|
|
||||||||
CUTTING EDGE |


* Department of Immunology and
Department of Pediatrics, University of Washington School of Medicine, Seattle, WA 98195
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD8 T cells contribute to protective immunity to HSV infection. In biopsy specimens from humans with recurrent HSV infection, viral clearance is associated with a high concentration of local CD8 T cells with cytolytic activity against infected cells (6). In animal models, depletion of CD8 T cells impairs clearance of virus from the CNS, whereas TCR transgenic CD8 T cells specific for the immune-dominant H-2Kb-restricted peptide in HSV-1 glycoprotein B (gB3)498505 transferred into mice lacking other components of adaptive immunity results in viral clearance (7, 8). These studies demonstrate that HSV-specific CD8 T cells play a protective role in HSV infection.
Infection with the Gram-positive intracellular bacterium Listeria monocytogenes (Lm) is a well-characterized experimental model in which Lm-specific CD8 T cells can confer protective immunity to secondary Lm infection (9, 10). Moreover, recombinant Lm expressing defined Ags from other intracellular viral pathogens such as lymphocytic choriomeningitis virus, influenza, HIV, SIV, or feline immune deficiency virus primes CD8 T cells specific for these heterologous Ags that protect against subsequent viral challenge (11, 12, 13, 14, 15, 16, 17). Accordingly, in this study, we examined the ability of recombinant Lm expressing a single immune-dominant Ag from HSV-1 to prime HSV-specific CD8 T cells and confer protective immunity to HSV challenge.
| Materials and Methods |
|---|
|
|
|---|
Lm
actA strain DPL1942 and recombinant Lm secreting the OVA protein behind the Lm hly promoter (Lm-OVA) have been described previously (18, 19). Transformation of Lm was performed by penicillin treatment as described (20). For infections, Lm was grown and subcultured in brain-heart infusion medium containing chloramphenicol (20 µg/ml) to early log-phase (OD600 0.1), washed, and diluted in PBS to a final concentration of 1 x 106 CFUs per 200 µl and inoculated i.v. into mice.
Expression constructs
The DNA fragment encoding OVA, hemagglutinin (HA) tag, Lm hly promoter, and signal sequence was PCR amplified from Lm-OVA (19) using the following primers: 5'-tctagattaacatttgttaacgacgac-3' and 5'- ggatccttaaggggaaacacatctgcc-3', and cloned into the XbaI and BamH1 sites in the low copy vector pAM401 containing resistance to chloramphenicol (21) (Fig. 1A). Underlined DNA sequence indicate restriction enzyme sites. This construct was then cut with PstI and StuI, and ligated with the overlapping primer sets for pHSVgB (coding strand, 5'-accacctcctccatcgagttcgcccggctgcagtttacagg-3' and noncoding strand, 5'-cctgtaaactgcagccgggcgaactcgatggaggaggtggttgca-3') (Fig. 1A) and pCONTROL (coding strand, 5'- atgacagagcagcagtggaatttcgcgggtatcgaggccgcggcaagcgcaatccagggaaatgtagg-3' and noncoding strand, 5'-cctacatttccctggattgcgcttgccgcggcctcgatacccgcgaaattccactgctgctctgtcattgca-3'). The relevant portions of these constructs were verified by DNA sequencing.
|
Supernatant protein was prepared by filtering (0.2-µm syringe filter) Lm culture medium (brain-heart infusion) with bacteria in log-phase growth (24 h after 1/100 back-dilution of stationary phase cultures to OD600 0.40.6), trichloroacetic acid precipitation (10%), and separation by SDS gel electrophoresis. Proteins were transferred to nitrocellulose and probed with rabbit anti-HA (clone HA-11; Covance Research Products).
Herpes simplex virus
HSV-1 (KOS strain) viral stocks were prepared for hind footpad infection (2.5 x 106 PFU per footpad) following dermal abrasion, as described previously (22). After infection, mice were monitored twice daily for 14 days for HSV CNS disease manifested as ataxia and/or hind limb paralysis. Our previous studies have demonstrated that >80% of mice that develop these symptoms later succumb to infection, and accordingly paralyzed mice were euthanized in accordance with our Institutional Animal Care and Use Committee protocol. For determining tissue HSV titers, the hind footpads and spinal cord were harvested, snap frozen, homogenized, and titered on Vero cells (22).
Mice
Female C57BL/6 (H-2b) and IFN-
-deficient mice on the C57BL/6 background were purchased from The Jackson Laboratory. MyD88-deficient mice were a gift from Dr. S. Akira (Osaka University, Osaka, Japan) and were backcrossed onto the C57BL/6 background for at least 10 generations. All mice were maintained in the University of Washington specific pathogen-free facility. For gB peptide immunization, 100 µg of purified peptide in 100 µl of saline was mixed with 100 µl of alum (Imject Alum; Pierce) and inoculated i.p. All studies were approved by the University of Washington Institutional Animal Care and Use Committee.
Quantification of CD8 T cell response
HSV-1 gB498505-specific CD8 T cells were analyzed in peripheral blood by staining with H-2Kb dimer X loaded with gB498505 peptide according to the manufacturers instructions (BD Biosciences). For intracellular cytokine staining, single-cell suspensions of splenocytes or cells from the draining lymph nodes were incubated in the presence of the indicated peptides (106 M) and monensin (GolgiStop reagent; BD Biosciences) for 5 h, surface stained, permeabilized (Cytoperm solution; BD Biosciences), and stained for intracellular IFN-
.
Cytokine production
The concentration of IFN-
in splenocyte culture supernatants (5 x 106 cells/ml) was quantified 72 h after peptide stimulation by ELISA using reagents from R&D Systems.
Statistics
The differences in mean viral PFUs, the percentages and numbers of cells, and cytokine concentrations were determined using the Student t test. The difference in survival between groups of mice were determined using log-rank
2 test (Prism; GraphPad Software).
| Results |
|---|
|
|
|---|
To test the ability of recombinant Lm-expressing HSV Ag to trigger HSV-specific CD8 T cells, we engineered an expression construct (designated pHSVgB) containing the HSV-1 peptide gB498505 secreted as a HA-tagged recombinant protein expressed under the Lm hly promoter and signal sequence, within the Gram-positive bacterial vector pAM401 (21) (Fig. 1A). In a similar fashion, we inserted the coding sequence for a peptide Ag from an irrelevant pathogen (Mycobacterium tuberculosis) into the same Lm expression construct that was used as a control, pCONTROL (Fig. 1A). Because the ultimate goal of these studies was to evaluate the potential of using recombinant Lm as live attenuated vaccine vectors, we transformed either pHSVgB or pCONTROL into a
actA Lm strain, DPL-1942. We and others have shown that the
actA Lm mutant primes a robust Lm-specific CD8 and CD4 T cell response, and clearance of this strain does not require components of innate immunity such as MyD88 or IFN-
that are normally critical for protection from wild-type Lm infection (23, 24). Lm
actA transformed with either pHSVgB (Lm
actA pHSVgB) or pCONTROL (Lm
actA pCONTROL) each secreted a protein of predicted size (
19 kDa) into culture supernatants as detected by blotting with anti-HA Ab (Fig. 1B).
Lm
actA pHSVgB triggers Ag-specific CD8 T cell expansion
We next examined the gB-specific immune response triggered by Lm
actA pHSVgB in comparison with the immune response triggered by gB peptide administered in alum. By day 6 after inoculation with 106 CFUs of Lm
actA pHSVgB, gB-specific CD8 T cells were detectable in the peripheral blood. The magnitude of gB-specific CD8 T cell expansion peaked at day 8, began to contract by day 13, and reached levels
20% of day 8 levels at day 28 postinfection (Fig. 2A). For comparison, mice administered gB peptide in alum or mice infected with Lm
actA pCONTROL had only background levels of gB-specific CD8 T cells at each of these time points.
|
actA pHSVgB infection, we examined the Ag-specific response in splenocytes at the peak of the T cell response (day 8). At this time point, CD8+ splenocytes from Lm
actA pHSVgB-infected mice readily produced IFN-
in response to stimulation with gB498505 peptide as determined by both intracellular cytokine staining and ELISA, whereas splenocytes from Lm
actA pCONTROL-infected mice produced only background amounts of cytokine (Fig. 2, BD). Thus, infection with Lm
actA pHSVgB primes a robust CD8 T cell response to gB498505 in B6 mice. To confirm that mice infected with Lm
actA pHSVgB and Lm
actA pCONTROL only differed by the CD8 T cell response to gB498505, we examined the response to the endogenous listeriolysin-O peptide, LLO189201, presented by MHC class II (Fig. 2, B and D). Similar frequencies of IFN-
-producing CD4 T cells and total IFN-
production were found in both infection groups after stimulation with this peptide.
Infection with Lm
actA pHSVgB confers protective immunity to HSV-1 infection
To examine whether the gB-specific CD8 T cell response triggered by Lm
actA pHSVgB infection confers protection to HSV-1 infection, groups of mice infected with either Lm
actA pHSVgB or Lm
actA pCONTROL were infected in the hind footpads 28 days later with an inoculum of HSV-1 that normally causes ataxia and/or hind limb paralysis in naive mice. Many features of disease pathogenesis in human infection are represented in this acute infection model. After infection, virus travels anterograde through the enervating sciatic nerve to the dorsal root ganglia, replicates in the ganglia, and then returns to the site of infection via retrograde axonal transport resulting in a primary lesion of the footpad (22). Virus in the dorsal root ganglia can also cross the synapse, enter the spinal cord, and ascend to the brain causing paralysis. In the first 79 days after HSV infection, 85% (17 of 20) of mice primed with Lm
actA pCONTROL developed hind limb paralysis compared with only 25% (5 of 20) of mice primed with Lm
actA pHSVgB (p = 0.0002) (Fig. 3A). These mice were monitored for up to 14 days after infection, and no additional paralysis developed for any mice beyond day 9 after HSV infection.
|
actA pHSVgB, when compared with mice primed with Lm
actA pCONTROL, gB peptide in alum, or naive mice, had
10-fold and
200-fold reductions in HSV-1 titers in the footpad and spinal cord, respectively (Fig. 3B). Additionally, these protective effects of prior Lm
actA pHSVgB infection were associated with a rapid and robust expansion of gB-specific CD8 T cells in the draining popliteal lymph nodes in response to HSV-1 challenge. By day 3 after HSV-1 infection, 1.2% of CD8 T cells in the lymph nodes from Lm
actA pHSVgB-primed mice produced IFN-
in response to gB498505 peptide stimulation, whereas lymph node cells from Lm
actA pCONTROL-primed or naive mice had no detectable Ag-specific response (Fig. 3C). By 6 days postinfection, the gB-specific response in popliteal lymph node cells reached
15% of total CD8 T cells in Lm
actA pHSVgB-primed mice, compared with a
7% response in Lm
actA pCONTROL or naive mice (Fig. 3D). The delayed and dampened response in control mice represented the primary CD8 T cell response to HSV, which was not sufficient to protect them; the majority of these mice developed HSV-induced paralysis and ataxia and had markedly increased amounts of virus in both the CNS and peripheral tissues.
Finally, we examined the ability of Lm
actA pHSVgB to trigger protective immunity in immune-deficient mice that are more susceptible to HSV-1 infection. In both IFN-
-deficient and MyD88-deficient mice, a gB-specific immune response was readily detected by dimer staining after Lm
actA pHSVgB inoculation (data not shown); however, no significant protection from HSV-1 challenge could be detected for these mice (Fig. 3E). Taken together, these data demonstrate that recombinant Lm expressing a single peptide from HSV-1 confers protection to HSV-1 infection in immune-competent mice.
| Discussion |
|---|
|
|
|---|
The widespread prevalence of HSV infection combined with the lack of "curative" therapy and increasing resistance to standard antiviral therapy emphasizes the need for developing a vaccine that can prevent HSV infection (30, 31). In this study, we examined the potential for recombinant Lm expressing a single immune-dominant MHC class I-restricted peptide from HSV-1 to prime HSV-specific CD8 T cells to reduce disease. We demonstrate that Lm
actA pHSVgB induces a robust CD8 T cell response to HSV gB with
2% of peripheral CD8 T cells specific for this heterologous Ag at the peak of primary expansion in immune-competent and IFN-
-deficient and MyD88-deficient mice. In response to HSV-1 challenge, immune-competent mice were protected from HSV-1-induced disease, had marked reductions in the amount of recoverable virus, and a more rapid and robust expansion of Ag-specific CD8 T cells. Although recombinant Lm
actA pHSVgB triggered a robust gB-specific CD8 T cell response in IFN-
-deficient or MyD88-deficient mice, these responses were associated with little or protection against subsequent HSV-1 infection. These results are inconsistent with the readily achievable protective immunity to subsequent Lm infection in these mice after priming with Lm
actA (23, 24), and may reflect differences in CD8 T cell effectors, or other MyD88- or IFN-
-dependent immune mechanisms required for adaptive immunity to HSV-1 compared with Lm.
To our knowledge, this is the first study demonstrating protection from infection-associated disease in addition to reduction in viral burden conferred by recombinant Lm. Ideally, a HSV vaccine would both prevent new infection and be curative for established latent infection thereby preventing recurrent disease. However, HSV rarely reactivates from latency in mice, preventing assessment of this aspect of the vaccine. Nevertheless, the data presented here represent an important first step in the development of recombinant Listeria as a novel class of vaccine vectors against HSV infection.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported in part by Puget Sound Partners for Global Health Pilot Project Award (to S.S.W.), an Infectious Disease Society of America Career Development Award (to S.S.W.), and National Institutes of Health Grants K08HD51584 (to S.S.W.) and R01HD018184 (to C.B.W.). ![]()
2 Address correspondence and reprint requests to Dr. Sing Sing Way, Department of Pediatrics, University of Washington School of Medicine, 1959 Northeast Pacific Street, Box 357650, Seattle, WA 98195. E-mail address: singsing{at}u.washington.edu ![]()
3 Abbreviations used in this paper: gB, glycoprotein B; Lm, Listeria monocytogenes; HA, hemagglutinin. ![]()
Received for publication November 20, 2006. Accepted for publication February 13, 2007.
| References |
|---|
|
|
|---|
. Immunity 3: 109-117. [Medline]This article has been cited by other articles:
![]() |
L. Yan, J. Qiu, J. Chen, B. Ryan-Payseur, D. Huang, Y. Wang, L. Rong, J. A. Melton-Witt, N. E. Freitag, and Z. W. Chen Selected prfA* Mutations in Recombinant Attenuated Listeria monocytogenes Strains Augment Expression of Foreign Immunogens and Enhance Vaccine-Elicited Humoral and Cellular Immune Responses Infect. Immun., August 1, 2008; 76(8): 3439 - 3450. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Rowe, T. M. Johanns, J. M. Ertelt, and S. S. Way PDL-1 Blockade Impedes T Cell Expansion and Protective Immunity Primed by Attenuated Listeria monocytogenes J. Immunol., June 1, 2008; 180(11): 7553 - 7557. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Khan, R. Hakak, K. Eberle, P. Sayles, L. M. Weiss, and J. F. Urban Jr. Coinfection with Heligmosomoides polygyrus Fails To Establish CD8+ T-Cell Immunity against Toxoplasma gondii Infect. Immun., March 1, 2008; 76(3): 1305 - 1313. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |