The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179: 195-200.
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moran, S. T.
Right arrow Articles by Pillai, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moran, S. T.
Right arrow Articles by Pillai, S.

Synergism between NF-{kappa}B1/p50 and Notch2 during the Development of Marginal Zone B Lymphocytes1

Stewart T. Moran2, Annaiah Cariappa2, Haoyuan Liu, Beth Muir, Dennis Sgroi, Cristian Boboila and Shiv Pillai3

Cancer Center, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02129


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NF-{kappa}B1 and Notch2 are both required for the development of marginal zone (MZ) B cells. Analysis of B lymphocyte development in mice that are doubly heterozygous at the Notch2 and NF-{kappa}B1 loci revealed synergism between Notch2 and NF-{kappa}B1 during MZ B cell development. Two known transcriptional targets of the Notch pathway, Hes-5 and Deltex-1, were found to be preferentially expressed in MZ B cells and regulated by NF-{kappa}B1. These studies provide in vivo evidence for a genetic interaction between the Notch and NF-{kappa}B pathways.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The Notch and NF-{kappa}B protein families represent two major evolutionarily conserved pathways that affect cell fate and cell survival in all known metazoans, but genetic interactions between these pathways have not been hitherto described. Notch proteins are cell surface molecules that influence binary cell fate decisions in all multicellular organisms. The activation of a Notch receptor results in the proteolytic liberation of its intracellular domain, which is then translocated to the nucleus. The cleaved intracellular domain of Notch forms ternary complexes with recombination signal binding protein-J{kappa} (RBP-J{kappa}) and mastermind-like proteins, resulting in the conversion of RBP-J{kappa} from a transcriptional repressor to an activator of transcription that ultimately mediates the induction of a set of target genes (reviewed in Ref. 1).

The NF-{kappa}B pathway, like the Notch pathway, also influences cell fate decisions in metazoans. It is also relevant in terms of the induction of gene expression in a number of other biological contexts, including inflammation and cancer. There are five distinct NF-{kappa}B proteins in vertebrates and these exist as homodimers or heterodimers that are retained in the cytosol by I{kappa}B proteins before activation. Following the ubiquitination and proteasomal degradation of I{kappa}B, NF-{kappa}B dimers are released and enter the nucleus. I{kappa}B is marked for ubiquitination following its phosphorylation by the I{kappa}B kinase (IKK)4 complex, which is comprised of two catalytic subunits, IKK{alpha}/IKK-1 and IKKbeta/IKK-2, and a regulatory subunit, IKK{gamma}/NEMO (NF-{kappa}B essential modulator). Two of the five members of the NF-{kappa}B family, NF-{kappa}B1/p50 and NF-{kappa}B2/p52, possess DNA-binding Rel-homology domains, but lack a transactivation domain. The other three members, p65/RelA, RelB, and c-Rel, all possess DNA binding as well as transactivation domains (2). As a result, NF-{kappa}B activates the transcription of target genes as a heterodimer, generally with p65 or c-Rel, and less frequently with RelB. NF-{kappa}B p50 homodimers lack the ability to activate transcription and may recruit histone deacetylases resulting in transcriptional repression (3).

Both Notch and NF-{kappa}B are key players in lymphocyte development. Although Notch1 is a crucial mediator of the T vs B lymphoid cell fate decision (4, 5), Notch2 is required at the mature follicular (FO) vs marginal zone (MZ) B lymphoid cell fate transition. MZ B cells are lost but FO B cells are preserved in mice in which Notch2 or RBP-J{kappa} are conditionally deleted in the B lineage (6, 7). In addition, the deletion of the gene that encodes Delta-like-1, a ligand for Notch proteins, or the overexpression of a dominant-negative mutant of mastermind-like-1, also results in the absence of MZ B cells (8, 9), while the loss of MINT (Msx2 interacting nuclear target protein), a negative regulator of the Notch pathway, contributes to an increase in MZ B cells (10). Signaling via Notch2 is therefore required for the development of MZ B cells. The role of Notch2 during peripheral B cell development may not be restricted to the generation or maintenance of MZ B cells. Although conditional Notch2–/– mice exhibited no defect in peritoneal B-1 B cells (6), examination of Notch2+/– B cells in another study implicated Notch2 in peritoneal B-1 B cell development (11).

Mice that lack NF-{kappa}B1 have a marked reduction of MZ B cells (12). A less prominent reduction in MZ B cell numbers was noted in Rag-2–/– mice that were reconstituted with p65–/– hemopoietic stem cells, or in mice lacking c-Rel (12). These data suggest that while NF-{kappa}B1/p65 and NF-{kappa}B1/c-Rel both contribute to MZ B cell development, the requirement for NF-{kappa}B1 as a component of these heterodimers is stringent. Alternatively, it remains formally possible that NF-{kappa}B1 homodimers are required to repress crucial targets to permit MZ B cell differentiation. Regardless of whether NF-{kappa}B1 functions as a transcription activator or a repressor during MZ B cell development, it is also possible that it is required for MZ B cell generation because it functions as a negative regulator of the BCR/Bruton’s tyrosine kinase (Btk) pathway. The loss of negative regulators of BCR signaling, such as Aiolos and CD22, can contribute to a block in MZ B cell development (13, 14).

Many other genes contribute to the generation or maintenance of MZ B cells, some at the level of cell survival and others in maintaining MZ B cells in their niche (14). Signaling via the B cell-activating factor of the TNF family (BAFF) receptor (BAFF-R) may drive MZ development as suggested by the expansion of MZ B cells in BAFF-transgenic mice (15); BAFF may contribute to the activation of the canonical NF-{kappa}B pathway and thus contribute not just to MZ B cell development but possibly to maintenance as well (16). Other proteins that are believed to influence MZ B cell survival include CD19 (17) and PI3Kp110 (18, 19). The LFA-1 and {alpha}4beta1 integrins (20), the Pyk2 tyrosine kinase (21), the Rac2 Rho family GTPase (22), the Lsc/p115 Rho guanine nucleotide exchange factor Ig (23), and the DOCK-2 adaptor (24) may all be required to retain MZ B cells in the vicinity of the marginal sinus.

Some biochemical interactions between Notch and NF-{kappa}B have been described in studies in cell lines, but no in vivo or genetic links between these pathways have been established in any species studied. One such biochemical interaction is the association of Notch with NF-{kappa}B1 in overexpression studies in human cell lines and this interaction has been linked to the inhibition of NF-{kappa}B transcriptional activity by Notch (25). In other studies, I{kappa}B{alpha} and p65 have been shown to influence the regulation of Notch target gene expression (26, 27). c-Rel has also been shown to be capable of regulating the expression of Jagged 1, a Notch ligand, and to thus be capable of regulating Notch signaling (28).

In this study, we have used a genetic approach to demonstrate that NF-{kappa}B1 is not a negative regulator of Btk. NF-{kappa}B1 is required for the development of B-1 B cells as well as of MZ B cells. NF-{kappa}B1 and Notch2 function synergistically during MZ B cell development as revealed by the analysis of splenic B cell development in mice haploinsufficient for both these genes, but no evidence was found for a genetic interaction between Notch2 and NF-{kappa}B1 during B-1 B cell development. These studies further our understanding of an important cell fate decision in lymphocytes and provide the first in vivo evidence that the Notch and NF-{kappa}B pathways interact.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

p50-null mice were obtained from The Jackson Laboratory and have been described previously (12). Notch2+/– mice were provided by Dr. Y Hamada (National Institute for Basic Biology, Okazaki Japan). C57BL/6 mice and xid (CBA/N) mice were purchased from The Jackson Laboratory. Xid/p50-null double mutants were generated in a manner similar to that described for Aiolos–/–/xid mice (13). p50–/– mice were mated with N2+/– mice to generate double heterozygotes which were then intercrossed to obtain N2+/–/p50+/– or N2+/–/p50–/– mice. All mice were housed in a pathogen-free facility. Animal procedures were cleared by the Subcommittee on Research Animal Care at Massachusetts General Hospital.

Flow cytometric analysis and FACS

Single-cell suspensions from the spleen were obtained using standard methods. Peritoneal B cells were harvested by injecting 10 ml of PBS containing 0.2% BSA into the peritoneal cavity followed by aspiration with an 18-gauge needle. Flow cytometry and flow sorting were performed as previously described (29). The following murine mAb conjugates were used: r-PE (R-PE)-1B4B1 (anti-IgM, rat IgG), and biotinylated-11-26 (anti-IgD, rat IgG2a, {kappa}; both obtained from Southern Biotechnology Associates), and FITC-7G6 (anti-CD21/CD35, rat IgG2b, BD Pharmingen). Biotinylated Abs were revealed using streptavidin-allophycocyanin (BD Pharmingen). Flow cytometric analysis was performed on a dual-laser FC500 (Beckman Coulter) and sorting was performed on a MoFlo sorter (DakoCytomation). The purity of sorted samples always exceeded 96%. Gates in the spleen were set according to Hardy et al. (30) and Cariappa et al. (13, 31). Processed sample data were analyzed using FloJo version 8.2 software (Tree Star).

TaqMan RT-PCR analysis

Splenocytes from C57BL/6 and p50 mutant mice were stained as described above with anti-IgM, IgD, and CD21 Abs; IgMhighIgDlow/–CD21high MZ B cells, IgMlowIgDhighCD21int FO type I (FO-I), and IgMhighIgDhighCD21int FO type II (FO-II) were sorted. Total RNA was isolated from each sorted fraction by the Absolutely RNA Microprep kit (Stratagene) and converted into cDNA. TaqMan quantitative RT-PCR and primer design was performed as previously described (32). Primers used were: Deltex 1 forward TGTTCAGGCTATACACGCATCAA, reverse CCACCGCCCACTTTCAAG; TaqMan probe CTGAGCAGGCAGCAAAGCGTTAACTTC. Hes5 forward CTGATGCGCGCTCACAGT, reverse CATGCACCCACCCATACAAA; TaqMan probe TCTCCACGATGATCCTTAAAGGATT.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
The defect in MZ B cell development in NF-{kappa}B1-null mice is not linked to the activation of Btk

Aiolos-null mice present with an enhancement in BCR signal strength and a significant defect in MZ B cell development. In double mutant mice that lack Aiolos and also carry the xid mutation (an inactivating point substitution within the pleckstrin homology domain of Btk), the MZ B cell population is restored, presumably because Btk-dependent BCR signal strength is no longer enhanced (13). Like Aiolos-deficient mice, NF-{kappa}B1 mutant mice present with decreased numbers of MZ B cells (12). We used a similar genetic approach to the one used with Aiolos-null mice to determine whether the decreased numbers of MZ B cells in NF-{kappa}B1-null mice may be attributed to enhanced signaling via Btk. We crossed the NF-{kappa}B1-null mutation onto the xid (CBA/N) background and, in contrast to the "reappearance" of the IgMhighIgDlowCD21high MZ B cell fraction observed in xid/Aiolos–/– mice (13), xid/NF-{kappa}B1–/– mice present with a virtually complete absence of MZ B cells (Fig. 1). Although there appears to be an increase in the newly formed (NF/T) B cell population in the double mutant mice (right side panel of Fig. 1), this is an apparent increase that reflects the paucity of MZ B cells. We conclude that the loss of MZ B cells in NF-{kappa}B1 mutant mice cannot be attributed to increased Btk-derived signals.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 1. The loss of MZ B cells in NF-{kappa}B1/p50 mutant mice is not a result of enhanced Btk-derived signals. MZ B cells (IgMhighIgDlowCD21high) were analyzed from NF-{kappa}B1/p50+/–, NF-{kappa}B1/p50–/–, and NF-{kappa}B1/p50–/–/xid mice. Numbers indicate the percentage of cells that are of a MZ B cell phenotype in each gate. The table below shows the absolute numbers of MZ B cells in each mouse strain. Three mice were analyzed in each group. Values of p for differences between groups were determined by the Mann-Whitney U test.

 
NF-{kappa}B1 is required for B-1 B cell development

NF-{kappa}B is activated downstream of the BAFF-R in developing and mature B cells (16). Although Notch2 may be required for B-1 B cell development (11), BAFF knockout mice exhibit normal B-1 B cell development (33). It was of some interest to therefore examine whether NF-{kappa}B1-null mice have a defect in B-1 B cell development. As can be seen from Fig. 2, peritoneal IgMhighCD5+ B-1a B cell development is markedly compromised in the absence of NF-{kappa}B1. A less striking reduction in peritoneal IgMhigh Mac-1+ B-1b B cells was also noted in these mice.


Figure 2
View larger version (60K):
[in this window]
[in a new window]

  		FIGURE 2. Peritoneal B1a B cell numbers are decreased in NF-{kappa}B1/p50–/– mice. B-1a B cells are IgMhighCD5+ cells and B-1b B cells are IgMhighCD11b+ B cells. Three mice were analyzed in each group.

 
NF-{kappa}B1 and Notch2 synergize during the development of MZ B cells

NF-{kappa}B1-null mice, Notch2 conditionally null mice, as well as Notch2+/– mice all present with a significant reduction in MZ B cells (6, 11, 12). We therefore entertained the possibility that Notch2 and NF-{kappa}B1 might cooperate to influence MZ B cell development. To test this hypothesis, we analyzed FO and MZ B cell development in NF-{kappa}B1+/–, Notch2+/–, and NF-{kappa}B1+/–/Notch2+/– doubly heterozygous mice.

We have previously suggested that IgMhighIgDhighCD21int B cells may represent the last common precursor of MZ and IgDhighIgMlow mature FO B cells (14, 34, 35). The majority of these cells are long-lived posttransitional B cells (A. Cariappa, H. Liu, C. Boboila, S. T. Moran, and S. Pillai, submitted for publication). These cells are present in mutants, such as the Aiolos-null and Notch2+/– mice, that lack MZ B cells, but are also preserved in xid mice and other mutants in the Btk pathway in which IgDhighIgMlow mature FO B cells fail to develop or are lost. We currently refer to IgMhighIgDhighCD21int B cells as FO-II cells. We distinguish them from IgDhighIgMlow mature FO B cells, which we refer to as FO-I B cells. Consistent with previous reports, NF-{kappa}B1+/– mice have no obvious defect in splenic B cell development and Notch2+/– mice have a reduction in a presumed MZ precursor (MZP; IgMhighIgDhighCD21high) population and in MZ (IgMhighIgDlowCD21high) B cells, while other B cell populations (NF/ T1, IgMhighIgDlowCD21low; FO-II, IgMhighIgDhighCD21int; and IgMlowIgDhighCD21int FO-I B cells) are not reduced (6, 11, 12) (Fig. 3). Strikingly, in NF-{kappa}B1+/–/Notch2+/– doubly heterozygous mice, there is an almost complete absence of MZP and MZ B cells (Fig. 3; see Table I for absolute numbers). These data establish that the NF-{kappa}B1 and Notch2 genes interact genetically and function synergistically to promote MZ B cell development. However, in contrast, examination of peritoneal B-1 B cell development in NF-{kappa}B1+/–/Notch2+/– and NF-{kappa}B1–/–/Notch2+/– mice revealed no evidence of synergism between Notch2 and NF-{kappa}B1 during B-1B cell development (Fig. 4).


Figure 3
View larger version (49K):
[in this window]
[in a new window]

  		FIGURE 3. NF-{kappa}B1 and Notch2 function synergistically during the generation of MZ B cells. Splenic B cells from wild-type (C57BL/6), NF-{kappa}B1/p50+/–, Notch2+/–, and NF-{kappa}B1/p50+/–/Notch2+/– mice were analyzed for expression of IgD and IgM (left panels) followed by CD21 (right panels). This analysis distinguishes five different splenic populations (from left to right): NF, IgMhighIgDlowCD21low; MZ, IgMhighIgDlowCD21high; FO-II, IgMhighIgDhighCD21int; MZP, IgMhighIgDhighCD21high; and FO-I, IgMlowIgDhighCD21int. Three mice were analyzed in each group.

 

View this table:
[in this window]
[in a new window]

  		Table I. Absolute numbers of splenic B cells in wild-type and mutant micea

 

Figure 4
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 4. NF-{kappa}B1 and Notch2 do not cooperate in the generation of peritoneal B1 B cells. Peritoneal B cells from NF-{kappa}B1/p50+/–, Notch2+/–, NF-{kappa}B1/p50–/–/Notch2+/–, and NF-{kappa}B1/p50+/–/Notch2+/– mice were analyzed. Three mice were analyzed in each group.

 
Hes5 and Deltex1 are regulated by NF-{kappa}B1

There are a number of potential ways in which the Notch2 and NF-{kappa}B1 transcriptional regulators could potentially synergize during MZ B cell development. One possible mechanism is the cooperative transcriptional regulation of target genes. The Deltex1 (Dtx1) gene is known to be positively regulated by Notch2 and to be expressed at higher levels in MZ B cells than in other B cell populations (6). The hairy/enhancer of split homolog 5 (Hes5) is also expressed most strongly in MZ B cells (6). We tested the hypothesis that these known Notch targets might represent NF-{kappa}B1-regulated genes in B cells. We performed quantitative real-time RT-PCR on RNA obtained from wild-type and NF-{kappa}B1 mutant FO-II cells (the cell type that represents the presumed last common precursor for both MZ B cells and FO-I B cells) as well as on RNA extracted from wild-type MZ and FO-I B cells. Fig. 5A shows that the IgMhighIgDhighCD21int FO-II B cell population is preserved in NF-{kappa}B1–/– mice even though the MZP B cell population is reduced. As shown in Fig. 5B, Hes5 and Dtx1 are more highly expressed in wild-type FO-II cells than in NF-{kappa}B1-null FO-II cells, suggesting that NF-{kappa}B1 is a positive regulator of these genes. In addition, quantitative real-time RT-PCR analysis confirmed that both Hes5 and Dtx1 are more highly expressed in wild-type MZ B cells relative to FO-I B cells. These data suggest that in differentiating B cells, some genes, such as Deltex1, may be dually regulated by both Notch2 and NF-{kappa}B1.


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		FIGURE 5. Expression of Hes5 and Deltex1, is regulated by NF-{kappa}B1. A, The IgMhighIgDhighCD21int FO-II fraction is preserved in p50–/– mice when compared with wild-type mice (n = 3 in each group). B, Expression of Hes5 and Deltex1 in wild-type and NF-{kappa}B1 mutant FO-II B cells as well as in wild-type MZ and FO-I B cells was analyzed by a real-time PCR approach described in Materials and Methods. Error bars denote 1 SD from the mean. Transcript levels were measured in arbitrary units; n.s., no signal.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
We have observed a strong genetic interaction between two hemizygous loci. Such collaboration between two distinct heterozygous null alleles has very rarely been observed in studies of mouse development. Although Notch2+/– mice do have a clearly discernible reduction in MZ B cells, Notch2+/–/NF-{kappa}B1+/– mice present with a far more striking phenotype. Our genetic analyses clearly reveal synergism between NF-{kappa}B1 and Notch2 during MZ B cell development. There are many potential ways in which Notch2 and NF-{kappa}B1 may function synergistically. Given that both these proteins are transcriptional regulators, Notch2 could potentially affect the expression of NF-{kappa}B1; alternatively, NF-{kappa}B1 could potentially regulate the expression of Notch2 or of components of the Notch pathway. Yet another possibility is that target genes could be synergistically regulated by Notch2 and NF-{kappa}B1. Our studies suggest that Notch2 and NF-{kappa}B1 might cooperate at the level of target gene expression in splenic B cells and this may explain their synergism during the development of MZ B cells. Cooperative interactions between the Notch and NF-{kappa}B pathways have not been described in any other developmental context in metazoans.

As has been reported earlier (6, 11), we observed an increase in FO-I B cell numbers in Notch2+/– mice, but this increase was no longer observed in Notch2+/–/p50+/– double heterozygotes (Table I). We do not precisely understand why normal FO-I B cell numbers are observed in the double heterozygotes; these data are consistent with the view that Notch2 drives MZ B cell development at the expense of FO-I B cell maturation, but that the increase in FO-I B cells in the absence of Notch2 may depend in part on some aspect of NF-{kappa}B signaling. The synergism between Notch2 and NF-{kappa}B1 during MZ B cell development does not extend to the regulation of FO B cell numbers or to the development of B-1 B cells.

We have shown that both Deltex1 and Hes5 are expressed at relatively high levels in MZ B cells and that both these genes are expressed in the B lineage in an NF-{kappa}B1-dependent manner. The dependence of Deltex1 expression on Notch2 is clear but the evidence for Notch2-dependent regulation of Hes5 is weaker (6). Our data are consistent with the possibility that a set of genes may be coordinately regulated by Notch2 and NF-{kappa}B to orchestrate a program that potentially commits developing B cells to a MZ B cell fate. Clearly a large set of genes, and not merely Dtx1 (and possibly Hes5), may be dual Notch and NF-{kappa}B targets. It will be necessary to perform chromatin immunoprecipitation assays at specific stages of B cell development to examine the in vivo occupancy by transcription factors of regulatory sites in putative target genes to fully reveal the transcriptional targets of Notch2 and NF-{kappa}B that contribute to MZ B cell development.

What signaling receptor is responsible for the induction of NF-{kappa}B1-containing heterodimers during MZ B cell development? The actual signaling pathway that contributes to the activation of NF-{kappa}B during MZ B cell development remains unclear. Although basal or low-level BCR signaling may be the source of NF-{kappa}B activation during MZ B cell development, the participation of NF-{kappa}B1 does not appear to depend on the activation of the BCR/Btk/phospholipase C{gamma} pathway, because this latter pathway is not required for MZ B cell development. A likely source of NF-{kappa}B activation in the context of MZ B cell development is the BAFF-R. BAFF-null mice present with a severe reduction of both MZ and FO B cell populations (33) and this defect is phenocopied by conditional IKK{gamma}-null mice defective in the canonical NF-{kappa}B-signaling pathway (36). Constitutively active IKKbeta can rescue the BAFF-R defect, indicating that canonical NF-{kappa}B signaling during B cell development is largely mediated by the BAFF-R (16). BAFF signaling may mediate the survival of peripheral B cells by posttranslationally down-regulating the expression of Bim (37). However, it might separately contribute to the transcriptional induction of target genes in collaboration with Notch-2 to mediate MZ B cell development or survival.

It is interesting that there appears to be an absolute requirement for NF-{kappa}B1, an NF-{kappa}B protein that lacks an activation domain, during MZ B cell development. We assume that the activation in vivo of a subset of genes required for MZ B cell development depends on NF-{kappa}B1-containing heterodimers, and that c-Rel homodimers for instance, cannot functionally replace NF-{kappa}B1 containing heterodimers in this context, although they may suffice for FO B cell survival. These stringent in vivo requirements are consistent with the growing appreciation that the composition and posttranslational modifications of NF-{kappa}B dimers critically influence target gene activation (2, 38). We have previously demonstrated that the absence of c-Rel or of p65/RelA only partly reduces MZ B cell numbers (12), suggesting that both NF-{kappa}B1/c-Rel and NF-{kappa}B1/p65 heterodimers may contribute to MZ B cell development. The requirement for NF-{kappa}B1 is particularly intriguing when one considers that BAFF signaling via the alternative pathway is likely to contribute to the processing of p100 to yield NF-{kappa}B2 in all B cells in lymphoid follicles (39), suggesting indirectly that NF-{kappa}B2 cannot substitute for NF-{kappa}B1 during MZ B cell development. Nevertheless, there appears to be an independent B cell-intrinsic as well as a B cell-extrinsic requirement for RelB during MZ B cell development (40), suggesting a requirement for both the canonical and alternative NF-{kappa}B pathways during MZ B cell development and/or survival.

Our studies suggest that Notch2 and NF-{kappa}B1 function in a different way during B-1 B cell development, distinct from their synergistic roles in MZ B cells. The role of Notch2 in B1 B cell development remains unclear—a defect was not seen in conditional Notch2–/– mice but was observed in a separate study examining Notch2+/– heterozygotes. How exactly NF-{kappa}B1 functions in B-1 B cell development is also unclear, and given that BAFF-R is dispensable during the development of this lineage, the cell surface receptor activating NF-{kappa}B1 during B-1 B cell development is presumably not this TNF family receptor. Given the stringent requirement for relatively strong BCR signaling and for the Btk pathway during B-1 B cell development (in contrast to the limited role, if any, for Btk during MZ B cell development), it may well be that the BCR/Btk pathway induces the activity of NF-{kappa}B1-containing heterodimers during B-1 B cell development.

In conclusion, our results indicate that Notch2 and NF-{kappa}B1 function synergistically in vivo during the development of MZ B cells. The identification of the specific Notch and NF-{kappa}B1 targets that are required during MZ B cell development will be essential to obtain a detailed molecular elucidation of the programs that drive the development of cells of this B lymphoid lineage.


   Acknowledgments
 
We thank Joanne Yetze-Aldape, John Daley, and Susan Lazo-Kallanian for their contributions to flow cytometric sorting.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AI 064930 and CA102793. Back

2 S.T.M. and A.C. were equal contributors. Back

3 Address correspondence and reprint requests to Dr. Shiv Pillai, Massachusetts General Hospital Cancer Center, Building 149, 13th Street, Charlestown, MA 02129. E-mail address: pillai{at}helix.mgh.harvard.edu Back

4 Abbreviations used in this paper: IKK, I{kappa}B kinase; FO, follicular; MZ, marginal zone; Btk, Bruton’s tyrosine kinase; BAFF, B cell-activating factor of the TNF family; BAFF-R, BAFF receptor; FO-I, FO type I; FO-II, FO type II; MZP, MZ precursor; NF, newly formed. Back

Received for publication January 2, 2007. Accepted for publication April 30, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Artavanis-Tsakonas, S., M. D. Rand, R. J. Lake. 1999. Notch signaling: cell fate control and signal integration in development. Science 284: 770-776. [Abstract/Free Full Text]
  2. Ghosh, S., M. Karin. 2002. Missing pieces in the NF-{kappa}B puzzle. Cell 109: (Suppl.):S81-S96. [Medline]
  3. Zhong, H., M. J. May, E. Jimi, S. Ghosh. 2002. The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol. Cell 9: 625-636. [Medline]
  4. Pui, J. C., D. Allman, L. Xu, S. DeRocco, F. G. Karnell, S. Bakkour, J. Y. Lee, T. Kadesch, R. R. Hardy, J. C. Aster, W. S. Pear. 1999. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11: 299-308. [Medline]
  5. Radtke, F., A. Wilson, G. Stark, M. Bauer, J. van Meerwijk, H. R. MacDonald, M. Aguet. 1999. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 10: 547-558. [Medline]
  6. Saito, T., S. Chiba, M. Ichikawa, A. Kunisato, T. Asai, K. Shimizu, T. Yamaguchi, G. Yamamoto, S. Seo, K. Kumano, et al 2003. Notch2 is preferentially expressed in mature B cells and indispensable for marginal zone B lineage development. Immunity 18: 675-685. [Medline]
  7. Tanigaki, K., H. Han, N. Yamamoto, K. Tashiro, M. Ikegawa, K. Kuroda, A. Suzuki, T. Nakano, T. Honjo. 2002. Notch-RBP-J signaling is involved in cell fate determination of marginal zone B cells. Nat. Immunol. 3: 443-450. [Medline]
  8. Hozumi, K., N. Negishi, D. Suzuki, N. Abe, Y. Sotomaru, N. Tamaoki, C. Mailhos, D. Ish-Horowicz, S. Habu, M. J. Owen. 2004. Delta-like 1 is necessary for the generation of marginal zone B cells but not T cells in vivo. Nat. Immunol. 5: 638-644. [Medline]
  9. Maillard, I., A. P. Weng, A. C. Carpenter, C. G. Rodriguez, H. Sai, L. Xu, D. Allman, J. C. Aster, W. S. Pear. 2004. Mastermind critically regulates Notch-mediated lymphoid cell fate decisions. Blood 104: 1696-1702. [Abstract/Free Full Text]
  10. Kuroda, K., H. Han, S. Tani, K. Tanigaki, T. Tun, T. Furukawa, Y. Taniguchi, H. Kurooka, Y. Hamada, S. Toyokuni, T. Honjo. 2003. Regulation of marginal zone B cell development by MINT, a suppressor of Notch/RBP-J signaling pathway. Immunity 18: 301-312. [Medline]
  11. Witt, C. M., W. J. Won, V. Hurez, C. A. Klug. 2003. Notch2 haploinsufficiency results in diminished B1 B cells and a severe reduction in marginal zone B cells. J. Immunol. 171: 2783-2788. [Abstract/Free Full Text]
  12. Cariappa, A., H. C. Liou, B. H. Horwitz, S. Pillai. 2000. Nuclear factor {kappa}B is required for the development of marginal zone B lymphocytes. J. Exp. Med. 192: 1175-1182. [Abstract/Free Full Text]
  13. Cariappa, A., M. Tang, C. Parng, E. Nebelitskiy, M. Carroll, K. Georgopoulos, S. Pillai. 2001. The follicular versus marginal zone B lymphocyte cell fate decision is regulated by Aiolos, Btk, and CD21. Immunity 14: 603-615. [Medline]
  14. Pillai, S., A. Cariappa, S. T. Moran. 2005. Marginal zone B cells. Annu. Rev. Immunol. 23: 161-196. [Medline]
  15. Mackay, F., S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher, P. Schneider, J. Tschopp, J. L. Browning. 1999. Mice transgenic for BAFF develop lymphocytic disorders along with autoimmune manifestations. J. Exp. Med. 190: 1697-1710. [Abstract/Free Full Text]
  16. Sasaki, Y., E. Derudder, E. Hobeika, R. Pelanda, M. Reth, K. Rajewsky, M. Schmidt-Supprian. 2006. Canonical NF-{kappa}B activity, dispensable for B cell development, replaces BAFF-receptor signals and promotes B cell proliferation upon activation. Immunity 24: 729-739. [Medline]
  17. Martin, F., J. F. Kearney. 2000. Positive selection from newly formed to marginal zone B cells depends on the rate of clonal production, CD19, and btk. Immunity 12: 39-49. [Medline]
  18. Okkenhaug, K., A. Bilancio, G. Farjot, H. Priddle, S. Sancho, E. Peskett, W. Pearce, S. E. Meek, A. Salpekar, M. D. Waterfield, et al 2002. Impaired B and T cell antigen receptor signaling in p110{delta} PI 3-kinase mutant mice. Science 297: 1031-1034. [Abstract/Free Full Text]
  19. Clayton, E., G. Bardi, S. E. Bell, D. Chantry, C. P. Downes, A. Gray, L. A. Humphries, D. Rawlings, H. Reynolds, E. Vigorito, M. Turner. 2002. A crucial role for the p110{delta} subunit of phosphatidylinositol 3-kinase in B cell development and activation. J. Exp. Med. 196: 753-763. [Abstract/Free Full Text]
  20. Lu, T. T., J. G. Cyster. 2002. Integrin-mediated long-term B cell retention in the splenic marginal zone. Science 297: 409-412. [Abstract/Free Full Text]
  21. Guinamard, R., M. Okigaki, J. Schlessinger, J. V. Ravetch. 2000. Absence of marginal zone B cells in Pyk-2-deficient mice defines their role in the humoral response. Nat. Immunol. 1: 31-36. [Medline]
  22. Croker, B. A., D. M. Tarlinton, L. A. Cluse, A. J. Tuxen, A. Light, F. C. Yang, D. A. Williams, A. W. Roberts. 2002. The Rac2 guanosine triphosphatase regulates B lymphocyte antigen receptor responses and chemotaxis and is required for establishment of B-1a and marginal zone B lymphocytes. J. Immunol. 168: 3376-3386. [Abstract/Free Full Text]
  23. Girkontaite, I., K. Missy, V. Sakk, A. Harenberg, K. Tedford, T. Potzel, K. Pfeffer, K. D. Fischer. 2001. Lsc is required for marginal zone B cells, regulation of lymphocyte motility and immune responses. Nat. Immunol. 2: 855-862. [Medline]
  24. Fukui, Y., O. Hashimoto, T. Sanui, T. Oono, H. Koga, M. Abe, A. Inayoshi, M. Noda, M. Oike, T. Shirai, T. Sasazuki. 2001. Haematopoietic cell-specific CDM family protein DOCK2 is essential for lymphocyte migration. Nature 412: 826-831. [Medline]
  25. Guan, E., J. Wang, J. Laborda, M. Norcross, P. A. Baeuerle, T. Hoffman. 1996. T cell leukemia-associated human Notch/translocation-associated Notch homologue has I{kappa}B-like activity and physically interacts with nuclear factor-{kappa}B proteins in T cells. J. Exp. Med. 183: 2025-2032. [Abstract/Free Full Text]
  26. Espinosa, L., J. Ingles-Esteve, A. Robert-Moreno, A. Bigas. 2003. I{kappa}B{alpha} and p65 regulate the cytoplasmic shuttling of nuclear corepressors: cross-talk between Notch and NF{kappa}B pathways. Mol. Biol. Cell 14: 491-502. [Abstract/Free Full Text]
  27. Aguilera, C., R. Hoya-Arias, G. Haegeman, L. Espinosa, A. Bigas. 2004. Recruitment of I{kappa}B{alpha} to the hes1 promoter is associated with transcriptional repression. Proc. Natl. Acad. Sci. USA 101: 16537-16542. [Abstract/Free Full Text]
  28. Bash, J., W. X. Zong, S. Banga, A. Rivera, D. W. Ballard, Y. Ron, C. Gelinas. 1999. Rel/NF-{kappa}B can trigger the Notch signaling pathway by inducing the expression of Jagged1, a ligand for Notch receptors. EMBO J. 18: 2803-2811. [Medline]
  29. Cariappa, A., L. Chen, K. Haider, M. Tang, E. Nebelitskiy, S. T. Moran, S. Pillai. 2003. A catalytically inactive form of protein kinase C-associated kinase/receptor interacting protein 4, a protein kinase Cbeta-associated kinase that mediates NF-{kappa}B activation, interferes with early B cell development. J. Immunol. 171: 1875-1880. [Abstract/Free Full Text]
  30. Hardy, R. R., K. Hayakawa, D. R. Parks, L. A. Herzenberg. 1983. Demonstration of B cell maturation in X-linked immunodeficient mice by simultaneous three colour immunofluorescence. Nature 306: 270-272. [Medline]
  31. Cariappa, A., I. B. Mazo, C. Chase, H. N. Shi, H. Liu, Q. Li, H. Rose, H. Leung, B. J. Cherayil, P. Russell, et al 2005. Perisinusoidal B cells in the bone marrow participate in T-independent responses to blood-borne microbes. Immunity 23: 397-407. [Medline]
  32. Ma, X. J., R. Salunga, J. T. Tuggle, J. Gaudet, E. Enright, P. McQuary, T. Payette, M. Pistone, K. Stecker, B. M. Zhang, et al 2003. Gene expression profiles of human breast cancer progression. Proc. Natl. Acad. Sci. USA 100: 5974-5979. [Abstract/Free Full Text]
  33. Schiemann, B., J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, M. L. Scott. 2001. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 293: 2111-2114. [Abstract/Free Full Text]
  34. Pillai, S., A. Cariappa, S. T. Moran. 2004. Positive selection and lineage commitment during peripheral B-lymphocyte development. Immunol. Rev. 197: 206-218. [Medline]
  35. Cariappa, A., S. Pillai. 2002. Antigen-dependent B-cell development. Curr. Opin. Immunol. 14: 241-249. [Medline]
  36. Pasparakis, M., M. Schmidt-Supprian, K. Rajewsky. 2002. I{kappa}B kinase signaling is essential for maintenance of mature B cells. J. Exp. Med. 196: 743-752. [Abstract/Free Full Text]
  37. Craxton, A., K. E. Draves, A. Gruppi, E. A. Clark. 2005. BAFF regulates B cell survival by downregulating the BH3-only family member Bim via the ERK pathway. J. Exp. Med. 202: 1363[Abstract/Free Full Text]
  38. Leung, T. H., A. Hoffmann, D. Baltimore. 2004. One nucleotide in a {kappa}B site can determine cofactor specificity for NF-{kappa}B dimers. Cell 118: 453-464. [Medline]
  39. Claudio, E., K. Brown, S. Park, H. Wang, U. Siebenlist. 2002. BAFF-induced NEMO-independent processing of NF-{kappa}B2 in maturing B cells. Nat. Immunol. 3: 958-965. [Medline]
  40. Weih, D. S., Z. B. Yilmaz, F. Weih. 2001. Essential role of RelB in germinal center and marginal zone formation and proper expression of homing chemokines. J. Immunol. 167: 1909[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
A. Cariappa, C. Boboila, S. T. Moran, H. Liu, H. N. Shi, and S. Pillai
The Recirculating B Cell Pool Contains Two Functionally Distinct, Long-Lived, Posttransitional, Follicular B Cell Populations
J. Immunol., August 15, 2007; 179(4): 2270 - 2281.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moran, S. T.
Right arrow Articles by Pillai, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moran, S. T.
Right arrow Articles by Pillai, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS