants from an IgD-expressing line and, therefore, most likely represent an activated B cell rather than an immature B cell.

Transitional and mature B cell markers

Immature B cells that have recently emigrated to the spleen are described as transitional B cells, which are subdivided into T1 and T2 (and sometimes T3) stages (reviewed in Ref. 11). To further characterize the WEHI-231 line, we used various B cell markers (Fig. 4). By definition, T1 cells are CD21lowCD23lowCD24highIgMhighIgDlow, whereas T2 cells are CD21highCD23highCD24highIgMhighIgDhigh (12, 13). A distinctive marker is CD93 (AA4.1), which is expressed on all transitional B cells but not mature B cells; this marker is missing on all WEHI-231 lines (Fig. 4).


Figure 4
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 4. Flow cytometry profile of the WEHI-231 lines stained with Abs to various surface molecules. BALB/c, spleen cells from a BALB/c mouse, C57BL/6, spleen cells from a C57BL/6 mouse, PK, CP, and ATCC, and WEHI-231 precursor lines, AF and HM, WEHI-231 progeny lines are indicated. Various markers were tested as shown. It is curious that HM, and most of the cells in ATCC and AF, are CD79b (bottom row); both CD79a and CD79b are required for cell surface IgM expression. We have not further investigated whether this requirement is due to mutant protein not being recognized by the mAb, or to other causes. Fluorescence intensity is on a logarithmic scale, and cell counts (max. 300) is shown.

 
Mature B cells are subdivided in two groups: the marginal zone B cells, which are IgMhighIgDlowCD21highCD23low, and follicular B cell that express IgM, IgD, CD21, and CD23 at intermediate levels (11). However, none of the examined WEHI-231 fit these profiles. Thus, WEHI-231 lines do not express CD21 (CR2), except for HM, with a range of expression levels, and AF, which expresses as much as splenic B cells (Fig. 4). CD23 is also expressed on mature B cells; with CD23 the PK, CP, ATCC, and AF lines are CD23, with some heterogeneity in the CP and AF lines, and HM is clearly CD23+, as much as the splenic cells (Fig. 4). Another important marker for mature B cell is CD22; it is expressed at high levels on mature peripheral B lymphocytes (follicular and marginal zone), B-1 cells (CD5+ B cells), and plasma cells (14). This marker is highly expressed in all WEHI-231 lines (5) (Fig. 4). We also confirmed that WEHI-231 is CD5+ (7), a surface molecule expressed on B-1 cells and some B cell lymphomas.

All WEHI-231 lines are positive for IgM (Fig. 3), CD5, CD19, and CD22 (Fig. 4). The expression of CD79b, a component of the BCR required for signal transduction, in PK and CP cell lines, is weak but similar to the primary spleen cells, whereas ATCC and AF express only little, and HM is negative for CD79b (Fig. 4). As mentioned, HM was selected on the basis of low surface IgM expression, and it is interesting to note that along with it came the expression of CD23. Moreover, it expresses AID at high levels (see below). HM is also different from the other WEHI-231 lines in that it is positive for the germinal center marker GL7 (Fig. 4); however, it is negative for another germinal center marker, Bcl-6 (Fig. 5A). Clearly, HM and, to a lesser degree AF, evolved in cell culture into a different, more mature phenotype, losing IgD expression but gaining expression of AID.


Figure 5
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 5. Bcl-6 and AID expression in WEHI-231 lines. A, Western blot analysis with an Ab to Bcl-6. Ramos, Burkitt’s lymphoma cell line A20, a murine B cell lymphoma line derived from a spontaneous reticulum cell neoplasm, and NIH mouse fibroblast line NIH3T3 are indicated. B and C, Western blots with Ab to AID (top) or actin (bottom). The 18-81, mouse cell line expressing AID, 70Z mouse pre-B cell line 70Z/3, wild-type spleen cells, BALB/c wild-type spleen cells, knockout spleen cells, AID knockout spleen cells, and LPS spleen cells stimulated with LPS are indicated. D, TaqMan analysis of AID cDNA from WEHI-231 lines from three measurements each. Fold AID expression compared with 70Z/3. Primers are located in exons 4 and 5; the probe is spanning the junction between exons 4 and 5. AID expression was normalized to β-actin expression and to 70Z/3. LPS spl.1 and LPS spl.2 are two independent cultures with 3 x 105 cells/ml with LPS stimulation. AF and HM are WEHI-231 progeny lines. PK, CP, and ATCC are precursor lines. Spl.1 and spl.2 represent two independent spleen cell preparations, which were unstimulated.

 
AID expression and activity in later WEHI-231 lines

We have found previously that the WEHI-231 lines AF and HM express AID, but that in AF, the C to G activity is 32–37 times lower than in the hypermutating cell line 18-81. The C to T activity is also much reduced, but only 12-fold (15). Neither AF nor HM switches from IgM to another isotype (9). We investigated whether the precursor WEHI-231 lines CP, PK, and ATCC also expressed AID. From Fig. 5B is it evident that although AF and HM both express AID (Fig. 5B, lanes 2 and 3), lines ATCC, CP, and PK do not express AID (Fig. 5B, lanes 4–6). In fact, AF expresses as much protein as do LPS-activated spleen cells (Fig. 5C). The AID protein expression pattern is reflected by the quantitative measurements of mRNA encoding AID (Fig. 5D). Although PK, CP, and ATCC have no, or as little AID mRNA as nonstimulated spleen cells or 70Z/3 (a chemically transformed pre-B cell line), AF expresses four times more AID mRNA than LPS-activated spleen cells or the Abelson virus-transformed line 18-81 (Fig. 5D). The fact that in AF the steady-state level of message is so much higher than in activated spleen cells, but that there is not more protein (Fig. 5C, compare lane 1 to lane 3), points to translational and/or posttranslational regulation of AID expression. As reported previously, although WEHI-231 AF expresses AID perfectly normal, we only found some noncanonical mutations in the VH and Cµ, and much reduced activity on a retroviral hypermutation reporter plasmids (9) (15). Not surprisingly, the AID-negative WEHI-231 cells had no activity (data not shown).

CD45 splice variants

As reported before, none of the WEHI-231 lines express the marker B220 (Fig. 4), which is believed to be present on most B cells, although B-1 cells are B220low, and B220 B cells have also been described (16, 17). It is also possible that failure to express the particular splice variant of CD45 that is recognized by the B220 Ab, represents one of the oncogenic events driving the WEHI-231 tumor. CD45 is a prototypic receptor-like protein tyrosine phosphatase and is an essential regulator of signal transduction pathways in immune cells (18, 19). CD45 is expressed as at least eight isoforms due to alternative splicing of the exons 4, 5, and 6 (designated A, B, and C (20, 21, 22)) in the extracellular domain. The largest isoform, denoted RABC and recognized by the B220 Ab, includes all three exons, and the smallest isoform, denoted RO, lacks all three exons (recognized by the T200 Ab) (20, 21, 22). The expression of the various CD45 isoforms is dependent on cell type, developmental stage and activation stage of the cell (19, 23, 24). CD45 apparently functions as a rheostat that positively or negatively fine-tunes the signal transduction threshold at multiple checkpoints in B cell development (25, 26).

The mAb to B220 used in this study reacts with an epitope on the extracellular domain of CD45 glycoprotein, which is dependent upon the expression of exon A and specific carbohydrate residues (27). Because all WEHI-231 lines were B220, we assayed these lines for absence of, or deletions in exon 4 and adjacent sequence by amplification of exons 2–7 and sequencing the products (Fig. 6). While the cell line 18–81 expresses RABC and RBC, the WEHI-231 lines express neither of these splice variants. Instead, we found two other splice variants, RB and RO (Fig. 6), which are expressed in activated B cells and memory B cells (reviewed in Ref. 25).


Figure 6
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 6. CD45 mRNA expression in WEHI-231. A, Agarose gels with amplification products of PCR between exon 2 and exon 7. Amplification products were subcloned in bacteria and sequenced. B, Representation of the splice variants found in 18-81 (lines I and II) and in CP (III and IV).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we can distinguish two different kinds of WEHI-231 cell lines that originated from a single founder tumor cell in the donor mouse. A representation of the history of the various WEHI-231 cells and some of their hallmarks is given in Fig. 7. The one kind of cell line, represented by the early freezings ATCC, CP, and PK, expresses IgD and CD5, but no CD93 or AID, which makes the line look like a self-renewing B-1 cell. These lines strongly express surface IgM, but no CD23. However, there are some additional signals that were provided in culture to line AF and clone HM: these cells lost their IgD expression and express AID, although they do not switch their isotype; rather they can switch µ alleles. Interestingly, when selected for lower IgM surface expression, the cells turned CD23+. Based on the markers studied, and on the precursor-progeny relationship of the lines, we conclude that the phenotype of WEHI-231 is not one of an immature B cell line; rather it is of a mature, albeit nonconventional B cell.


Figure 7
View larger version (11K):
[in this window]
[in a new window]

 
FIGURE 7. Schematic representation and history of WEHI-231 variants. AID, no expression of AID; AID+, expression of AID; and allele switch, switch in expression from the µa to the µb allele. Clone HMS I.13 is a direct subclone of clone HM. Clone HM is derived from AF, which, however, is a line with a heterogenous population of cells, among which no direct clonal relationship can be established. This is why in the scheme, a hypothetical AID+ founder cell is depicted. AF represents a variety of cells that are derived from the ATCC, but have undergone genetic and phenotypic variations over the years. Because over time, there is always at least a slight growth advantage of one cell variant over the others, one clone may become predominant and overgrow all the other cells, including the original cell type. Because of the genealogical relationship and the genotype (Igb vs the original Iga allotype, and one vs the original two alleles), one cell variant in line AF must have outgrown HM (and other cells); but HM cells are still present, albeit at a low frequency, in the AF line. In contrast, because HM is a clone, the subclone HMS I.13 is a direct descendant of an HM cell.

 
As previously reviewed (4), the continuous passage of WEHI-231 cells in different laboratories has yielded variants that differ greatly in their response to anti-Ig treatment. In response to anti-Ig, all variants stop growing, but some cells go on to die by apoptosis. Cells resistant to apoptosis by anti-Ig treatment are also resistant to apoptosis induced by the immunosuppressants cyclosporin A, FK-506, and rapamycin. But they still have intact at least one apoptotic pathway, as indicated by their susceptibility to dexamethasone, irradiation, and other treatments.

We were also pondering the question whether WEHI-231 could reflect some of the characteristics of human MCL, a particularly difficult to treat type of non-Hodgkin lymphoma, for which there is a dearth of murine models. In trying to compare, it is understood that exact genotypic and phenotypic representation may be elusive. Nor is it obvious that any mouse tumor can completely recapitulate a human tumor. But by identifying the human phenotypes closest to it, we can hope to gain some insights for therapy from the wealth of information accumulated on the apoptotic behavior of WEHI-231.

MCL is a malignant non-Hodgkin’s lymphoma of B cell lineage; its normal cell counterpart is thought to be the IgM+, IgD+ (naive) B cell in the mantle zone of lymphoid follicles (28). As in chronic lymphocytic leukemia (CLL), MCL cells usually express CD5; and the pan B cell Ags CD19, CD20, CD22, FCM7, CD79b (B29 or Igβ), and CD24 (29, 30, 31, 32). However, unlike CLL, MCL does not express CD23 (35), and this marker, therefore, serves to distinguish between the two forms of lymphomas. Another useful distinction is usually strong expression of CD20 and Ig chain in MCL, but weak expression in CLL. In line with the MCL phenotype, all WEHI-231 lines are positive of IgM, CD5, CD19, and CD22. Also in line, the expression of CD79b in PK and CP is weak but similar to the primary spleen cells, whereas ATCC and AF express only little and HM is negative for CD79b. Except for HM, the WEHI-231 lines are CD23, although in CP and AF there may be present a minor CD23+ cell population. Also, Bcl-6 is mainly expressed in normal germinal center B cells and related follicle center and marginal zone lymphomas, but not in MCL (33) and WEHI-231.

As mentioned, HM was selected on the basis of low surface IgM expression, and it is interesting to note that along with it came the expression of CD23, which would make HM more similar to a CLL-type tumor (IgMlow, CD23. Moreover, the expression of AID at high levels, another marker that distinguishes CLL from MCL, indicates a crossover from MCL- to CLL-like phenotype, as can happen in patients. Of course, culture conditions do not necessarily reflect physiological growth conditions, and regardless of similarities we do not suggest that the WEHI-231 cell line is a faithful counterpart to the human MCL, which itself probably represents a collection of tumors with some shared dysregulated pathways. The WEHI-231 cell line may, however, represent a useful indicator with pathways to investigate in MCL.


    Acknowledgments
 
We thank Drs. J. Chaudhuri and F. Alt for Ab to AID; Drs. Paul Kincade and Christopher Paige for cell lines; Drs. G. Vyas, J. Bluestone, and A. Ma for welcoming us to use some of their lab facilities; C. McArthur for cell sorting; and Drs. A. Gross and A. DeFranco for comments on the manuscript. This work was performed as part of the requirement for the PhD degree at the Freie Universität (Berlin, Germany) (supervisor Dr. Volker Erdmann).


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grant CA100266 from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Matthias Wabl, Department of Microbiology and Immunology, S-1075 Box 0414, University of California, 513 Parnassus Avenue, San Francisco, CA 94143-0670. E-mail address: mutator{at}ucsf.edu Back

3 Abbreviations used in this paper: AID, activation-induced cytidine deaminase; MCL, mantle cell lymphoma; NZB, New Zealand Black; VP, productive VDJ; VNP, nonproductive VDJ; CLL, chronic lymphocytic leukemia. Back

Received for publication March 8, 2007. Accepted for publication August 15, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Nemazee, D.. 2006. Receptor editing in lymphocyte development and central tolerance. Nat. Rev. Immunol. 6: 728-740. [Medline]
  2. Galibert, L., N. Burdin, C. Barthelemy, G. Meffre, I. Durand, E. Garcia, P. Garrone, F. Rousset, J. Banchereau, Y. J. Liu. 1996. Negative selection of human germinal center B cells by prolonged BCR cross-linking. J. Exp. Med. 183: 2075-2085. [Abstract/Free Full Text]
  3. Boyd, A. W., J. W. Schrader. 1981. The regulation of growth and differentiation of a murine B cell lymphoma. II. The inhibition of WEHI 231 by anti-immunoglobulin antibodies. J. Immunol. 126: 2466-2469. [Abstract]
  4. Gottschalk, A. R., J. Quintáns. 1995. Apoptosis in B lymphocytes: the WEHI-231 perspective. Immunol. Cell Biol. 73: 8-16. [Medline]
  5. Nadler, M. J., P. A. McLean, B. G. Neel, H. H. Wortis. 1997. B cell antigen receptor-evoked calcium influx is enhanced in CD22-deficient B cell lines. J. Immunol. 159: 4233-4243. [Abstract]
  6. Tisch, R., C. M. Roifman, N. Hozumi. 1988. Functional differences between immunoglobulins M and D expressed on the surface of an immature B-cell line. Proc. Natl. Acad. Sci. USA 85: 6914-6918. [Abstract/Free Full Text]
  7. Haggerty, H. G., R. J. Wechsler, V. M. Lentz, J. G. Monroe. 1993. Endogenous expression of delta on the surface of WEHI-231: characterization of its expression and signaling properties. J. Immunol. 151: 4681-4693. [Abstract]
  8. Gottschalk, A. R., C. L. McShan, R. Merino, G. Nuñez, J. Quintáns. 1994. Physiological cell death in B lymphocytes: I. Differential susceptibility of WEHI-231 sublines to anti-Ig induced physiological cell death and lack of correlation with bcl-2 expression. Int. Immunol. 6: 121-130. [Abstract/Free Full Text]
  9. Spillmann, F. J., M. Wabl. 2004. Endogenous expression of activation-induced cytidine deaminase in cell line WEHI-231. J. Immunol. 173: 1858-1867. [Abstract/Free Full Text]
  10. Gutman, G. A., N. L. Warner, A. W. Harris. 1981. Immunoglobulin production by murine B-lymphoma cells. Clin. Immunol. Immunopathol. 18: 230-244. [Medline]
  11. Matthias, P., A. G. Rolink. 2005. Transcriptional networks in developing and mature B cells. Nat. Rev. Immunol. 5: 497-508. [Medline]
  12. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, M. C. Lamers, R. Carsetti. 1999. B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J. Exp. Med. 190: 75-89. [Abstract/Free Full Text]
  13. Su, T. T., D. J. Rawlings. 2002. Transitional B lymphocyte subsets operate as distinct checkpoints in murine splenic B cell development. J. Immunol. 168: 2101-2110. [Abstract/Free Full Text]
  14. Erickson, L. D., L. T. Tygrett, S. K. Bhatia, K. H. Grabstein, T. J. Waldschmidt. 1996. Differential expression of CD22 (Lyb8) on murine B cells. Int. Immunol. 8: 1121-1129. [Abstract/Free Full Text]
  15. Wang, C. L., M. Wabl. 2005. Mutational activity in cell line WEHI-231. Immunogenetics 56: 849-853. [Medline]
  16. Cascalho, M., J. Wong, J. Brown, H. M. Jack, C. Steinberg, M. Wabl. 2000. A B220, CD19 population of B cells in the peripheral blood of quasimonoclonal mice. Int. Immunol. 12: 29-35. [Abstract/Free Full Text]
  17. McHeyzer-Williams, L. J., M. Cool, M. G. McHeyzer-Williams. 2000. Antigen-specific B cell memory: expression and replenishment of a novel b220 memory b cell compartment. J. Exp. Med. 191: 1149-1166. [Abstract/Free Full Text]
  18. Thomas, M. L.. 1989. The leukocyte common antigen family. Annu. Rev. Immunol. 7: 339-369. [Medline]
  19. Trowbridge, I. S., M. L. Thomas. 1994. CD45: an emerging role as a protein tyrosine phosphatase required for lymphocyte activation and development. Annu. Rev. Immunol. 12: 85-116. [Medline]
  20. Ralph, S. J., M. L. Thomas, C. C. Morton, I. S. Trowbridge. 1987. Structural variants of human T200 glycoprotein (leukocyte-common antigen). EMBO J. 6: 1251-1257. [Medline]
  21. Barclay, A. N., D. I. Jackson, A. C. Willis, A. F. Williams. 1987. Lymphocyte specific heterogeneity in the rat leucocyte common antigen (T200) is due to differences in polypeptide sequences near the NH2-terminus. EMBO J. 6: 1259-1264. [Medline]
  22. Saga, Y., J. S. Tung, F. W. Shen, E. A. Boyse. 1987. Alternative use of 5' exons in the specification of Ly-5 isoforms distinguishing hematopoietic cell lineages. Proc. Natl. Acad. Sci. USA 84: 5364-5368. [Abstract/Free Full Text]
  23. Fukuhara, K., M. Okumura, H. Shiono, M. Inoue, Y. Kadota, S. Miyoshi, H. Matsuda. 2002. A study on CD45 isoform expression during T-cell development and selection events in the human thymus. Hum. Immunol. 63: 394-404. [Medline]
  24. Johnson, S. A., S. J. Rozzo, J. C. Cambier. 2002. Aging-dependent exclusion of antigen-inexperienced cells from the peripheral B cell repertoire. J. Immunol. 168: 5014-5023. [Abstract/Free Full Text]
  25. Hermiston, M. L., Z. Xu, A. Weiss. 2003. CD45: a critical regulator of signaling thresholds in immune cells. Annu. Rev. Immunol. 21: 107-137. [Medline]
  26. Hermiston, M. L., A. L. Tan, V. A. Gupta, R. Majeti, A. Weiss. 2005. The juxtamembrane wedge negatively regulates CD45 function in B cells. Immunity 23: 635-647. [Medline]
  27. Johnson, P., A. Maiti, D. H. W. Ng. 1997. CD45: a family of leukocyte-specific cell surface glycoproteins. L. A. Herzenberg, and D. M. Weir, and L. A. Herzenberg, and C. Blackwell, eds. In Weir’s Handbook of Experimental Immunology vol. 2.: 62.1-62.16. Blackwell Science, Cambridge, MA.
  28. Harris, N. L.. 1994. Mantle cell lymphoma. J. Clin. Oncol. 12: 876-877. [Medline]
  29. Weisenburger, D. D.. 1984. Mantle-zone lymphoma: an immunohistologic study. Cancer 53: 1073-1080. [Medline]
  30. Lardelli, P., M. A. Bookman, J. Sundeen, D. L. Longo, E. S. Jaffe. 1990. Lymphocytic lymphoma of intermediate differentiation: morphologic and immunophenotypic spectrum and clinical correlations. Am. J. Surg. Pathol. 14: 752-763. [Medline]
  31. Bookman, M. A., P. Lardelli, E. S. Jaffe, P. L. Duffey, D. L. Longo. 1990. Lymphocytic lymphoma of intermediate differentiation: morphologic, immunophenotypic, and prognostic factors. J. Natl. Cancer Inst. 82: 742-748. [Abstract/Free Full Text]
  32. Kay, N. E., T. J. Hamblin, D. F. Jelinek, G. W. Dewald, J. C. Byrd, S. Farag, M. Lucas, T. Lin. 2002. Chronic lymphocytic leukemia. Hematology Am. Soc. Hematol. Educ. Program 1: 193-213.
  33. Raible, M. D., E. D. Hsi, S. Alkan. 1999. Bcl-6 protein expression by follicle center lymphomas: a marker for differentiating follicle center lymphomas from other low-grade lymphoproliferative disorders. Am. J. Clin. Pathol. 112: 101-107. [Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spillmann, F. J. X.
Right arrow Articles by Wabl, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spillmann, F. J. X.
Right arrow Articles by Wabl, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS