|
|
||||||||


* Division of Oncology, Center for Applied Medical Research,
Department of Histology and Pathology, and
Department of Biochemistry, School of Medicine, University of Navarra, Pamplona, Spain
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
H1264 (lung adenocarcinoma) and A549 (bronchoalveolar lung carcinoma) cell lines were obtained from the American Type Culture Collection. Cells were grown in RPMI 1640 with L-Glutamax (Invitrogen Life Technologies) supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin.
Sera
Normal human serum (NHS) was used as the source of complement. A pool of sera from 12 healthy donors was prepared. Heat-inactivated NHS (HI-NHS) was obtained by incubation of the serum at 56°C for 30 min.
Antibodies
Mouse anti-human factor H mAb OX-24 was prepared and purified as previously described (14). Mouse anti-human CD46 mAb GB-24 was a gift from Dr. J. Atkinson (Washington University, St. Louis, MO). Mouse anti-human CD55 mAbs BRIC 110 and BRIC 216 were purchased from IBGRL. Rat anti-human CD59 mAb YTH53.1 was purchased from Serotec. Isotype controls MOPC-21 (mouse IgG1) and YTH53.1 (rat IgG2b) were purchased from Sigma-Aldrich and Abcam, respectively. Polyclonal antisera against H1264 and A549 cells were prepared by immunizing female New Zealand White rabbits (Harlan) with whole-cell lysates from each cell line. The experimental protocols were reviewed and approved by the Institutional Animal Care and Use Committee of the University of Navarra. Immunization was performed by three injections of 107 cells each at 15-day intervals. For the first injection, cells were resuspended in 0.5 ml of PBS (10 mM phosphate and 150 mM NaCl, pH 7.4) and mixed with CFA (Difco). The mixture was injected intradermally on the back of the rabbits. Subsequent s.c. and i.m. booster injections were conducted with cells mixed with IFA (Difco). Sera obtained from the rabbits were incubated at 56°C for 30 min to inactivate complement activity. Antiserum immunoreactivity against each cell line was confirmed by flow cytometry using a FACSCalibur from BD Biosciences. CellQuest Pro software (BD Biosciences) was used for data acquisition and analysis.
Expression of mCRPs
Cells were detached from the culture dishes with 1 mM EDTA, washed once, and resuspended in binding buffer (PBS containing 1% BSA and 0.1% sodium azide). Cells (1 x 105) in 50 µl of binding buffer were incubated with the primary mAb for 30 min at 4°C. After three washings, cells were incubated for 30 min at 4°C with Alexa Fluor 488-conjugated goat anti-mouse IgG (Molecular Probes) or FITC-conjugated rabbit anti-rat IgG (Serotec) diluted 1/100 in a total volume of 50 µl. Cells were washed three times and analyzed by flow cytometry after the addition of propidium iodide. Data were collected as mean fluorescence intensity. Cells incubated only with the anti-mouse secondary Ab were used as negative control.
Deposition of C3-related fragments
Cells were detached from the culture dishes with 1 mM EDTA, washed once, and resuspended in veronal buffer (1.8 mM barbital, 3.1 mM barbituric acid, 141 mM NaCl, 0.5 mM MgCl2, and 0.15 mM CaCl2, pH 7.4). Cells (2 x 105) were incubated for 30 min at 4°C with the specific rabbit antisera diluted 1/50 in a total volume of 100 µl. After three washes, cells were again resuspended in veronal buffer (75 µl) and mixed with 125 µl of NHS diluted 1/5. Cells were incubated in the presence of NHS (final dilution, 1/8) for 30 min at 37°C. Deposition of C3 or related fragments was determined as described previously (14). Briefly, cells were incubated for 30 min at 4°C with a FITC-conjugated goat anti-human complement C3 Ab (ICN Biomedicals) and analyzed by flow cytometry after the addition of propidium iodide. To block mCRPs, cells were preincubated, before the addition of the rabbit antiserum, with the blocking Abs (GB-24 or BRIC 110/BRIC 216) at saturating concentrations (49.2, 7.2, and 2.3 µg/ml, respectively) during 30 min at 4°C. To block factor H, NHS (diluted 1/5) was preincubated for 30 min at 4°C with OX-24 at 0.16 mg/ml.
C5a release
Cells were processed and treated as described in the previous paragraph. Release of C5a was quantified in the supernatants using the Human C5a ELISA Kit (BD Biosciences) according to the manufacturers instructions.
Complement-mediated cytotoxicity
Cell lysis was evaluated using the calcein release assay as previously described, with slight modifications (26). In brief, 4 x 106 cells were resuspended in 2 ml of veronal buffer containing 2 µM calcein-AM (Molecular Probes). Cells were loaded with calcein at 37°C for 1 h and washed once with veronal buffer. Aliquots of 2 x 105 cells were treated with the antisera and neutralizing Abs as described in the previous section. Besides, the Ab YTH53.1 was used to block CD59 activity at a saturating concentration of 60 µg/ml. After incubation with NHS, cells were pelleted by centrifugation and supernatants were transferred to a 96-well plate (plate 1). Pelleted cells were lysed in 55 µl of 0.1% Triton X-100 and transferred to a 96-well plate (plate 2). Fluorescence was measured with excitation at 485 nm and emission at 520 nm. Calcein release (percent) was calculated as follows: (plate 1 value) x 100/(plate 1 value + plate 2 value). The specific release (complement-mediated cytotoxicity) was the calcein release calculated above minus the calcein release in cells not exposed to complement (cells treated with HI-NHS).
Vector-based small interfering RNA (siRNA)
Factor H oligonucleotides for siRNA were cloned in the pSHH vector using the GeneSilencer system (Imgenex). Oligonucleotides were designed against positions 808828 of factor H mRNA (G.I. 31964). A plasmid containing an irrelevant siRNA with a scramble sequence (AATTCTCCGAACGTGTCACGT) was used as control. For transfection, A549 cells (106) were grown in a 100-mm2 culture plate with DMEM supplemented with 10% FBS during 48 h. Transfection was performed using a mixture of 10 µg of siRNA plasmid and 10 µl of Lipofectamine 2000 (Invitrogen Life Technologies) in 1 ml of
MEM. Cells were incubated at 37°C with the DNA-Lipofectamine mixture and after 4 h were diluted twice with DMEM containing 20% FBS. Stable clones were selected in RPMI 1640 supplemented with 10% FBS and 0.5 mg/ml geneticin (Invitrogen Life Technologies).
Factor H quantification
A polystyrene 96-well plate was coated with 50 ng/well of the anti-factor H mAb OX-24 (in 50 µl of 50 mM sodium bicarbonate, pH 8.3) during 1 h at room temperature. After washings, the plate was blocked overnight at 4°C with blocking buffer: TBS (25 mM Tris and 150 mM NaCl, pH 7.4) with 1% BSA and 0.1% Tween 20. A volume of 50 µl of samples (supernatants of cells grown in RPMI 1640 without FBS for 48 h) or standards (factor H ranging from 1.5 to 200 ng/ml) was added and the plate was incubated for 2 h at room temperature. Human factor H was obtained from Sigma-Aldrich. After washings, a rabbit anti-factor H Ab (1/1000; Serotec) was added, and after a 30-min incubation at room temperature the assay was developed using a donkey anti-rabbit Ab coupled to HRP (1/2000; Amersham Biosciences) and o-phenylenediamine dihydrochloride (Sigma-Aldrich). The plate was read at 450 nm.
Western blotting
Supernatants of cells grown in RPMI 1640 without FBS for 48 h were concentrated, and factor H expression was analyzed as described previously (14).
Northern blotting
RNA purification was achieved with the Ultraspec Total RNA Isolation Reagent (Biotecx) according to the manufacturers instructions. Analysis for factor H mRNA expression by Northern blotting was performed as described previously (14).
Cell proliferation assay
Stable A549 siRNA cells (750 cells/well) were seeded in 96-well plates and cultured in 100 µl of RPMI 1640 supplemented with 10% FBS and 0.5 mg/ml geneticin. During 5 days, cell proliferation was determined daily using a MTT assay (Roche) per the manufacturers instructions.
In vivo xenograft studies
A549 cells stably transfected with the siRNA vector (at 80% confluence) were trypsinized and washed twice with PBS. Six million cells were resuspended in 150 µl of PBS and injected s.c. on the right flank of 4- to 6-wk-old female athymic nude mice (Harlan). Tumor development was monitored for
6 wk. Tumors were measured with a caliper and tumor volumes (V) were calculated using the formula: V (mm3) = L x W2, where L is the length and W is the width of the tumor. In a subset of cases, cells were first preincubated in 3 ml of PBS with 15 µl of anti-A549 antiserum or 15 µl of preimmune serum and washed three times before injection. In these cases, continuous stimulation of complement was performed by intratumoral injection of antiserum 1/5 (or preimmune serum) in 75 µl of PBS every 3 days.
Depletion of complement
Depletion of complement in nude mice was achieved by i.p. injection of 5 µg of cobra venom factor (CVF; Aczon) in 100 µl of PBS at 28, 24, and 4 h before injection of tumor cells. This regimen of injections has been previously described (27). In control mice, i.p. injections of 100 µl of PBS were performed. To avoid complement recovery during the experiment, periodically 5 µg of CVF injections was administered every 3 days. Complement depletion was monitored by quantification of C3 in mouse sera. Quantification of C3 was conducted following the protocol described above for factor H. Plates were coated with goat anti-mouse C3 (1/1000; Cappel Laboratories), serum samples were loaded at different dilutions, and the assay was developed using a goat anti-mouse C3 coupled to HRP (1/10000, Cappel Laboratories). Percentage of C3 depletion was calculated using the levels of C3 in serum before treatment with CVF as reference.
Statistical analysis
Data were analyzed by Students t test. A p < 0.05 was considered to be statistically significant.
| Results |
|---|
|
|
|---|
In a previous study, we have shown that H1264 and A549 cells are able to produce and bind the complement regulator factor H (14). We now studied the presence of the membrane-bound complement inhibitors CD46, CD55, and CD59 in both lung cancer cell lines. Flow cytometry analysis revealed the expression of the three complement regulators in the two cell lines. Expression of CD46 was similar in H1264 and A549 cells, while expression of CD55 was higher in H1264 cells and expression of CD59 was higher in A549 cells (Fig. 1).
|
Human NSCLC cells are highly resistant to the activation of the classical pathway of complement as compared with normal cells (28). Factor H, CD46, and CD55 are complement regulators that inhibit C3 convertases, key enzymes in the activation cascade of complement. We evaluated whether the resistance on H1264 and A549 NSCLC cells was related to the activity of any of these regulators. The classical pathway of complement was activated with specific antisera generated in rabbits against whole-cell extracts of both cell lines. The activity of each regulator was blocked with specific mAbs (OX-24 for factor H/FHL-1, GB-24 for CD46, and BRIC 110/216 for CD55). C3 convertase activity was evaluated by flow cytometry with an Ab that recognizes C3 and C3-derived fragments. Fig. 2 shows C3 deposition after activation of the classical pathway with NHS (diluted 1/8) in the presence or absence of neutralizing Abs. Blockade of either factor H or CD55 slightly increased C3 deposition on both H1264 and A549 cell membranes, suggesting that the activities of factor H and CD55 protect these lung cancer cells against the deposition of C3-related fragments. Inhibition of CD46 increased C3 deposition on A549 cells, but not on H1264 cells. In the activation cascade, C3 convertase activity leads to the formation and activation of C5 convertases, which cleave C5 in two fragments: cell-bound C5b and anaphylatoxin C5a. We evaluated the ability of factor H, CD46, and CD55 to control the C5a production on H1264 and A549 lung cancer cells upon activation of the classical pathway of complement. Incubation of H1264 and A549 cells in the presence of NHS (1/8) produced a moderate increase in the release of C5a (Fig. 3). Inhibition of factor H by the neutralizing mAb OX-24 increased significantly the release of C5a in H1264 (from 15.8 ± 3.2 ng/ml to 42.3 ± 3.2 ng/ml, p < 0.001) and A549 cells (from 12.3 ± 2.8 ng/ml to 48.7 ± 8.1 ng/ml, p = 0.002) (Fig. 3). When the same experiment was conducted in the presence of MOPC-21, an isotype control, C5a release was not affected. Neither neutralization of CD46 nor neutralization of CD55 affected C5a release after activation of the classical pathway of complement. Therefore, the three complement regulators are able to control the deposition of C3-related fragments on H1264 and A549 cell membranes, but only neutralization of factor H triggers an increase in C5 convertase activity. These data suggest that factor H protects H1264 and A549 cells after activation of the classical pathway of complement.
|
|
Among other immunological implications, activation of the classical pathway of complement may ultimately lead to complement-mediated cytotoxicity. We tested whether the inhibition of factor H, CD46, or CD55 may increase this cytotoxicity. H1264 and A549 cells were incubated in the presence of NHS with and without neutralizing Abs against the three complement regulators. Cytotoxicity was determined as calcein release using HI-NHS to differentiate complement-mediated release from nonspecific release. After activation of the classical pathway, blockade of factor H increased cytotoxicity, although this effect did not reach statistical significance (Fig. 4, A and B). In contrast, neutralization of CD59, with mAb YTH53.1, significantly increased complement-mediated cytotoxicity in both H1264 (from 13.1% ± 11.5 to 52.2% ± 11.8; p = 0.015) and A549 cells (from 16.0% ± 8.6 to 66.5% ± 6.2; p = 0.001) (Fig. 4, A and B). CD59 is a complement regulator that prevents the formation of the lytic membrane attack complex (MAC). Interestingly, simultaneous neutralization of factor H and CD59 increased lysis to 85.7 ± 14.6% in H1264 cells and to 83.4 ± 6.0% in A549 cells (Fig. 4, A and B). In both cell lines, cytotoxicity was significantly higher than that obtained by neutralization of CD59 alone (H1264: p = 0.036; A549: p = 0.028). Isotype controls for OX-24 and YTH53.1 did not affect cytotoxicity. YTH53.1 did not induced C5a release, ruling out an activation of complement by this Ab that may account for the increase in lysis. Our data suggest that there is an increase of the activity of the classical pathway of complement in H1264 and A549 cells after neutralization of factor H, but this does not trigger cell lysis due to the presence of CD59. Neither inhibition of CD46 nor inhibition of CD55, alone or in combination with inhibition of CD59, had any effect on cell lysis after activation of the classical pathway of complement (Fig. 4, CF).
|
Neutralization of factor H increases C3 fragment deposition and C5a release after complement activation. Therefore, factor H activity may be relevant for the growth of tumors in vivo. To evaluate this hypothesis, we blocked the expression of factor H in A549 cells and grew them in athymic mice as s.c. xenografts. Athymic mice are immunodeficient and cannot develop a complete adaptive immune response, but have normal complement activity.
First, we generated an A549 stable clone in which expression of factor H/FHL-1 was inhibited by siRNA (clone named FH-siRNA A549). A549 cells stably transfected with an irrelevant siRNA were used as control (clone named control-siRNA A549). The gene expression knockdown was confirmed by Northern blot and Western blot analyses (Fig. 5, A and B). More than 90% inhibition, measured by ELISA in the serum-free conditioned medium, was achieved (24.2 ± 0.8 pg/µl in FH-siRNA A549 vs 365.0 ± 101.5 pg/µl in control-siRNA A549). Control-siRNA and FH-siRNA A549 cells showed identical proliferation rates in vitro, ruling out any effect of factor H down-regulation on in vitro growth (Fig. 5C). Xenograft tumor growth in vivo was then evaluated in athymic mice. We injected 10 mice with FH-siRNA cells and 10 mice with control-siRNA A549 cells. Tumor growth was monitored at least twice a week, starting at day 19 postinjection. One mouse in the control group had to be euthanized at the beginning of the experiment due to its rapid weight loss and debilitation. After 28 days postinjection, xenografts formed by FH-siRNA A549 cells were significantly smaller than those formed by control-siRNA A549 cells (Fig. 6A). At day 35, mean tumor volumes were 722 ± 110 mm3 for control cells and 393 ± 185 mm3 for factor H-deficient cells (p < 0.001; Fig. 6A). The experiment was repeated once with very similar results. To verify the role of complement in this growth inhibition, deposition of mouse C3 fragments on explanted xenograft tumors was evaluated by immunohistochemical analysis. In all cases, FH-siRNA tumor cells showed higher levels of C3 staining when compared with those of control-siRNA tumor cells (Fig. 6B). The contribution of complement in the reduction of tumor growth in vivo was further confirmed by the generation of complement-deficient mice with i.p. injections of CVF. CVF is a protein that forms stable C3/C5 convertases in mammalian serum with an elevated half-life (29). The activity of these convertases triggers an uncontrollable activation of the complement system, resulting in complement depletion. In our experimental conditions, serum C3 levels were reduced to <10% and, if CVF was not injected periodically, C3 recovered to 50 and 100% after 5 and 7 days, respectively (data not shown). To maintain a continuous depletion of serum in our experiments, CVF was injected every 3 days throughout the experiment. We inoculated FH-siRNA A549 cells in both PBS- and CVF-treated athymic mice (nine mice per group). Tumor volume was monitored twice or three times a week for 40 days. Significant differences were observed between CVF-treated mice and control mice from day 24 to the end of the experiment (Fig. 7). At day 40 after injection, the mean tumor volume was 591 ± 100 mm3 in mice treated with CVF and 282 ± 89 mm3 in mice treated with PBS (p < 0.001). This experiment was repeated once with similar results. Therefore, the growth rate of FH-siRNA A549 cells in complement-deficient mice is recovered, which strongly supports the role of complement activation in the reduction of FH-siRNA A549 cell growth.
|
|
|
|
| Discussion |
|---|
|
|
|---|
In our work, we have first confirmed that NSCLC cells are highly resistant to complement. The antisera against H1264 and A549 cells were highly immunoreactive and allowed a powerful stimulation of the classical pathway of complement. In fact, we observed extensive C3 deposition in both H1264 and A549 cell lines after the stimulation. However, despite the strong initial complement activation, the percentage of complement-mediated lysis remained low (
15%), suggesting the presence of highly efficient complement inhibitors. This fact was previously observed by Varsano et al. (28) using lung cancer cells ChaGo K-1 and H596 preincubated with anti-carcinoembryonic Abs. Intense C3 deposition in the absence of subsequent complement activation may indicate the presence of inactive C3 fragments on the cell membrane due to the action of C3 convertase inhibitors, such as the mCRPs CD46 and CD55. However, Varsano et al. (28) observed that neutralizing Abs anti-CD46 and anti-CD55 were entirely ineffective in increasing the susceptibility of the lung cancer cells to complement. Interestingly, the neutralization of the same inhibitors increased significantly the level of complement-mediated lysis in normal nasal epithelial cells (28), showing a different behavior from malignant cells. Our present data suggest that factor H may be responsible for this inhibitory activity in lung cancer cells. Neutralization of factor H increased C3 deposition moderately and triggered a significant increase of the C5 convertase activity, as determined by C5a release. These data suggest a real augment of active C3b deposition when factor H is blocked. In contrast, we have also confirmed that neither CD46 nor CD55 has any effect on the control of complement activation. The expression of these inhibitors in H1264 and A549 cells was high, but their neutralization moderately increased C3 deposition and had no effect on C5 convertase activity and complement-mediated cytotoxicity. Interestingly, despite the increase of complement activity after factor H inhibition, complement-mediated cytotoxicity did not augment significantly. Only when we neutralized simultaneously factor H and CD59, an inhibitor of the MAC formation, cell lysis increased, both in H1264 and A549 cells. As previously reported, blockade of CD59 alone also increased complement-mediated cytotoxicity (28). We conclude that both factor H and CD59 play a major role in the protection of H1264 and A549 lung cancer cells against complement activity.
More importantly, we show that expression of factor H by A549 lung cancer cells is critical for A549 tumor growth in vivo. The resistance against complement activation in vivo confirms the in vitro results and underlines the importance of modulating complement activity on lung cancer cells to improve Ab-based immunotherapies. The in vivo experiments were conducted with A549 cells stably transfected with a siRNA specific for factor H or an irrelevant siRNA. Xenografts from factor H-deficient cells were significantly smaller than those from control cells. We ruled out a direct effect of factor H on A549 cell growth rate in vitro. Our results with CVF, along with the high C3 deposition observed in xenografts from factor H-deficient A549 cells, strongly suggests that the effect on tumor growth was mediated by an increase in complement activation on the lung cancer cells. Besides, in complement-depleted mice, factor H-deficient A549 cell growth was comparable to that of normal A549 cells, suggesting that the complement response played a critical role in the tumor growth reduction. This may be considered surprising since factor H inhibition in vitro was not able to increase significantly complement-mediated lysis. However, it has to be remembered that, upon activation, the complement system has several potential effects. First, deposition of C3b on the cell surface leads to the formation of MAC, disrupting the membranes integrity and causing lysis. Second, deposition of complement components has an important role in fostering opsonization. Finally, during complement activation, powerful anaphylatoxins are released which promote inflammation by stimulating histamine release and attracting phagocytic cells to the area of activation (31). In an in vivo setting, the control of C3 deposition by factor H may prevent the establishment of relevant immune responses against the tumor, independent of the formation of MAC. In a syngeneic mouse model of metastatic lymphoma, inhibition of MAC-mediated lysis by expression of CD59 did not hinder the efficacy of Ig2a and IgM mAbs specific for the ganglioside GD2, indicating that both complement-dependent cellular cytotoxicity and Ab-dependent cellular cytotoxicity operate in vivo (32). It is also important to note that human factor H and murine factor H share high structural and functional similarities and that short consensus repeats 1820 of human factor H are able to bind to murine C3b (33). These results suggest that human factor H should be able to interact with murine complement. Using factor H-deficient mouse serum, we have observed a reduction in the deposition of murine C3 on human H1264 and A549 cells when increasing concentrations of human factor H were added (our unpublished data). Therefore, human factor H is able to interact with murine complement and inhibit its activity. This is not the case for CD59, since human CD59 is not able to regulate the murine complement system (34). The incapacity of human CD59 to inhibit the formation of MAC on A549 cells injected into mice may also help to explain the profound impact of factor H in the in vivo model. A question that arises from the in vivo experiments is the relevance of the endogenous murine factor H in the protection against complement by human lung cancer cells. Factor H is produced at high levels in mice and should be able to interact with tumor cells in a similar way to endogenously produced human factor H. However, based on our results, we can conclude that the expression of human factor H, but not the mere presence of murine factor H, protects human tumor cells against complement activation. It has been previously suggested that factor H/FHL-1 production by tumor cells causes a high accumulation of this protein in the tumor microenvironment, which would favor its protected role (25). Further investigation is warranted to clarify this interesting observation.
Given the numerous genetic and epigenetic changes associated with carcinogenesis, it is clear that tumor cells express many neoantigens that may be recognized by the immune system (1). This is the basis of the immune surveillance hypothesis, which proposes that the immune system surveys the body for these tumor-associated Ags, eliminating many or most tumors. A corollary to this hypothesis is that tumor cells in progressive cancers develop active mechanisms to escape immune recognition or resist immune attack. Although there is not irrefutable evidence for the existence of an effective immune surveillance, a wealth of published data support the role of the immune system as a primary defense against neoplasia and the importance of the protective mechanisms developed by the tumors (35, 36). Based on these results and on our previous studies (14), we propose that lung cancer cells may develop a protective mechanism against complement attack by expressing and binding factor H to their cell membranes. Several studies have also suggested the importance of factor H in the protection of other tumor cells against complement activation (12, 13, 25, 37). For the first time, we demonstrate the importance of factor H expression for the protection of cancer cells in an in vivo model. Hopefully, these results will help to elucidate the mechanisms used by lung tumor cells to avoid complement activity and will assist in the design of more efficient complement-mediated immunotherapies.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was funded through the UTE Project CIMA, Instituto de Salud Carlos III: Red Temática de Investigación Cooperativa en Cáncer (C03/10), the 20042006 American Association for Cancer Research-Cancer Research and Prevention Foundation Career Development Award in Translational Lung Cancer Research, and Ministerio de Educación y Ciencia (SAF-2005-01302). ![]()
2 Address correspondence and reprint requests to Dr. Ruben Pio or Dr. Luis M Montuenga, Oncology Division, CIMA Building, Pio XII, 55, Pamplona 31008, Spain. E-mail address: rpio{at}unav.es or lmontuenga{at}unav.es ![]()
3 Abbreviations used in this paper: MAC, membrane attack complex; mCRP, membrane-bound complement regulatory protein; FHL-1, factor H-like protein 1; NSCLC, non-small cell lung cancer; NHS, normal human serum; HI-NHS, heat-inactivated NHS; siRNA, small interfering RNA; CVF, cobra venom factor. ![]()
Received for publication April 28, 2006. Accepted for publication February 14, 2007.
| References |
|---|
|
|
|---|
1H. Proc. Natl. Acad. Sci. USA 73: 3268-3272.
1 H globulin. J. Exp. Med. 144: 1147-1163.
1H for cleavage of C3b and C4b in solution. J. Exp. Med. 146: 257-270. This article has been cited by other articles:
![]() |
S. M. Mangsbo, J. Sanchez, K. Anger, J. D. Lambris, K. N. Ekdahl, A. S. Loskog, B. Nilsson, and T. H. Totterman Complement Activation by CpG in a Human Whole Blood Loop System: Mechanisms and Immunomodulatory Effects J. Immunol., November 15, 2009; 183(10): 6724 - 6732. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Varela, M. Imai, C. Atkinson, R. Ohta, M. Rapisardo, and S. Tomlinson Modulation of Protective T Cell Immunity by Complement Inhibitor Expression on Tumor Cells Cancer Res., August 15, 2008; 68(16): 6734 - 6742. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |