The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 178: 5612-5622.
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Darce, J. R.
Right arrow Articles by Jelinek, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Darce, J. R.
Right arrow Articles by Jelinek, D. F.

Divergent Effects of BAFF on Human Memory B Cell Differentiation into Ig-Secreting Cells1

Jaime R. Darce, Bonnie K. Arendt, Sook Kyung Chang and Diane F. Jelinek2

Department of Immunology, Mayo Clinic College of Medicine, Mayo Graduate School, Rochester, MN 55905


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
B cell-activating factor belonging to the TNF family (BAFF) plays a critical role in B cell maturation, yet its precise role in B cell differentiation into Ig-secreting cells (ISCs) remains unclear. In this study, we find that upon isolation human naive and memory B (MB) cells have prebound BAFF on their surface, whereas germinal center (GC) B cells lack detectable levels of prebound BAFF. We attribute their lack of prebound BAFF to cell activation, because we demonstrate that stimulation of naive and MB cells results in the loss of prebound BAFF. Furthermore, the absence of prebound BAFF on GC B cells is not related to a lack of BAFF-binding receptors or an inability to bind exogenous BAFF. Instead, our data suggest that accessibility to soluble BAFF is limited within GCs, perhaps to prevent skewing of the conventional B cell differentiation program. In support of this concept, whereas BAFF significantly enhances ISC differentiation in response to T cell-dependent activation, we report for the first time the ability of BAFF to considerably attenuate ISC differentiation of MB cells in response to CpG stimulation, a form of T cell-independent activation. Our data suggest that BAFF may be providing regulatory signals during specific T cell-independent events, which protect the balance between MB cells and ISCs outside GCs. Taken together, these data define a complex role for BAFF in humoral immune responses and show for the first time that BAFF can also play an inhibitory role in B cell differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
B cell differentiation into effector memory B (MB)3 cells or Ig-secreting cells (ISCs) is influenced by various cytokines present in the activation milieu. In particular, members of the TNF/TNF-R superfamily have been shown to play significant roles in B cell differentiation (1). One member of this family, B cell-activating factor belonging to the TNF family (BAFF; also known as BLyS), is critical for the survival and homeostasis of B lymphocytes (2). BAFF was initially found to be expressed and secreted by myeloid lineage cells in response to IFN-{gamma} stimulation (3, 4). However, it is now known that BAFF is also expressed by neutrophils, astrocytes, neoplastic, and normal B lineage cells, and T cells from autoimmune disorders (5, 6, 7, 8, 9, 10, 11, 12). It is expressed as a transmembrane protein or as a soluble ligand following cleavage at the cell surface by furin convertases (13).

To date, BAFF has been shown to bind to three receptors: BAFF-R (14), transmembrane activator and calcium-modulating cyclophilin ligand interactor (TACI) (15, 16, 17), and B cell maturation Ag (BCMA) (18, 19). These receptors are predominantly expressed on B lineage cells, although their expression has been observed in activated T cells and myeloid lineage cells (20, 21, 22).

BAFF-binding receptors (BBRs) are expressed at various stages of B cell maturation (23), implying a role for BAFF at all stages of development. However, the role of BAFF is best understood in relationship to post-bone marrow B cell maturation. Thus, there is clear evidence using BAFF null mice that this molecule is critically required for the progression of B cell development beyond the transitional type 2 stage (14, 19). BAFF also appears to be important in B cell homeostasis, because BAFF transgenic mice show an increase in mature B cells, which often leads to autoimmunity (24, 25). Of interest, serum BAFF levels are elevated in autoimmune patients and some patients with mature B cell malignancies, which correlates with elevated numbers of autoreactive and malignant B cells observed in these patients (26, 27, 28). Moreover, readily detectable levels of serum BAFF, ranging from 5 to 10 ng/ml, are found in healthy individuals (27, 28). Despite the known relationship between BAFF levels and B cell numbers, the steady-state levels of BAFF receptor(s) occupancy required to maintain B cell homeostasis remain unknown. Using an indirect approach assessing BAFF-R occupancy, Carter et al. (29) recently provided the first evidence that normal human B cells display prebound BAFF and that this was elevated in B cells from patients with systemic lupus erythematosus. Their results provocatively suggested a correlation between receptor occupancy and disease activity. Their study highlights the lack of knowledge in this area regarding normal human B cells. Specifically, it is unclear whether human B cells require a certain level of BAFF receptor(s) occupancy to survive, become activated, or differentiate. Similarly, it is unclear whether all human B cell subsets exhibit a certain degree of baseline BBR occupancy.

Adding to this complexity, because BAFF null mice lack mature B cells, it has been difficult to address the influence that BAFF has at later stages of B cell development. However, recent studies have begun to demonstrate that BAFF can influence class switch recombination of naive murine and human B cells (30, 31) as well as enhance survival and effector functions of in vitro generated plasmablasts (32). Nevertheless, it is clear that additional investigation is needed to completely understand the impact BAFF has in later stages of B cell differentiation.

In this study, we find that soluble BAFF is on the surface of naive and memory human B cells at isolation, whereas prebound BAFF is strikingly absent on freshly isolated germinal center (GC) B cells. Moreover, in agreement with our GC B cell observations, we found that B cell activation, even in the absence of proliferation, resulted in the gradual loss of prebound BAFF, yet the ability to bind exogenous BAFF was not compromised. Furthermore, we report that although BAFF enhances the differentiation of MB cells into ISCs activated in a T cell-dependent (TD) manner, we unexpectedly discovered that BAFF attenuates differentiation of MB into ISCs when activated through a T cell-independent (TI) response. Thus, for the first time, we provide evidence demonstrating that BAFF has opposite effects on B cell differentiation depending on the mode of B cell activation, further highlighting the complexity of this cytokine.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cells

Mononuclear cells from peripheral blood (PB) of normal donors or tonsil tissue from routine tonsillectomies were separated by Ficoll-Hypaque density-gradient centrifugation. Individuals provided written informed consent in accordance with the Declaration of Helsinki. The Mayo Clinic Rochester institutional review board approved the protocol to obtain blood or tonsil tissue from volunteers. B lymphocytes were enriched to >98% purity by magnetic cell separation using StemCell Technology B cell enrichment mixture/colloid and the negative selection program on the Robosep Separator (StemCell Technologies). GC B cells or PB B cell subsets were stained with Abs against CD38 and/or CD27 and sorted using a FACSVantage sorter (BD Immunocytometry Systems).

Flow cytometry

Purified B cells were stained using standard flow cytometry methodology. Briefly, cells were incubated on ice for 20 min with primary Ab, before washing twice with cold FACS buffer (Dulbecco’s PBS (DPBS) containing 2 mM EDTA, 0.05% sodium azide, and 2% FCS) and subsequent incubation with various secondary reagents. After washing, cells were fixed with 1% paraformaldehyde before analysis using a FACSCalibur flow cytometer (BD Pharmingen) and FlowJo analytical software (Tree Star). CD27 and CD38 Abs were purchased from BD Pharmingen; anti-BAFF-biotinylated polyclonal Abs were purchased from Antigenix America; and an unconjugated anti-BAFF mAb specific for detecting transmembrane BAFF (Buffy-1) was purchased from Alexis Biochemicals. PE-conjugated mAbs against BAFF-R along with isotype control Abs were purchased from eBioscience; and biotinylated polyclonal anti-TACI and anti-BCMA Abs were purchased from R&D Systems along with goat biotinylated IgG control. PE- or allophycocyanin-labeled streptavidin (Caltag Laboratories/Invitrogen Life Technologies) and PE-conjugated rabbit anti-mouse Abs (BioSource International) were used as secondary reagents. To evaluate exogenous BAFF binding, cells were incubated on ice for 30 min with 0.5 µg of human rBAFF (rhBAFF; R&D Systems) or a long form of rhBAFF (Alexis Biochemicals; containing an intact stalk region, wherever specified) before washing two times, and then stained using anti-BAFF-specific or isotype control Abs. Cell turnover was determined using CFSE (Molecular Probes/Invitrogen Life Technologies) intercalating dye. Cells were suspended in 0.1% FCS/DPBS at a density of 20 x 106 cells/ml and labeled with 1.5 µM CFSE for 8 min at room temperature. Labeling was halted by adding prewarmed FCS, and then incubating at 37°C for 10 min to efflux excess CFSE. Cells were washed three times with 2% FCS/DPBS and cultured in the presence or absence or mitogen.

RT-PCR

The TRIzol reagent (Invitrogen Life Technologies) was used to isolate total RNA from purified PB B cells and tonsillar B cell subsets. RNA was converted into cDNA using the First-Strand cDNA Synthesis Kit (Amersham Biosciences), according to the manufacturer’s instructions. BAFF and beta-actin cDNAs were detected by PCR amplification with HotStarTaq (Qiagen) in steps of 1 min each at 94°C, 60°C, and 72°C for 35 cycles, using primers previously described as being specific for BAFF (7) (5'-GGA GAA GGC AAC TCC AGT CAG AAC and 3'-CAA TTC ATC CCC AAA GAC ATG GAC). The following primers were designed using the published cDNA nucleotide sequences for beta-actin: 5'-GGA TCC GAC TTC GAG CAA GAG ATG GCC AC and 3'-CAA TGC CAG GGT ACA TGG TG.

Stripping of soluble BAFF

Purified PB B cells were cultured in polypropylene round-bottom tubes (BD Discovery Labware) at a concentration of 10 x 106 cells/ml for 2 h at 37°C in complete medium (RPMI 1640 with 10% FCS, L-glutamine, penicillin, and streptomycin) in the presence or absence of 10 µg/ml human BLyS receptor 3 (rhBR3; Antigenix America) or human rBCMA (rhBCMA; Antigenix America). After the incubation, cells were washed twice with FACS buffer and then stained using anti-BAFF polyclonal Abs, as described above.

Polyclonal activation of PB B cells

PB B cells were activated with the following polyclonal stimuli: anti-Ig/CD40L/cytokines (anti-Ig/40L/c) (2 µg/ml agonistic anti-IgA, IgG, IgM F(ab')2 Abs) (Jackson ImmunoResearch Laboratories) in the presence of IL-2 (100 U/ml; Fitzgerald Industries International), IL-4 (50 ng/ml; PeproTech), IL-10 (50 ng/ml; PeproTech), and soluble human rCD40L/TNF-related activation protein (0.5 µg/ml; Fitzgerald Industries International); CpG/cytokines (CpG/c) (oligodeoxynucleotide 2006 5'-TC GTCGTTTTGTCGTTTTGTCGTT, synthesized by in-house core facility) with IL-2 (100 U/ml) and IL-15 (10 ng/ml; PeproTech); CD40L/cytokines (40L/c) (0.5 µg/ml soluble human rCD40L/TNF-related activation protein plus IL-2 (100 U/ml) and IL-10 (50 ng/ml)). B cells were cultured at 37°C in a 5% CO2 incubator for the indicated lengths of time in polypropylene round-bottom tubes in the presence or absence of the above stimuli at a concentration of 1 x 106 cells/ml complete medium. When specified, IL-4 (50 ng/ml; PeproTech) was used to improve cell viability of unactivated B cells in long-term culture experiments.

Cell cycle analysis

PB B cells were cultured in polypropylene round-bottom tubes in the presence or absence of stimulus for the indicated lengths of time, as described above. On day of analysis, cells were pulsed with 10 µM BrdU for 2 h before harvest. BrdU incorporation was determined according to the protocol described for BrdU flow kits (BD Pharmingen). BrdU incorporation was analyzed using a FACSCalibur flow cytometer (BD Pharmingen).

Cell viability

B cells were washed once with DPBS, resuspended in a 100-µl vol of cold annexin-binding buffer, and stained with annexin V-FITC (Caltag Laboratories/Invitrogen Life Technologies) on ice for 20 min. Cells were washed once with annexin-binding buffer, and then 0.5 µg/ml propidium iodide (PI) was added right before flow cytometric analysis. Cell number and viability were also corroborated through whole cell counts of cells stained with trypan blue exclusion dye.

Western blot analysis

Cells were lysed using radioimmunoprecipitation assay lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 15 mM sodium molybdate, and 1 mM NaF) supplemented with protease inhibitors (10 µg/ml leupeptin, 10 µg/ml aprotinin, 10 µg/ml pepstatin, 2 mM Na3VO4, and 1 mM PMSF). Lysates were cleared of insoluble material by centrifugation for 10 min at 15,000 x g. Lysates (10 µg/lane) were resolved by SDS-PAGE and transferred to Immobilon-P membranes (Millipore) for immunoblotting. Membranes were blocked in StartingBlock TBS blocking buffer (Pierce Biotechnology) supplemented with 0.2% Tween 20. Membranes were blotted overnight with 0.2 µg/ml biotinylated anti-BAFF polyclonal Abs, followed by incubation with a 1/1000 dilution of avidin-HRP (eBioscience). Immunoreactive proteins were detected using an ECL detection system (SuperSignal; Pierce) and autoradiography. Recombinant soluble BAFF (R&D Systems) and lysates obtained from 293T cells transfected with a human full-length BAFF cDNA construct (provided by R. Bram, Mayo Clinic, Rochester, MN) were used as positive controls. The 293T cell lysates used in these studies were significantly diluted because of the high levels of BAFF expression achieved. As a consequence, beta-actin levels are significantly reduced and cannot be visualized on the blots.

Analysis of Ig secretion

Ig secretion was measured using a standard Ig H chain-specific ELISA. Briefly, 96-well microtiter plates (Nalge Nunc International) were independently coated with anti-IgA, anti-IgG, and anti-IgM Abs (BioSource International). Plates were then blocked with 1x casein (BioFX Laboratories). After several washes, culture supernatants were added to coated plates and incubated for 2 h. Igs were detected colorimetrically using anti-IgA, anti-IgG, and anti-IgM HRP-labeled Abs (BioSource International) and a Molecular Devices microplate reader. Standard curves were generated to quantitate ELISA results using known amounts of purified human IgA, IgG, and IgM Abs (Jackson ImmunoResearch Laboratories). The detection limit of the assays was 1 µg/ml-0.1 ng/ml for IgG and IgM and 2 µg/ml-0.1 ng/ml for IgA. The o-phenylenediamine dihydrochloride ELISA substrate for HRP along with stable peroxide substrate buffer were purchased from Pierce.

Detection of cytoplasmic Ig (cIg)

Activated B cells were mounted on glass slides via centrifugation using a Thermo Shandon cytospin 2. Briefly, cells were fixed using 95% ethanol for 5 min, washed with 1x PBS/0.1% Tween 80 for 1 min, and then stained with 1 µg/ml polyclonal FITC-conjugated F(ab')2 anti-human IgA, IgG, and IgM Ab (BioSource International). The cells were then washed and viewed using an Olympus AX 70 fluorescence microscope (Olympus America). Analysis of cIg-positive cells was also determined using flow cytometry following intracellular labeling, according to the instructions provided with the Fix and Perm cell permeabilization kit from Caltag Laboratories/Invitrogen Life Technologies.

Statistical analysis

Statistical analysis was performed using Student’s t test. Values of p < 0.05 were considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Soluble BAFF is constitutively bound to resting PB B cells

Evidence that BAFF is readily detectable in the serum of healthy individuals (27, 28) prompted us to determine whether BBRs on normal PB B cells were occupied at time of cell isolation. We began these studies by using an anti-BAFF-specific polyclonal Ab and assessing which cells exhibit surface BAFF detection in total PBMC. As shown in Fig. 1A, CD19-positive B cells were the only cells that reacted with the anti-BAFF Ab. Furthermore, purified PB B cells obtained from several healthy individuals were all uniformly and significantly reactive with the anti-BAFF Ab (Fig. 1B). However, the absolute levels of surface BAFF did vary between individuals, suggestive of potential variation in the levels of serum BAFF that can be found within healthy individuals. Moreover, analysis of blood naive (CD27) and MB (CD27+) cells revealed that both of these populations have similar detection levels of surface BAFF (Fig. 1C).


Figure 1
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 1. Detectable levels of prebound BAFF on the surface of resting blood B cells. A, PBMC were stained with Abs against BAFF and CD19. B, Freshly isolated PB B cells from several donors were stained with polyclonal anti-BAFF Abs. Numbers represent the {delta} median fluorescence intensity (MFI) measured by dividing the MFI of the anti-BAFF Ab by the MFI of control Ab. Ig control Ab (shaded histogram); Ag-specific Ab (solid line histogram). C, Prebound BAFF on PB naive CD27 (solid lined histogram) and memory CD27+ (dotted histogram) B cells. D, Lysates from freshly isolated B cells were assessed by Western blot using an anti-BAFF Ab. E, Expression of BAFF and beta-actin mRNA levels in PB B cells isolated from different healthy donors. sB, Human soluble rBAFF. FL-B, Full-length BAFF. Abs against beta-actin were used to demonstrate equal loading of B cell lysates.

 
Because B cell reactivity with the anti-BAFF Ab at isolation could be a reflection of processed soluble ligand occupying BBRs or of intrinsic B cell expression of transmembrane BAFF, we used a Western blot approach to discriminate between these possibilities. As controls, we ran soluble rBAFF or whole cell lysates from 293T cells that were transiently transfected with a BAFF construct. As shown in Fig. 1D, the Ab used for flow cytometry also worked in Western blot analyses, and it was capable of recognizing both the full-length as well as the soluble forms of BAFF. Analysis of B cell lysates obtained from five healthy individuals revealed a prominent 17-kDa band, suggesting that the majority of the anti-BAFF reactivity reflects binding of the processed, soluble form of BAFF rather than expression of endogenous full-length BAFF. However, we still observed trace levels of a 32-kDa band, a size that is consistent with full-length BAFF. To pursue this observation, we next used RT-PCR to first assess BAFF expression at the mRNA level, and consistent with earlier reports (10, 11, 12), we observed variable expression of BAFF mRNA in human PB B cells (Fig. 1E).

Anti-BAFF reactivity of PB B cells primarily reflects bound soluble BAFF

Because PB B cells expressed BAFF mRNA and there was evidence of trace levels of full-length BAFF protein in B cell lysates, we next wished to determine whether the anti-BAFF reactivity of B cells, revealed by flow cytometry, primarily reflected prebound soluble BAFF or cell surface transmembrane BAFF expression. To accomplish this, we used Abs specific for the stalk region of BAFF, which is intact in the BAFF transmembrane glycoprotein. The efficacy of the Ab was first assessed by staining 293T cells transiently transfected with either a control vector (mock) or a full-length BAFF cDNA construct. Fig. 2A demonstrates that the Ab recognizes 293T cells transfected with the BAFF construct, but not the empty vector. We then used this Ab to stain freshly isolated PB B cells and found there was no reactivity with this Ab (Fig. 2B). However, reactivity was observed when B cells were previously incubated with a human rBAFF containing an intact stalk region, thus further demonstrating the specificity of this Ab and underscoring the observation that transmembrane BAFF levels are undetectable in PB B lymphocytes (Fig. 2C).


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 2. Assessment of PB B cell expression of the transmembrane form of BAFF. A, 293T cells were transiently transfected with empty vector (Mock) or a vector containing a full-length human BAFF cDNA. Surface BAFF expression was assessed 24 h posttransfection using the anti-BAFF Buffy-1 Ab. Expression of transmembrane BAFF using Buffy-1 Ab on PB B cells in the absence (B) or presence (C) of the long form of rhBAFF containing the stalk domain (Alexis). D and E, Specificity of anti-BAFF polyclonal Ab. PB B cells were incubated for 2 h at 37°C in medium alone or medium containing rhBCMA or rhBR3 before determining BAFF levels using flow cytometry (D) and Western blot (E) methods.

 
Because B cells lacked reactivity with an Ab specific for the stalk region of BAFF, it remained possible that the polyclonal anti-BAFF Ab, used in the experiments shown in Fig. 1, lacked specificity. To address this possibility, we used a soluble decoy receptor approach and next preincubated B cells with rhBAFF-R (rhBR3) before assessing reactivity with the polyclonal anti-BAFF Ab. As shown in Fig. 2D, preincubation of B cells with rhBR3 significantly attenuated the levels of surface BAFF, whereas incubation with rhBCMA did not. The latter observation was expected because we anticipated that rhBCMA would not disrupt BAFF binding because it has a lower affinity to BAFF in comparison with BAFF-R (33, 34). Because it was possible that the rhBR3 was simply masking the epitope(s) recognized by the anti-BAFF Ab, we verified by Western blot that the rhBR3 significantly reduced the levels of 17-kDa soluble BAFF, but not the band corresponding to full-length BAFF (~32 kDa). Furthermore, the levels of soluble BAFF were not compromised in the rhBCMA-treated cells (Fig. 2E). In results not shown, extended incubation with rhBR3 (20–24 h) resulted in a complete loss of soluble BAFF as revealed by flow cytometry and Western blot. Taken together, these data demonstrate that freshly isolated PB B cells do not have detectable levels of transmembrane BAFF, but instead display significant levels of prebound BAFF on their cell surface.

GC B cells lack baseline surface BAFF binding

Because for the most part B cells in blood comprise both resting naive and MB cells, we wanted to determine whether BAFF receptors were also occupied in an activated B cell population. Therefore, we next analyzed tonsillar tissue, which is a source of activated GC B cells in addition to naive and MB cells. We found that tonsillar naive and MB cells have uniform levels of prebound BAFF (Fig. 3A), albeit generally at a lower level than that observed in PB B cells. Interestingly, in contrast to tonsillar naive and MB cells, we were unable to detect BAFF on the surface of GC B cells (Fig. 3A). These results were further confirmed by Western blot analysis (Fig. 3B). Moreover, we found that both populations of CD38low and CD38high B cells expressed trace levels of full-length BAFF. Therefore, as previously evaluated in blood B cells, we looked for BAFF mRNA levels in both populations. We demonstrate that CD38low and CD38high B cells express BAFF mRNA, yet lower expression levels of BAFF mRNA were observed in CD38high GC B cells (Fig. 3C). In addition, similar to blood B cells, we found no detectable levels of transmembrane BAFF in either population when using flow cytometry and the Ab specific for the stalk region of BAFF (data not shown).


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
FIGURE 3. Activated GC B cells lack prebound BAFF, but can bind exogenous BAFF. A, Naive, memory, and GC B cells from tonsil were identified using CD27 and CD38 Abs, and each population was evaluated for surface BAFF levels. In addition, CD38high B cells also expressed CD77, a marker of GC B cells (data not shown). B, Whole cell lysates from tonsillar B cells further sorted into 38high (GC) and 38low (naive and MB) populations were run on an SDS-PAGE gel and blotted with anti-BAFF Abs. sB, Human soluble rBAFF. FL-B, Full-length BAFF. C, Expression of BAFF and beta-actin mRNA in 38low and 38high populations from three different tonsil preparations. D, Expression of BAFF-R, TACI, and BCMA on tonsillar naive (solid lined histogram) and memory (dotted histogram), or E, GC B cells. F, Levels of BAFF binding on tonsillar CD38high GC B cells. Tonsillar B cells were cultured with or without saturating amounts of rhBAFF and stained with anti-BAFF Abs, and data are shown only for CD38high GC B cells. Ig control Ab (shaded histogram); baseline BAFF (dotted line histogram); exogenous BAFF (solid line histogram). Data are representative of three independent experiments.

 
Although GC B cells clearly did not express detectable levels of prebound BAFF, we next wanted to address whether this observation reflected the inability of GC B cells to bind BAFF, i.e., BBRs may be down-regulated in this population of B cells. Although BBR expression of GC B cells has been documented previously by several groups (22, 35, 36), it was important to test this possibility in the context of our studies. As shown in Fig. 3D, both naive and MB tonsillar cells uniformly expressed BAFF-R (Fig. 3D). MB cells, but not naive B cells, uniformly expressed TACI and low levels of BCMA. Analysis of BBRs on GC B cells revealed a uniform expression of BAFF-R and to a lesser degree BCMA. This population also expresses low levels of surface TACI (Fig. 3E). We next assessed whether GC B cells could bind exogenous BAFF. As may be seen in Fig. 3F, although BAFF receptors are unoccupied on GC B cells, they are quite capable of binding rhBAFF (Fig. 3F). The fact that GC B cells can bind soluble BAFF, yet they lack baseline prebound BAFF upon isolation, suggests that GCs may contain low levels or completely lack soluble BAFF. This observation is complemented by a recent report showing that BAFF is abundantly expressed in the extrafollicular area and to a lesser extent in GC structures (35).

Surface-bound BAFF is lost upon B cell activation

Although it is possible that BAFF levels are naturally low or absent in GCs, our data also do not dismiss the possibility that GC B cells, which are actively proliferating, may lose prebound BAFF due to high cell turnover or perhaps by endocytosing and degrading prebound BAFF. To address this latter possibility, we next monitored the levels of BAFF in PB B cells following in vitro activation in an effort to mimic activation that may precede or coincide with GC reactions. We chose to activate PB B cells with two different activation schemes that were designed to mimic TD or a form of TI B cell activation, as follows: anti-human Ig Abs in combination with CD40L plus IL-2, IL-4, and IL-10 (TD; anti-Ig/40L/c); or CpG plus IL-2 and IL-15 (TI-type 1 Ag; CpG/c), respectively. In addition, we also evaluated the prebound BAFF levels of resting B cells at various time points to control for gradual loss of BAFF during long incubation times. However, because the viability of resting B cells in medium alone is compromised during long incubation periods, we also cultured B cells in IL-4-supplemented medium, which improves B cell viability considerably compared with medium alone (Fig. 4A). In comparing the levels of prebound BAFF between freshly isolated and IL-4-resting B cells, we found no significant difference between the two populations (Fig. 4, B and C). Of interest, even after 120 h in culture, IL-4-treated B cells still possessed detectable levels of prebound BAFF (Fig. 4C). In contrast, B cells stimulated with either activation scheme lost detectable levels of prebound BAFF (Fig. 4C). Moreover, our Western blot data corroborate our flow data showing a complete loss of the 17-kDa BAFF band upon B cell activation (Fig. 4D). Interestingly, we found that loss of prebound BAFF is not coupled with cell division, because not all of the B cells divided at 120 h, yet all of them lost BAFF from their surface (Fig. 4E).


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 4. Prebound BAFF is lost upon B cell activation. A, Viability of cells cultured in medium alone or with IL-4 at 120 h. B, Prebound BAFF on freshly isolated B cells. C, Surface BAFF levels of resting (IL-4) or activated PB B cells determined at 24 and 120 h. D, BAFF protein levels of freshly isolated B cells (F), or B cells activated for 120 h with anti-Ig/40L/c ({alpha}Ig) or CpG/c (C). sB, Soluble rBAFF. FL-B, Full-length BAFF. E, CFSE dilution of activated B cells at 120 h. Data are representative of five independent experiments.

 
Loss of soluble BAFF upon activation is not due to an inability to bind BAFF, but instead reflects an effect of limited amounts of BAFF in the microenvironment

We next determined whether the loss of baseline BAFF receptor occupancy in activated B cells reflected loss in ability to bind BAFF. As shown in Fig. 5A, similar to GC B cells, activated PB B cells can bind exogenous BAFF despite complete loss of prebound BAFF following polyclonal activation. Because activated B cells can bind exogenous BAFF, this implies that activation may result in the release or internalization and intracellular degradation of bound BAFF. However, we were unable to detect release of prebound BAFF into the medium postactivation by ELISA (data not shown), thereby favoring the latter possibility.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 5. Exogenous BAFF binds to activated B cells. A, Activated B cells were treated as in Fig. 2D. Ig control Ab (shaded histogram); baseline BAFF (dotted line histogram); exogenous BAFF (solid line histogram). B, PB B cells were activated for 120 h in the presence or absence of exogenous BAFF. At 120 h, surface BAFF levels were assessed. Data are representative of five independent experiments.

 
In addition, we next assessed surface BAFF levels when B cells were activated in a BAFF-rich environment. In fact, we found that when B cells are activated in a BAFF-rich environment, they maintain high levels of BAFF on their cell surface (Fig. 5B). These data collectively suggest that lack of surface BAFF on GC B cells most likely reflects a combination of two events: 1) internalization and degradation of prebound BAFF upon activation and entry into the GC; and 2) entry of activated B cells into a microenvironment that has very limiting levels of soluble BAFF.

Differential effects of BAFF on ISC formation are observed during TD or TI activation of PB B cells

To date, our data show that prebound BAFF is lost upon activation, and accessibility to soluble BAFF may be low in GCs, evidenced by a lack of prebound BAFF on GC B cells. Both of these observations suggest a specific role for BAFF in normal human B cell differentiation and further suggest the hypothesis that BAFF may be playing a rate-limiting step in this process. To address this, we next studied the role of BAFF in the activation, survival, and differentiation of PB B cells, which were activated in a TD manner, mimicking a GC response, as well as a TI manner occurring outside GCs. Thus, the activation schemes used in these studies were human rCD40L plus IL-2 and IL-10 (40L/c), or CpG/c, which have been shown to efficiently promote generation of ISCs (37, 38, 39, 40). Of note, activation with 40L/c also results in loss of prebound BAFF (data not shown). We found that BAFF promotes B cell proliferation of 40L/c-activated B cells, but it does not significantly affect their viability (Fig. 6, A and B). Moreover, despite reports demonstrating that constant activation through CD40 attenuates Ig secretion (41, 42), we were still able to detect considerable levels of Ig without removing CD40L from the culture medium. In addition, we show that BAFF significantly increased the Ig secretion of 40L/c-activated B cells (Fig. 6C) by an average of a 6-fold increase in IgA secretion (n = 4, p = 0.007), a 2-fold increase in IgG (n = 4, p = 0.009), and a 3-fold increase in IgM (n = 4, p = 0.02).


Figure 6
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 6. BAFF affects the proliferation and differentiation of PB B cells activated in a T cell-dependent manner. The 40L/c-activated PB B cells were cultured in the presence or absence of BAFF for 120 h. A, B cell viability was analyzed using annexin/PI staining. B, BrdU incorporation was used to determine cell cycle progression. C, B cells were activated with 40L/c for 120 h plus or minus BAFF. Supernatants were collected and Ig secretion was measured using an ELISA. The 40L/c alone ({blacksquare}) and 40L/c plus BAFF ({square}). Data are representative of three or more experiments.

 
The effect of BAFF during TI B cell responses is shown in Fig. 7A. We found that exogenous BAFF modestly promoted the survival of CpG/c-activated B cells. In addition, we observed an increase in the number of cells progressing through the cell cycle when BAFF was present in the culture, thus verifying its costimulatory properties when combined with CpG/c activation (Fig. 7B). Unexpectedly, BAFF considerably decreased the Ig secretion of CpG/c-activated B cells (Fig. 7C). Thus, BAFF decreased IgA secretion by an average of 57% (n = 5, p = 0.004), IgG by 54% (n = 5, p = 0.01), and IgM by 43% (n = 5, p = 0.01).


Figure 7
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 7. BAFF decreases Ig secretion of CpG/c-activated PB B cells. B cells were activated for 120 h with CpG/c in the presence or absence of BAFF. A, B cell viability was analyzed using annexin/PI staining. B, BrdU incorporation was used to determine cell cycle progression. C, Supernatants were collected and Ig secretion was measured using an ELISA. CpG/c alone ({blacksquare}) and CpG/c plus BAFF ({square}). Data are representative of five experiments.

 
Furthermore, we wanted to determine whether BAFF would have a similar inhibitory affect upon activation with other known TI stimuli. Therefore, we activated PB B cells with formalin-fixed Staphylococcus aureus Cowan A plus IL-2 (SA/c), which is considered a TI-type 2 Ag, in the presence or absence of BAFF. As previously reported by numerous groups (4, 25, 43, 44), BAFF enhanced the proliferation and viability of SA/c-activated B cells (data not shown). Furthermore, in support of previous observations (4, 44), we also found that BAFF augmented Ig secretion of SA/c-activated B cells (data not shown).

BAFF attenuates MB cell ISC differentiation induced by CpG/c activation

Although secreted Ig levels were significantly reduced in response to CpG/c activation in the presence of BAFF, we wanted to determine whether BAFF suppressed Ig secretion or ISC differentiation. Thus, we primarily looked at the number of cells that were positive for cIg in response to CpG/c in the presence or absence of BAFF. BAFF did not decrease Ig secretion per cell, but instead appears to inhibit B cell differentiation into ISCs because the number of cIg-positive B cells decreased by 50% when B cells were activated with CpG/c in the presence of BAFF (Fig. 8, A and B). To determine the phenotype of the BAFF-regulated B cell, we decided to activate naive and MB cells independently with CpG/c in the presence or absence of BAFF. In addition, we subfractionated MB cells based on their CD38 expression, because it was reported previously that expression of CD38 correlates with ISC differentiation and an enhanced sensitivity to BAFF stimulation (32, 45). We found that although naive B cells respond to CpG/c activation by proliferating (data not shown), these cells do not yield detectable levels of secreted Ig (Fig. 8C), consistent with data from a previous report (40). In contrast, MB cells secreted high levels of all three Ig subclasses, regardless of their CD38 status and BAFF-attenuated Ig secretion in both populations (Fig. 8C).


Figure 8
View larger version (50K):
[in this window]
[in a new window]

 
FIGURE 8. BAFF attenuates MB cell differentiation into ISCs. PB B cells were activated for 120 h with CpG/c in the presence or absence of BAFF. A, cIg staining of CpG/c-activated B cells ± BAFF. The 4',6'-diamidino-2-phenylindole staining was used to stain nuclei. B, Flow cytometric analysis of cIg expression in activated B cells. C, Ig secretion by naive (CD27) and MB cell subsets (CD27+CD38 and CD27+CD38+) activated with CpG/c ({blacksquare}) or CpG/c plus BAFF ({square}). Data are representative of three independent observations.

 
In addition to cIg expression, we looked for increased expression of CD27 along with up-regulation of BCMA, two markers that are induced upon ISC differentiation of MB cells (32, 45). As shown in Fig. 9A, activation of B cells with 40L/c or CpG/c resulted in the appearance of MB cells exhibiting increased expression of CD27. Moreover, addition of BAFF to 40L/c-activated B cells resulted in an even further increase in the percentage of cells expressing high density surface CD27 (Fig. 9A). In contrast, we observed that BAFF decreased the percentage of CD27high MB cells by 50%, a percentage of inhibition that is similar in magnitude to BAFF-mediated inhibition of cIg-positive cells generated in response to CpG/c (Figs. 8 and 9A). In addition to increased CD27 expression, we observed that both activation schemes induced BCMA expression on MB cells. Moreover, as observed with CD27 expression, BAFF increased the number of BCMA-positive cells in response to TD activation, but decreased the number of BCMA-positive cells upon CpG/c activation (Fig. 9B).


Figure 9
View larger version (49K):
[in this window]
[in a new window]

 
FIGURE 9. BAFF suppresses increased expression of CD27 and up-regulation of BCMA in CpG/c-activated B cells. Levels of CD27 (A) or BCMA (B) were assessed after PB B cells were activated with CpG/c with or without BAFF for 120 h. Data are representative of three experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The effects of BAFF on the development and homeostasis of mature B cells are relatively well understood in the murine system. By contrast, our understanding of the effects of BAFF on human B cells, particularly ISC differentiation, is quite limited. In this study, we describe two significant findings and present data that conceptually link the two major observations. First, we demonstrate that soluble BAFF is prebound to the surface of naive and MB cells, yet absent from GC B cells, suggesting the possibility that these cells do not encounter or are restricted from constant BAFF exposure. Secondly, we reveal for the first time the divergent effects of BAFF on ISC differentiation of MB cells engaged in a TD vs a specific form of TI response. We find that although BAFF can enhance the generation of ISCs in combination with 40L/c stimulation, it markedly attenuates MB cell differentiation into ISCs during CpG/c activation. These results suggest that limited exposure to BAFF in GCs is required to preserve the balance between generation of MB cells vs ISCs. Conversely, accessibility to BAFF during CpG activation may control the number of MB cells that differentiate into ISCs. Taken together, our study introduces the concept that BAFF availability during B cell responses to diverse Ags plays a critical role during multiple maturation/differentiation phases of human B lineage cells.

Studies in mice have shown that mature B cells require ongoing exposure to BAFF to maintain their position in the mature B cell pool. However, it remains uncertain whether mature B cells, exposed to Ag in secondary lymphoid organs, require BAFF to survive or differentiate. Several reports have shown that BAFF can participate in later stages of B cell maturation, by promoting class switch recombination (30, 31), or inducing Ig secretion of plasmablasts (30, 32). Although BAFF was shown to influence these maturation and differentiation events, these studies do not demonstrate that BAFF is required. In this study, we have evidence to suggest that BAFF may not be involved in B cell differentiation events occurring in GCs. Our ex vivo analysis of prebound BAFF levels revealed that, unlike naive and MB cells, GC B cells were devoid of prebound BAFF. This is not due to a lack of BBRs, because we show that GC B cells express BAFF-R and BCMA, as previously demonstrated by others (22, 35, 36). Moreover, GC B cells and activated B cells maintain their ability to bind exogenous BAFF. Instead, our results demonstrating that PB B cells lose prebound BAFF following activation provide a plausible explanation for the lack of prebound BAFF in GC B cells. Of note, the activation-induced loss of prebound BAFF in PB B cells may instead result from a loss of BBR expression. However, we have evidence demonstrating that B cell activation induces the up-regulation of BBR expression, which would promote, not discourage, BAFF binding (J. R. Darce, B. K. Arendt, X. Wu, and D. F. Jelinek, manuscript in preparation). Because clearance of prebound BAFF may represent an important mechanism by which BAFF-mediated signaling in B cells is regulated in soluble BAFF-restricted environments, it will be important to determine the mechanism(s) by which this occurs, and studies of this nature are in progress. In support of our hypothesis, a recent report demonstrated that GC structures display low to no detectable levels of BAFF (35).

Although our data suggest that GCs lack soluble BAFF, we cannot exclude the possibility that transmembrane forms of BAFF may be expressed on cells found within these structures. There is a suggestion that GC-resident follicular dendritic cells (FDC) are a source of BAFF. However, currently the expression of BAFF by FDCs is controversial. One group discovered that a transmembrane form of BAFF is expressed by primary human FDCs as well as a human FDC cell line (46). Meanwhile, another group found that mouse FDCs are not a major source of BAFF (47). This discrepancy in BAFF expression could be explained by intrinsic differences between species. Of interest, GCs can form in the absence of BAFF, although the longevity and retention of GC structures are lost following initial formation (48).

Even though GC B cells lack prebound BAFF, naive and MB cells from PB and tonsil tissue have significant levels of this ligand on their cell surface. Moreover, PB B cells exhibited higher levels of prebound BAFF than tonsillar B cell populations. This was unexpected because we assumed that B cells would encounter higher levels of BAFF in peripheral organs. However, in consideration of our results, we hypothesize that the level of prebound BAFF is directly related to the availability of soluble BAFF. Chiu et al. (35) recently demonstrated that BAFF is abundantly found in the extrafollicular area, where naive and MB cells can reside (49). These data suggest that tonsillar naive and MB cells have accessibility to BAFF within these niches. Yet, in addition to B cells, other BAFF-binding cells can be found within this extrafollicular space, such as activated T cells and myeloid lineage cells (21, 22). Therefore, B cells trafficking through peripheral lymphoid tissue may encounter greater competition for soluble BAFF. In contrast, our analysis of whole PBMCs revealed that only B cells reacted with the anti-BAFF Ab, implying that B cells do not compete for BAFF with other cells in PB. Furthermore, soluble BAFF is readily available to PB B cells, because it has been estimated that BAFF levels in the serum of healthy individuals average between 5 and 10 ng/ml (27, 28). Finally, the precise source of the soluble BAFF bound to B cell BBRs remains to be determined. Indeed, it is quite possible that soluble BAFF may be derived from B cells themselves. Previous reports have demonstrated BAFF expression in human B lymphocytes at the mRNA and protein levels (10, 11, 12), and we corroborate the mRNA and protein data when assaying total cell lysates. However, our results extend these previous studies by demonstrating that normal human B cells lack detectable cell surface transmembrane BAFF expression. Because it is currently thought that soluble BAFF is only produced following extracellular proteolytic processing of transmembrane BAFF (13), we consider it unlikely that the prebound BAFF derives from B cells themselves. Alternatively, BAFF processing may uniquely occur intracellularly in B lineage cells. Presently, there are no data disputing this possibility, and moreover, the biological significance of B cell-derived BAFF remains unclear.

Our observations of prebound BAFF levels prompted us to determine the influence of BAFF during B cell activation. The lack of prebound BAFF on GC B cells indicated to us that BAFF is absent in GCs perhaps to prevent disruption of the differentiation program that occurs within these structures. This theory is plausible becaused loss of BAFF-mediated signaling in the GC would place greater emphasis on selection via the newly remodeled BCR, rather than promoting the survival of all BCR-stimulated B cells, possibly even those acquiring autoreactivity (50). Moreover, within GCs, centrocytes re-express CD40 and receive constant signals from this receptor, thus enhancing their viability and promoting their differentiation into MB cells (51, 52). As we demonstrated in our in vitro activation of PB B cells, BAFF enhanced CD40-induced B cell proliferation and ISC differentiation. Although previous reports suggest that ISC differentiation is compromised by constant signals through CD40 (41, 42), in this study we demonstrate that activation through CD40 alone drives B cell differentiation, evidenced by moderate levels of Ig secretion. Furthermore, unlike other studies that show the effects of BAFF on preactivated B cells post-CD40L stimulation (32), we reveal its effects during constant exposure to CD40L, because it may occur during a GC reaction. Therefore, because we find that BAFF enhances ISC differentiation in response to CD40L stimulation, we believe that access to BAFF in GCs may potentially derail the balance between ISC and MB cell generation.

Furthermore, we also evaluated the effects of BAFF during TI activation of B cells, which occurs outside of GCs, in BAFF-rich zones (35). TI responses are critical in initiating early immune responses to invading pathogens. Bacterial and viral products are examples of one type of TI stimuli that activate B cells through pattern recognition receptors, such as TLRs, resulting in the differentiation of short-lived and long-lived ISCs (53). CpG is recognized by the TLR9 on activated B cells and has been shown to significantly affect the survival of all B cells as well as induce the ISC differentiation of MB cells (40, 54, 55). Given that it has been suggested that autoreactive clones arise from MB cell subsets (56) and that TLR9 expression is elevated in MB cells from SLE patients with active disease (57), CpG stimulation is currently viewed as an important factor in autoimmunity. These observations collectively predict that BAFF would augment CpG-mediated activation and differentiation of B cells, especially because BAFF transgenic mice develop autoimmune disease. Indeed, we demonstrate that BAFF augments the survival and proliferation of CpG-activated B cells. However, in contrast, we found that BAFF significantly decreased CpG-mediated ISC differentiation revealed by marked decreases in IgA, IgG, and IgM secretion. As mentioned above, CpG activation has been shown to drive ISC differentiation of MB cells only (40). Our results are consistent with these reports, because activation of naive B cells did not yield detectable levels of secreted Ig. Furthermore, we demonstrate that reduced ISC generation is accompanied by a restriction of MB cell differentiation evidenced by a decrease in numbers of cIg-positive, CD27high, and BCMA-positive cells.

The inhibitory effects of BAFF on CpG-mediated ISC differentiation are quite interesting and suggest a new mechanism by which B cell responses to hypomethylated DNA, a highly potent B cell polyclonal activator, are regulated. However, although CpG is a TI B cell activator, not all TI Ags are subject to negative regulation by BAFF. For example, we found that BAFF enhanced the proliferation and Ig secretion of B cells activated with SA/c, an observation consistent with other published reports (data not shown) (4, 25, 43, 44). Moreover, BAFF was shown to enhance in vivo humoral immune responses in mice challenged with a TI polyvalent vaccine (58). The mechanism(s) by which BAFF differentially affects CpG or SA/c ISC differentiation remains to be determined and is a topic of current investigation. Because both of these stimuli assert their effects through different signal transduction pathways, it is possible that the BAFF signaling pathway could inhibit or synergize with TLR9 and BCR signals, respectively. Furthermore, a recent report investigating the signals that can negatively regulate CpG-stimulated generation of ISCs revealed that constant signaling through the BCR, via the ERK MAPK pathway, blocks CpG-induced ISC differentiation (59). It is therefore possible that a similar type of signal transduction antagonism is occurring between CpG and BBRs in MB cells. Regardless of mechanism, our studies demonstrate for the first time an inhibitory property of BAFF.

In contrast with our data demonstrating that BAFF negatively regulates ISC differentiation, He et al. (55) reported that BAFF in the presence of IL-10 augments CpG-induced IgG production by human IgD+IgM+ blood B cells. Although our CpG activation protocol included IL-2 and IL-15, we still observed BAFF-mediated suppression of B cell differentiation when cells were activated with CpG and IL-10 (results not shown). Other experimental differences that may explain the discrepant results include differences in CpG concentration and differences in cell isolation. With respect to the latter, He et al. (55) positively selected naive B cells using magnetic bead-conjugated Abs to IgD, a method that could have impacted subsequent responsiveness.

In summary, our results demonstrate that BAFF has pleiotropic effects on mature human B cells. Although BAFF may be required to establish and maintain a mature B cell pool, the need to limit BAFF signaling within GCs exists. In addition, BAFF could also play a critical role outside of GCs, and under some circumstances of B cell activation, may actually attenuate ISC differentiation. Finally, our data underscore the complex nature of this cytokine and its divergent influences on human B lymphocytes.


    Acknowledgment
 
We thank Dr. Xiaosheng Wu for his experimental advice as well as for critically reading this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant RO1 CA 105258 (awarded to D.F.J.) and Predoctoral Fellowship F31 AI 61838 (awarded to J.R.D.). Back

2 Address correspondence and reprint requests to Dr. Diane F. Jelinek, Mayo Clinic College of Medicine, 200 First Street Southwest, Rochester, MN 55905. E-mail address: jelinek.diane{at}mayo.edu Back

3 Abbreviations used in this paper: MB, memory B; 40L/c, CD40L/cytokine; anti-Ig/40L/c, anti-Ig/CD40L/cytokine; BAFF, B cell-activating factor belonging to the TNF family; BBR, BAFF-binding receptor; BCMA, B cell maturation Ag; cIg, cytoplasmic Ig; CpG/c, CpG/cytokine; DPBS, Dulbecco’s PBS; FDC, follicular dendritic cell; GC, germinal center; ISC, Ig-secreting cell; MFI, median fluorescence intensity; PB, peripheral blood; PI, propidium iodide; rhBAFF, human rBAFF; rhBCMA, human rBCMA; rhBR3, human BLyS receptor 3; SA/c, Staphylococcus aureus Cowan A plus IL-2; TACI, transmembrane activator and calcium-modulating cyclophilin ligand interactor; TD, T cell dependent; TI, T cell independent. Back

Received for publication November 13, 2006. Accepted for publication February 20, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Locksley, R. M., N. Killeen, M. J. Lenardo. 2001. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104: 487-501. [Medline]
  2. Mackay, F., J. L. Browning. 2002. BAFF: a fundamental survival factor for B cells. Nat. Rev. Immunol. 2: 465-475. [Medline]
  3. Craxton, A., D. Magaletti, E. J. Ryan, E. A. Clark. 2003. Macrophage- and dendritic cell-dependent regulation of human B-cell proliferation requires the TNF family ligand BAFF. Blood 101: 4464-4471.
  4. Nardelli, B., O. Belvedere, V. Roschke, P. A. Moore, H. S. Olsen, T. S. Migone, S. Sosnovtseva, J. A. Carrell, P. Feng, J. G. Giri, D. M. Hilbert. 2001. Synthesis and release of B-lymphocyte stimulator from myeloid cells. Blood 97: 198-204.
  5. Mackay, F., H. Leung. 2006. The role of the BAFF/APRIL system on T cell function. Semin. Immunol. 18: 284-289. [Medline]
  6. Scapini, P., B. Nardelli, G. Nadali, F. Calzetti, G. Pizzolo, C. Montecucco, M. A. Cassatella. 2003. G-CSF-stimulated neutrophils are a prominent source of functional BLyS. J. Exp. Med. 197: 297-302. [Abstract/Free Full Text]
  7. Novak, A. J., R. J. Bram, N. E. Kay, D. F. Jelinek. 2002. Aberrant expression of B-lymphocyte stimulator by B chronic lymphocytic leukemia cells: a mechanism for survival. Blood 100: 2973-2979. [Abstract/Free Full Text]
  8. Novak, A. J., J. R. Darce, B. K. Arendt, B. Harder, K. Henderson, W. Kindsvogel, J. A. Gross, P. R. Greipp, D. F. Jelinek. 2004. Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood 103: 689-694. [Abstract/Free Full Text]
  9. Krumbholz, M., D. Theil, T. Derfuss, A. Rosenwald, F. Schrader, C. M. Monoranu, S. L. Kalled, D. M. Hess, B. Serafini, F. Aloisi, et al 2005. BAFF is produced by astrocytes and up-regulated in multiple sclerosis lesions and primary central nervous system lymphoma. J. Exp. Med. 201: 195-200. [Abstract/Free Full Text]
  10. He, B., N. Raab-Traub, P. Casali, A. Cerutti. 2003. EBV-encoded latent membrane protein 1 cooperates with BAFF/BLyS and APRIL to induce T cell-independent Ig heavy chain class switching. J. Immunol. 171: 5215-5224. [Abstract/Free Full Text]
  11. He, B., A. Chadburn, E. Jou, E. J. Schattner, D. M. Knowles, A. Cerutti. 2004. Lymphoma B cells evade apoptosis through the TNF family members BAFF/BLyS and APRIL. J. Immunol. 172: 3268-3279. [Abstract/Free Full Text]
  12. Kern, C., J. F. Cornuel, C. Billard, R. Tang, D. Rouillard, V. Stenou, T. Defrance, F. Ajchenbaum-Cymbalista, P. Y. Simonin, S. Feldblum, J. P. Kolb. 2004. Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL through an autocrine pathway. Blood 103: 679-688.
  13. Schneider, P., F. MacKay, V. Steiner, K. Hofmann, J. L. Bodmer, N. Holler, C. Ambrose, P. Lawton, S. Bixler, H. Acha-Orbea, et al 1999. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J. Exp. Med. 189: 1747-1756. [Abstract/Free Full Text]
  14. Thompson, J. S., S. A. Bixler, F. Qian, K. Vora, M. L. Scott, T. G. Cachero, C. Hession, P. Schneider, I. D. Sizing, C. Mullen, et al 2001. BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science 293: 2108-2111. [Abstract/Free Full Text]
  15. Gross, J. A., J. Johnston, S. Mudri, R. Enselman, S. R. Dillon, K. Madden, W. Xu, J. Parrish-Novak, D. Foster, C. Lofton-Day, et al 2000. TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 404: 995-999. [Medline]
  16. Xia, X. Z., J. Treanor, G. Senaldi, S. D. Khare, T. Boone, M. Kelley, L. E. Theill, A. Colombero, I. Solovyev, F. Lee, et al 2000. TACI is a TRAF-interacting receptor for TALL-1, a tumor necrosis factor family member involved in B cell regulation. J. Exp. Med. 192: 137-143. [Abstract/Free Full Text]
  17. Yan, M., S. A. Marsters, I. S. Grewal, H. Wang, A. Ashkenazi, V. M. Dixit. 2000. Identification of a receptor for BLyS demonstrates a crucial role in humoral immunity. Nat. Immunol. 1: 37-41. [Medline]
  18. Thompson, J. S., P. Schneider, S. L. Kalled, L. Wang, E. A. Lefevre, T. G. Cachero, F. MacKay, S. A. Bixler, M. Zafari, Z. Y. Liu, et al 2000. BAFF binds to the tumor necrosis factor receptor-like molecule B cell maturation antigen and is important for maintaining the peripheral B cell population. J. Exp. Med. 192: 129-135. [Abstract/Free Full Text]
  19. Schiemann, B., J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, M. L. Scott. 2001. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 293: 2111-2114. [Abstract/Free Full Text]
  20. Von Bulow, G. U., R. J. Bram. 1997. NF-AT activation induced by a CAML-interacting member of the tumor necrosis factor receptor superfamily. Science 278: 138-141. [Abstract/Free Full Text]
  21. Chang, S. K., B. K. Arendt, J. R. Darce, X. Wu, D. F. Jelinek. 2006. A role for BLyS in the activation of innate immune cells. Blood 108: 2687-2694. [Abstract/Free Full Text]
  22. Ng, L. G., A. P. Sutherland, R. Newton, F. Qian, T. G. Cachero, M. L. Scott, J. S. Thompson, J. Wheway, T. Chtanova, J. Groom, et al 2004. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells. J. Immunol. 173: 807-817. [Abstract/Free Full Text]
  23. Mackay, F., C. Ambrose. 2003. The TNF family members BAFF and APRIL: the growing complexity. Cytokine Growth Factor Rev. 14: 311-324. [Medline]
  24. Mackay, F., S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher, P. Schneider, J. Tschopp, J. L. Browning. 1999. Mice transgenic for BAFF develop lymphocytic disorders along with autoimmune manifestations. J. Exp. Med. 190: 1697-1710. [Abstract/Free Full Text]
  25. Khare, S. D., I. Sarosi, X. Z. Xia, S. McCabe, K. Miner, I. Solovyev, N. Hawkins, M. Kelley, D. Chang, G. Van, et al 2000. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice. Proc. Natl. Acad. Sci. USA 97: 3370-3375. [Abstract/Free Full Text]
  26. Stohl, W., S. Metyas, S. M. Tan, G. S. Cheema, B. Oamar, D. Xu, V. Roschke, Y. Wu, K. P. Baker, D. M. Hilbert. 2003. B lymphocyte stimulator overexpression in patients with systemic lupus erythematosus: longitudinal observations. Arthritis Rheum. 48: 3475-3486. [Medline]
  27. Novak, A. J., D. M. Grote, S. C. Ziesmer, M. P. Kline, M. K. Manske, S. Slager, T. E. Witzig, T. Shanafelt, T. G. Call, N. E. Kay, et al 2006. Elevated serum B-lymphocyte stimulator levels in patients with familial lymphoproliferative disorders. J. Clin. Oncol. 24: 983-987. [Abstract/Free Full Text]
  28. Groom, J., S. L. Kalled, A. H. Cutler, C. Olson, S. A. Woodcock, P. Schneider, J. Tschopp, T. G. Cachero, M. Batten, J. Wheway, et al 2002. Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjogren’s syndrome. J. Clin. Invest. 109: 59-68. [Medline]
  29. Carter, R. H., H. Zhao, X. Liu, M. Pelletier, W. Chatham, R. Kimberly, T. Zhou. 2005. Expression and occupancy of BAFF-R on B cells in systemic lupus erythematosus. Arthritis Rheum. 52: 3943-3954. [Medline]
  30. Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, A. Cerutti. 2002. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat. Immunol. 3: 822-829. [Medline]
  31. Castigli, E., S. A. Wilson, S. Scott, F. Dedeoglu, S. Xu, K. P. Lam, R. J. Bram, H. Jabara, R. S. Geha. 2005. TACI and BAFF-R mediate isotype switching in B cells. J. Exp. Med. 201: 35-39. [Abstract/Free Full Text]
  32. Avery, D. T., S. L. Kalled, J. I. Ellyard, C. Ambrose, S. A. Bixler, M. Thien, R. Brink, F. Mackay, P. D. Hodgkin, S. G. Tangye. 2003. BAFF selectively enhances the survival of plasmablasts generated from human memory B cells. J. Clin. Invest. 112: 286-297. [Medline]
  33. Day, E. S., T. G. Cachero, F. Qian, Y. Sun, D. Wen, M. Pelletier, Y. M. Hsu, A. Whitty. 2005. Selectivity of BAFF/BLyS and APRIL for binding to the TNF family receptors BAFFR/BR3 and BCMA. Biochemistry 44: 1919-1931. [Medline]
  34. Hymowitz, S. G., D. R. Patel, H. J. Wallweber, S. Runyon, M. Yan, J. Yin, S. K. Shriver, N. C. Gordon, B. Pan, N. J. Skelton, et al 2005. Structures of APRIL-receptor complexes: like BCMA, TACI employs only a single cysteine-rich domain for high affinity ligand binding. J. Biol. Chem. 280: 7218-7227. [Abstract/Free Full Text]
  35. Chiu, A., W. Xu, B. He, S. R. Dillon, J. A. Gross, E. Sievers, X. Qiao, P. Santini, E. Hyjek, J. W. Lee, et al 2006. Hodgkin lymphoma cells express TACI and BCMA receptors and generate survival and proliferation signals in response to BAFF and APRIL. Blood 109: 729-739. [Medline]
  36. Shulga-Morskaya, S., M. Dobles, M. E. Walsh, L. G. Ng, F. MacKay, S. P. Rao, S. L. Kalled, M. L. Scott. 2004. B cell-activating factor belonging to the TNF family acts through separate receptors to support B cell survival and T cell-independent antibody formation. J. Immunol. 173: 2331-2341. [Abstract/Free Full Text]
  37. Maliszewski, C. R., K. Grabstein, W. C. Fanslow, R. Armitage, M. K. Spriggs, T. A. Sato. 1993. Recombinant CD40 ligand stimulation of murine B cell growth and differentiation: cooperative effects of cytokines. Eur. J. Immunol. 23: 1044-1049. [Medline]
  38. Tangye, S. G., D. T. Avery, P. D. Hodgkin. 2003. A division-linked mechanism for the rapid generation of Ig-secreting cells from human memory B cells. J. Immunol. 170: 261-269. [Abstract/Free Full Text]
  39. Liang, H., Y. Nishioka, C. F. Reich, D. S. Pisetsky, P. E. Lipsky. 1996. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Invest. 98: 1119-1129. [Medline]
  40. Bernasconi, N. L., E. Traggiai, A. Lanzavecchia. 2002. Maintenance of serological memory by polyclonal activation of human memory B cells. Science 298: 2199-2202. [Abstract/Free Full Text]
  41. Arpin, C., J. Dechanet, C. Van Kooten, P. Merville, G. Grouard, F. Briere, J. Banchereau, Y. J. Liu. 1995. Generation of memory B cells and plasma cells in vitro. Science 268: 720-722. [Abstract/Free Full Text]
  42. Tarte, K., J. De Vos, T. Thykjaer, F. Zhan, G. Fiol, V. Costes, T. Reme, E. Legouffe, J. F. Rossi, J. Shaughnessy, Jr, et al 2002. Generation of polyclonal plasmablasts from peripheral blood B cells: a normal counterpart of malignant plasmablasts. Blood 100: 1113-1122.
  43. Moore, P. A., O. Belvedere, A. Orr, K. Pieri, D. W. LaFleur, P. Feng, D. Soppet, M. Charters, R. Gentz, D. Parmelee, et al 1999. BLyS: member of the tumor necrosis factor family and B lymphocyte stimulator. Science 285: 260-263. [Abstract/Free Full Text]
  44. Stewart, D. M., M. J. McAvoy, D. M. Hilbert, D. L. Nelson. 2003. B lymphocytes from individuals with common variable immunodeficiency respond to B lymphocyte stimulator (BLyS protein) in vitro. Clin. Immunol. 109: 137-143. [Medline]
  45. Avery, D. T., J. I. Ellyard, F. Mackay, L. M. Corcoran, P. D. Hodgkin, S. G. Tangye. 2005. Increased expression of CD27 on activated human memory B cells correlates with their commitment to the plasma cell lineage. J. Immunol. 174: 4034-4042. [Abstract/Free Full Text]
  46. Zhang, X., C. S. Park, S. O. Yoon, L. Li, Y. M. Hsu, C. Ambrose, Y. S. Choi. 2005. BAFF supports human B cell differentiation in the lymphoid follicles through distinct receptors. Int. Immunol. 17: 779-788. [Abstract/Free Full Text]
  47. Lesley, R., Y. Xu, S. L. Kalled, D. M. Hess, S. R. Schwab, H. B. Shu, J. G. Cyster. 2004. Reduced competitiveness of autoantigen-engaged B cells due to increased dependence on BAFF. Immunity 20: 441-453. [Medline]
  48. Rahman, Z. S., S. P. Rao, S. L. Kalled, T. Manser. 2003. Normal induction but attenuated progression of germinal center responses in BAFF and BAFF-R signaling-deficient mice. J. Exp. Med. 198: 1157-1169. [Abstract/Free Full Text]
  49. Liu, Y. J., S. Oldfield, I. C. MacLennan. 1988. Memory B cells in T cell-dependent antibody responses colonize the splenic marginal zones. Eur. J. Immunol. 18: 355-362. [Medline]
  50. Dorner, T., C. Heimbacher, N. L. Farner, P. E. Lipsky. 1999. Enhanced mutational activity of V{kappa} gene rearrangements in systemic lupus erythematosus. Clin. Immunol. 92: 188-196. [Medline]
  51. Casamayor-Palleja, M., J. Feuillard, J. Ball, M. Drew, I. C. MacLennan. 1996. Centrocytes rapidly adopt a memory B cell phenotype on co-culture with autologous germinal centre T cell-enriched preparations. Int. Immunol. 8: 737-744. [Abstract/Free Full Text]
  52. Tuscano, J. M., K. M. Druey, A. Riva, J. Pena, C. B. Thompson, J. H. Kehrl. 1996. Bcl-x rather than Bcl-2 mediates CD40-dependent centrocyte survival in the germinal center. Blood 88: 1359-1364. [Abstract/Free Full Text]
  53. Krieg, A. M.. 1996. An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J. Lab. Clin. Med. 128: 128-133. [Medline]
  54. Yi, A. K., M. Chang, D. W. Peckham, A. M. Krieg, R. F. Ashman. 1998. CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry. J. Immunol. 160: 5898-5906. [Abstract/Free Full Text]
  55. He, B., X. Qiao, A. Cerutti. 2004. CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10. J. Immunol. 173: 4479-4491. [Abstract/Free Full Text]
  56. Jonsson, R., K. A. Brokstad, P. E. Lipsky, M. Zouali. 2001. B-lymphocyte selection and autoimmunity. Trends Immunol. 22: 653-654. [Medline]
  57. Papadimitraki, E. D., C. Choulaki, E. Koutala, G. Bertsias, C. Tsatsanis, I. Gergianaki, A. Raptopoulou, H. D. Kritikos, C. Mamalaki, P. Sidiropoulos, D. T. Boumpas. 2006. Expansion of Toll-like receptor 9-expressing B cells in active systemic lupus erythematosus: implications for the induction and maintenance of the a