The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Orr, M. T.
Right arrow Articles by Way, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Orr, M. T.
Right arrow Articles by Way, S. S.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2007, 178: 4731-4735.
Copyright © 2007 by The American Association of Immunologists, Inc.


CUTTING EDGE

Cutting Edge: Recombinant Listeria monocytogenes Expressing a Single Immune-Dominant Peptide Confers Protective Immunity to Herpes Simplex Virus-1 Infection1

Mark T. Orr*, Nural N. Orgun*, Christopher B. Wilson*,{dagger} and Sing Sing Way2,{dagger}

* Department of Immunology and {dagger} Department of Pediatrics, University of Washington School of Medicine, Seattle, WA 98195


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The vast majority of the world’s population is infected with HSV. Although antiviral therapy can reduce the incidence of reactivation and asymptomatic viral shedding, and limit morbidity and mortality from active disease, it cannot cure infection. Therefore, the development of an effective vaccine is an important global health priority. In this study, we demonstrate that recombinant Listeria monocytogenes (Lm) expressing the H-2Kb glycoprotein B (gB)498–505 peptide from HSV-1 triggers a robust CD8 T cell response to this Ag resulting in protective immunity to HSV infection. Following challenge with HSV-1, immune-competent mice primed with recombinant Lm-expressing gB498–505 Ag were protected from HSV-induced paralysis. Protection was associated with dramatic reductions in recoverable virus, and early expansion of HSV-1-specific CD8 T cells in the regional lymph nodes. Thus, recombinant Lm-expressing Ag from HSV represents a promising new class of vaccines against HSV infection.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Herpes simplex virus types 1 and 2 are ubiquitous human pathogens. Depending on the population examined, between 50 and 100% of adults have seroevidence of infection with HSV-1 or HSV-2 (1). After primary infection in immune-competent hosts, the virus establishes life-long latency within the sensory ganglia that is associated with sporadic recurrences of clinical lesions and asymptomatic virus shedding. However, infection in neonates or other immune-compromised hosts commonly causes disseminated infection resulting in a high rate of morbidity and mortality. Although antiviral therapy can reduce morbidity and mortality in disseminated infection, and long-term suppressive therapy can reduce the frequency and severity of viral reactivation, antivirals cannot not "cure" infection (2, 3). Furthermore, the increasing incidence of HSV resistant to common antiviral medications emphasizes the current need for an effective vaccine to prevent HSV infection (4, 5).

CD8 T cells contribute to protective immunity to HSV infection. In biopsy specimens from humans with recurrent HSV infection, viral clearance is associated with a high concentration of local CD8 T cells with cytolytic activity against infected cells (6). In animal models, depletion of CD8 T cells impairs clearance of virus from the CNS, whereas TCR transgenic CD8 T cells specific for the immune-dominant H-2Kb-restricted peptide in HSV-1 glycoprotein B (gB3)498–505 transferred into mice lacking other components of adaptive immunity results in viral clearance (7, 8). These studies demonstrate that HSV-specific CD8 T cells play a protective role in HSV infection.

Infection with the Gram-positive intracellular bacterium Listeria monocytogenes (Lm) is a well-characterized experimental model in which Lm-specific CD8 T cells can confer protective immunity to secondary Lm infection (9, 10). Moreover, recombinant Lm expressing defined Ags from other intracellular viral pathogens such as lymphocytic choriomeningitis virus, influenza, HIV, SIV, or feline immune deficiency virus primes CD8 T cells specific for these heterologous Ags that protect against subsequent viral challenge (11, 12, 13, 14, 15, 16, 17). Accordingly, in this study, we examined the ability of recombinant Lm expressing a single immune-dominant Ag from HSV-1 to prime HSV-specific CD8 T cells and confer protective immunity to HSV challenge.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Bacteria

Lm {Delta}actA strain DPL1942 and recombinant Lm secreting the OVA protein behind the Lm hly promoter (Lm-OVA) have been described previously (18, 19). Transformation of Lm was performed by penicillin treatment as described (20). For infections, Lm was grown and subcultured in brain-heart infusion medium containing chloramphenicol (20 µg/ml) to early log-phase (OD600 0.1), washed, and diluted in PBS to a final concentration of 1 x 106 CFUs per 200 µl and inoculated i.v. into mice.

Expression constructs

The DNA fragment encoding OVA, hemagglutinin (HA) tag, Lm hly promoter, and signal sequence was PCR amplified from Lm-OVA (19) using the following primers: 5'-tctagattaacatttgttaacgacgac-3' and 5'- ggatccttaaggggaaacacatctgcc-3', and cloned into the XbaI and BamH1 sites in the low copy vector pAM401 containing resistance to chloramphenicol (21) (Fig. 1A). Underlined DNA sequence indicate restriction enzyme sites. This construct was then cut with PstI and StuI, and ligated with the overlapping primer sets for pHSVgB (coding strand, 5'-accacctcctccatcgagttcgcccggctgcagtttacagg-3' and noncoding strand, 5'-cctgtaaactgcagccgggcgaactcgatggaggaggtggttgca-3') (Fig. 1A) and pCONTROL (coding strand, 5'- atgacagagcagcagtggaatttcgcgggtatcgaggccgcggcaagcgcaatccagggaaatgtagg-3' and noncoding strand, 5'-cctacatttccctggattgcgcttgccgcggcctcgatacccgcgaaattccactgctgctctgtcattgca-3'). The relevant portions of these constructs were verified by DNA sequencing.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 1. Generation of Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL. A, Construct map for creating recombinant HA-tagged fusion proteins containing HSV-1 gB498–505 and mTB ESAT61–20 peptides that are expressed and secreted under the Lm hly promoter and signal sequence within the pAM401 vector (cat, chloroamphenicol acetyltransferase). B, Western blot of supernatant protein from Lm {Delta}actA pHSVgB (lane 1), Lm {Delta}actA pCONTROL (lane 2), and Lm-OVA (lane 3) (19 ) with anti-HA Ab.

 
Western blotting

Supernatant protein was prepared by filtering (0.2-µm syringe filter) Lm culture medium (brain-heart infusion) with bacteria in log-phase growth (2–4 h after 1/100 back-dilution of stationary phase cultures to OD600 0.4–0.6), trichloroacetic acid precipitation (10%), and separation by SDS gel electrophoresis. Proteins were transferred to nitrocellulose and probed with rabbit anti-HA (clone HA-11; Covance Research Products).

Herpes simplex virus

HSV-1 (KOS strain) viral stocks were prepared for hind footpad infection (2.5 x 106 PFU per footpad) following dermal abrasion, as described previously (22). After infection, mice were monitored twice daily for 14 days for HSV CNS disease manifested as ataxia and/or hind limb paralysis. Our previous studies have demonstrated that >80% of mice that develop these symptoms later succumb to infection, and accordingly paralyzed mice were euthanized in accordance with our Institutional Animal Care and Use Committee protocol. For determining tissue HSV titers, the hind footpads and spinal cord were harvested, snap frozen, homogenized, and titered on Vero cells (22).

Mice

Female C57BL/6 (H-2b) and IFN-{gamma}-deficient mice on the C57BL/6 background were purchased from The Jackson Laboratory. MyD88-deficient mice were a gift from Dr. S. Akira (Osaka University, Osaka, Japan) and were backcrossed onto the C57BL/6 background for at least 10 generations. All mice were maintained in the University of Washington specific pathogen-free facility. For gB peptide immunization, 100 µg of purified peptide in 100 µl of saline was mixed with 100 µl of alum (Imject Alum; Pierce) and inoculated i.p. All studies were approved by the University of Washington Institutional Animal Care and Use Committee.

Quantification of CD8 T cell response

HSV-1 gB498–505-specific CD8 T cells were analyzed in peripheral blood by staining with H-2Kb dimer X loaded with gB498–505 peptide according to the manufacturer’s instructions (BD Biosciences). For intracellular cytokine staining, single-cell suspensions of splenocytes or cells from the draining lymph nodes were incubated in the presence of the indicated peptides (10–6 M) and monensin (GolgiStop reagent; BD Biosciences) for 5 h, surface stained, permeabilized (Cytoperm solution; BD Biosciences), and stained for intracellular IFN-{gamma}.

Cytokine production

The concentration of IFN-{gamma} in splenocyte culture supernatants (5 x 106 cells/ml) was quantified 72 h after peptide stimulation by ELISA using reagents from R&D Systems.

Statistics

The differences in mean viral PFUs, the percentages and numbers of cells, and cytokine concentrations were determined using the Student t test. The difference in survival between groups of mice were determined using log-rank {chi}2 test (Prism; GraphPad Software).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Generation of Lm-expressing HSV gB498–505

To test the ability of recombinant Lm-expressing HSV Ag to trigger HSV-specific CD8 T cells, we engineered an expression construct (designated pHSVgB) containing the HSV-1 peptide gB498–505 secreted as a HA-tagged recombinant protein expressed under the Lm hly promoter and signal sequence, within the Gram-positive bacterial vector pAM401 (21) (Fig. 1A). In a similar fashion, we inserted the coding sequence for a peptide Ag from an irrelevant pathogen (Mycobacterium tuberculosis) into the same Lm expression construct that was used as a control, pCONTROL (Fig. 1A). Because the ultimate goal of these studies was to evaluate the potential of using recombinant Lm as live attenuated vaccine vectors, we transformed either pHSVgB or pCONTROL into a {Delta}actA Lm strain, DPL-1942. We and others have shown that the {Delta}actA Lm mutant primes a robust Lm-specific CD8 and CD4 T cell response, and clearance of this strain does not require components of innate immunity such as MyD88 or IFN-{gamma} that are normally critical for protection from wild-type Lm infection (23, 24). Lm {Delta}actA transformed with either pHSVgB (Lm {Delta}actA pHSVgB) or pCONTROL (Lm {Delta}actA pCONTROL) each secreted a protein of predicted size (~19 kDa) into culture supernatants as detected by blotting with anti-HA Ab (Fig. 1B).

Lm {Delta}actA pHSVgB triggers Ag-specific CD8 T cell expansion

We next examined the gB-specific immune response triggered by Lm {Delta}actA pHSVgB in comparison with the immune response triggered by gB peptide administered in alum. By day 6 after inoculation with 106 CFUs of Lm {Delta}actA pHSVgB, gB-specific CD8 T cells were detectable in the peripheral blood. The magnitude of gB-specific CD8 T cell expansion peaked at day 8, began to contract by day 13, and reached levels ~20% of day 8 levels at day 28 postinfection (Fig. 2A). For comparison, mice administered gB peptide in alum or mice infected with Lm {Delta}actA pCONTROL had only background levels of gB-specific CD8 T cells at each of these time points.


Figure 2
View larger version (53K):
[in this window]
[in a new window]

 
FIGURE 2. Induction of HSV-specific CD8 T cells after infection with Lm {Delta}actA pHSVgB. A, The percentage of HSV-gB498–505-specific CD8 T cells in the peripheral blood determined by staining with H-2Kb dimer X loaded with gB498–505 peptide at the indicated time points after inoculation with 106 CFUs of either Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL, or gB peptide (100 µg) in alum. B, IFN-{gamma} production by CD8 and CD4 T splenocytes from mice day 8 after infection with 106 CFUs of either Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL after restimulation with gB498–505 peptide and LLO189–201 peptide, respectively. Numbers in the upper right quadrant indicate the mean percentage (±SE) of IFN-{gamma}+ cells of total CD8+ or CD4+ T cells for five mice per group from two separate experiments. C, Absolute number of IFN-{gamma}-producing CD8 T cells per spleen day 8 after infection with Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL determined by intracellular cytokine staining. D, IFN-{gamma} concentration in splenocyte culture supernatants from day 8 Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL infected mice after 72-h stimulation with gB498–505, LLO189–201, or no peptide.

 
To further evaluate the HSV-specific CD8 T cell response triggered by Lm {Delta}actA pHSVgB infection, we examined the Ag-specific response in splenocytes at the peak of the T cell response (day 8). At this time point, CD8+ splenocytes from Lm {Delta}actA pHSVgB-infected mice readily produced IFN-{gamma} in response to stimulation with gB498–505 peptide as determined by both intracellular cytokine staining and ELISA, whereas splenocytes from Lm {Delta}actA pCONTROL-infected mice produced only background amounts of cytokine (Fig. 2, B–D). Thus, infection with Lm {Delta}actA pHSVgB primes a robust CD8 T cell response to gB498–505 in B6 mice. To confirm that mice infected with Lm {Delta}actA pHSVgB and Lm {Delta}actA pCONTROL only differed by the CD8 T cell response to gB498–505, we examined the response to the endogenous listeriolysin-O peptide, LLO189–201, presented by MHC class II (Fig. 2, B and D). Similar frequencies of IFN-{gamma}-producing CD4 T cells and total IFN-{gamma} production were found in both infection groups after stimulation with this peptide.

Infection with Lm {Delta}actA pHSVgB confers protective immunity to HSV-1 infection

To examine whether the gB-specific CD8 T cell response triggered by Lm {Delta}actA pHSVgB infection confers protection to HSV-1 infection, groups of mice infected with either Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL were infected in the hind footpads 28 days later with an inoculum of HSV-1 that normally causes ataxia and/or hind limb paralysis in naive mice. Many features of disease pathogenesis in human infection are represented in this acute infection model. After infection, virus travels anterograde through the enervating sciatic nerve to the dorsal root ganglia, replicates in the ganglia, and then returns to the site of infection via retrograde axonal transport resulting in a primary lesion of the footpad (22). Virus in the dorsal root ganglia can also cross the synapse, enter the spinal cord, and ascend to the brain causing paralysis. In the first 7–9 days after HSV infection, 85% (17 of 20) of mice primed with Lm {Delta}actA pCONTROL developed hind limb paralysis compared with only 25% (5 of 20) of mice primed with Lm {Delta}actA pHSVgB (p = 0.0002) (Fig. 3A). These mice were monitored for up to 14 days after infection, and no additional paralysis developed for any mice beyond day 9 after HSV infection.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 3. Lm {Delta}actA pHSVgB protects mice from lethal challenge with HSV-1. A, Paralysis-free survival after HSV-1 footpad inoculation (2.5 x 106 PFUs) in mice primed 28 days previously with Lm {Delta}actA pHSVgB ({blacksquare}) or Lm {Delta}actA pCONTROL ({blacktriangleup}). Difference in survival between these two groups, p = 0.0002. These data represent 20 mice per experimental group pooled from two independent experiments with similar results. B, Recoverable HSV-1 titers in the footpad and spinal cord on day 6 after HSV infection in naive mice, or mice primed 28 days previously with Lm {Delta}actA pHSVgB, Lm {Delta}actA pCONTROL, or gB peptide in alum. Percentage of CD8 T cells in draining popliteal lymph nodes producing IFN-{gamma} after stimulation with gB498–505 peptide ({blacksquare}) or no peptide ({square}) on day 3 (C) and day 6 (D) after footpad inoculation with HSV-1 (2.5 x 106 PFUs) in naive mice, or mice primed 28 days previously with Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL. E, Recoverable HSV-1 titers in the footpad and spinal cord on day 6 after HSV infection in IFN-{gamma}-deficient or MyD88-deficient mice primed 28 days previously with Lm {Delta}actA pHSVgB or Lm {Delta}actA pCONTROL.

 
To determine whether protection from paralysis was directly related to reductions in viral burden, we quantified the amount of recoverable virus just before mice develop paralysis (day 6). Mice primed with Lm {Delta}actA pHSVgB, when compared with mice primed with Lm {Delta}actA pCONTROL, gB peptide in alum, or naive mice, had ~10-fold and ~200-fold reductions in HSV-1 titers in the footpad and spinal cord, respectively (Fig. 3B). Additionally, these protective effects of prior Lm {Delta}actA pHSVgB infection were associated with a rapid and robust expansion of gB-specific CD8 T cells in the draining popliteal lymph nodes in response to HSV-1 challenge. By day 3 after HSV-1 infection, 1.2% of CD8 T cells in the lymph nodes from Lm {Delta}actA pHSVgB-primed mice produced IFN-{gamma} in response to gB498–505 peptide stimulation, whereas lymph node cells from Lm {Delta}actA pCONTROL-primed or naive mice had no detectable Ag-specific response (Fig. 3C). By 6 days postinfection, the gB-specific response in popliteal lymph node cells reached ~15% of total CD8 T cells in Lm {Delta}actA pHSVgB-primed mice, compared with a ~7% response in Lm {Delta}actA pCONTROL or naive mice (Fig. 3D). The delayed and dampened response in control mice represented the primary CD8 T cell response to HSV, which was not sufficient to protect them; the majority of these mice developed HSV-induced paralysis and ataxia and had markedly increased amounts of virus in both the CNS and peripheral tissues.

Finally, we examined the ability of Lm {Delta}actA pHSVgB to trigger protective immunity in immune-deficient mice that are more susceptible to HSV-1 infection. In both IFN-{gamma}-deficient and MyD88-deficient mice, a gB-specific immune response was readily detected by dimer staining after Lm {Delta}actA pHSVgB inoculation (data not shown); however, no significant protection from HSV-1 challenge could be detected for these mice (Fig. 3E). Taken together, these data demonstrate that recombinant Lm expressing a single peptide from HSV-1 confers protection to HSV-1 infection in immune-competent mice.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Numerous properties make recombinant Lm an attractive vaccine vector candidate for priming Ag-specific CD8 T cells. First and foremost, Lm infection is a strong adjuvant, and the resultant Ag-specific CD8 T cell response to Lm or recombinant Ag is protective and long-lasting (13, 25). These properties are directly related to the ability of the bacterium to gain access to the cytoplasmic compartment of infected cells delivering Ags to the MHC class I Ag presentation pathway. Second, preexisting immunity to Lm does not diminish the therapeutic efficacy of recombinant Lm strains (26, 27). Third, genetic manipulation allowing for expression of heterologous Ag and targeted disruption of virulence factors is readily accomplished. Accordingly, numerous attenuated Lm strains that cause minimal disease yet maintain immunogenicity have been described previously (28, 29). Together, these qualities make attenuated Lm expressing recombinant Ag promising vaccine candidates for priming Ag-specific T cells.

The widespread prevalence of HSV infection combined with the lack of "curative" therapy and increasing resistance to standard antiviral therapy emphasizes the need for developing a vaccine that can prevent HSV infection (30, 31). In this study, we examined the potential for recombinant Lm expressing a single immune-dominant MHC class I-restricted peptide from HSV-1 to prime HSV-specific CD8 T cells to reduce disease. We demonstrate that Lm {Delta}actA pHSVgB induces a robust CD8 T cell response to HSV gB with ~2% of peripheral CD8 T cells specific for this heterologous Ag at the peak of primary expansion in immune-competent and IFN-{gamma}-deficient and MyD88-deficient mice. In response to HSV-1 challenge, immune-competent mice were protected from HSV-1-induced disease, had marked reductions in the amount of recoverable virus, and a more rapid and robust expansion of Ag-specific CD8 T cells. Although recombinant Lm{Delta}actA pHSVgB triggered a robust gB-specific CD8 T cell response in IFN-{gamma}-deficient or MyD88-deficient mice, these responses were associated with little or protection against subsequent HSV-1 infection. These results are inconsistent with the readily achievable protective immunity to subsequent Lm infection in these mice after priming with Lm {Delta}actA (23, 24), and may reflect differences in CD8 T cell effectors, or other MyD88- or IFN-{gamma}-dependent immune mechanisms required for adaptive immunity to HSV-1 compared with Lm.

To our knowledge, this is the first study demonstrating protection from infection-associated disease in addition to reduction in viral burden conferred by recombinant Lm. Ideally, a HSV vaccine would both prevent new infection and be curative for established latent infection thereby preventing recurrent disease. However, HSV rarely reactivates from latency in mice, preventing assessment of this aspect of the vaccine. Nevertheless, the data presented here represent an important first step in the development of recombinant Listeria as a novel class of vaccine vectors against HSV infection.


    Acknowledgments
 
We thank Drs. A. Hajjar, T. Kollmann, and M. Mathis for helpful discussions.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Puget Sound Partners for Global Health Pilot Project Award (to S.S.W.), an Infectious Disease Society of America Career Development Award (to S.S.W.), and National Institutes of Health Grants K08HD51584 (to S.S.W.) and R01HD018184 (to C.B.W.). Back

2 Address correspondence and reprint requests to Dr. Sing Sing Way, Department of Pediatrics, University of Washington School of Medicine, 1959 Northeast Pacific Street, Box 357650, Seattle, WA 98195. E-mail address: singsing{at}u.washington.edu Back

3 Abbreviations used in this paper: gB, glycoprotein B; Lm, Listeria monocytogenes; HA, hemagglutinin. Back

Received for publication November 20, 2006. Accepted for publication February 13, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Smith, J. S., N. J. Robinson. 2002. Age-specific prevalence of infection with herpes simplex virus types 2 and 1: a global review. J. Infect. Dis. 186: (Suppl. 1):S3-S28. [Medline]
  2. Kimberlin, D.. 2004. Herpes simplex virus, meningitis and encephalitis in neonates. Herpes 11: (Suppl. 2):65A-76A. [Medline]
  3. Kimberlin, D. W., C. Y. Lin, R. F. Jacobs, D. A. Powell, L. Corey, W. C. Gruber, M. Rathore, J. S. Bradley, P. S. Diaz, M. Kumar, et al 2001. Safety and efficacy of high-dose intravenous acyclovir in the management of neonatal herpes simplex virus infections. Pediatrics 108: 230-238. [Abstract/Free Full Text]
  4. Danve-Szatanek, C., M. Aymard, D. Thouvenot, F. Morfin, G. Agius, I. Bertin, S. Billaudel, B. Chanzy, M. Coste-Burel, L. Finkielsztejn, et al 2004. Surveillance network for herpes simplex virus resistance to antiviral drugs: 3-year follow-up. J. Clin. Microbiol. 42: 242-249. [Abstract/Free Full Text]
  5. Stranska, R., R. Schuurman, E. Nienhuis, I. W. Goedegebuure, M. Polman, J. F. Weel, P. M. Wertheim-Van Dillen, R. J. Berkhout, A. M. van Loon. 2005. Survey of acyclovir-resistant herpes simplex virus in the Netherlands: prevalence and characterization. J. Clin. Virol. 32: 7-18. [Medline]
  6. Koelle, D. M., C. M. Posavad, G. R. Barnum, M. L. Johnson, J. M. Frank, L. Corey. 1998. Clearance of HSV-2 from recurrent genital lesions correlates with infiltration of HSV-specific cytotoxic T lymphocytes. J. Clin. Invest. 101: 1500-1508. [Medline]
  7. van Lint, A., M. Ayers, A. G. Brooks, R. M. Coles, W. R. Heath, F. R. Carbone. 2004. Herpes simplex virus-specific CD8+ T cells can clear established lytic infections from skin and nerves and can partially limit the early spread of virus after cutaneous inoculation. J. Immunol. 172: 392-397. [Abstract/Free Full Text]
  8. Simmons, A., D. C. Tscharke. 1992. Anti-CD8 impairs clearance of herpes simplex virus from the nervous system: implications for the fate of virally infected neurons. J. Exp. Med. 175: 1337-1344. [Abstract/Free Full Text]
  9. Harty, J. T., M. J. Bevan. 1992. CD8+ T cells specific for a single nonamer epitope of Listeria monocytogenes are protective in vivo. J. Exp. Med. 175: 1531-1538. [Abstract/Free Full Text]
  10. Harty, J. T., E. G. Pamer. 1995. CD8 T lymphocytes specific for the secreted p60 antigen protect against Listeria monocytogenes infection. J. Immunol. 154: 4642-4650. [Abstract]
  11. Frankel, F. R., S. Hegde, J. Lieberman, Y. Paterson. 1995. Induction of cell-mediated immune responses to human immunodeficiency virus type 1 Gag protein by using Listeria monocytogenes as a live vaccine vector. J. Immunol. 155: 4775-4782. [Abstract]
  12. Zhao, X., M. Zhang, Z. Li, F. R. Frankel. 2006. Vaginal protection and immunity after oral immunization of mice with a novel vaccine strain of Listeria monocytogenes expressing human immunodeficiency virus type 1 gag. J. Virol. 80: 8880-8890. [Abstract/Free Full Text]
  13. Rayevskaya, M. V., F. R. Frankel. 2001. Systemic immunity and mucosal immunity are induced against human immunodeficiency virus Gag protein in mice by a new hyperattenuated strain of Listeria monocytogenes. J. Virol. 75: 2786-2791. [Abstract/Free Full Text]
  14. Shen, H., M. K. Slifka, M. Matloubian, E. R. Jensen, R. Ahmed, J. F. Miller. 1995. Recombinant Listeria monocytogenes as a live vaccine vehicle for the induction of protective anti-viral cell-mediated immunity. Proc. Natl. Acad. Sci. USA 92: 3987-3991. [Abstract/Free Full Text]
  15. Boyer, J. D., T. M. Robinson, P. C. Maciag, X. Peng, R. S. Johnson, G. Pavlakis, M. G. Lewis, A. Shen, R. Siliciano, C. R. Brown, et al 2005. DNA prime Listeria boost induces a cellular immune response to SIV antigens in the rhesus macaque model that is capable of limited suppression of SIV239 viral replication. Virology 333: 88-101. [Medline]
  16. Stevens, R., K. E. Howard, S. Nordone, M. Burkhard, G. A. Dean. 2004. Oral immunization with recombinant Listeria monocytogenes controls virus load after vaginal challenge with feline immunodeficiency virus. J. Virol. 78: 8210-8218. [Abstract/Free Full Text]
  17. Ikonomidis, G., D. A. Portnoy, W. Gerhard, Y. Paterson. 1997. Influenza-specific immunity induced by recombinant Listeria monocytogenes vaccines. Vaccine 15: 433-440. [Medline]
  18. Brundage, R. A., G. A. Smith, A. Camilli, J. A. Theriot, D. A. Portnoy. 1993. Expression and phosphorylation of the Listeria monocytogenes ActA protein in mammalian cells. Proc. Natl. Acad. Sci. USA 90: 11890-11894. [Abstract/Free Full Text]
  19. Foulds, K. E., L. A. Zenewicz, D. J. Shedlock, J. Jiang, A. E. Troy, H. Shen. 2002. Cutting edge: CD4 and CD8 T cells are intrinsically different in their proliferative responses. J. Immunol. 168: 1528-1532. [Abstract/Free Full Text]
  20. Park, S. F., G. S. Stewart. 1990. High-efficiency transformation of Listeria monocytogenes by electroporation of penicillin-treated cells. Gene 94: 129-132. [Medline]
  21. Wirth, R., F. Y. An, D. B. Clewell. 1986. Highly efficient protoplast transformation system for Streptococcus faecalis and a new Escherichia coli-S. faecalis shuttle vector. J Bacteriol. 165: 831-836. [Abstract/Free Full Text]
  22. Orr, M. T., K. H. Edelmann, J. Vieira, L. Corey, D. H. Raulet, C. B. Wilson. 2005. Inhibition of MHC class I is a virulence factor in herpes simplex virus infection of mice. PLoS Pathog. 1: e7[Medline]
  23. Way, S. S., T. R. Kollmann, A. M. Hajjar, C. B. Wilson. 2003. Cutting edge: protective cell-mediated immunity to Listeria monocytogenes in the absence of myeloid differentiation factor 88. J. Immunol. 171: 533-537. [Abstract/Free Full Text]
  24. Harty, J. T., M. J. Bevan. 1995. Specific immunity to Listeria monocytogenes in the absence of IFN{gamma}. Immunity 3: 109-117. [Medline]
  25. Sun, J. C., M. J. Bevan. 2003. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 300: 339-342. [Abstract/Free Full Text]
  26. Stevens, R., A. Lavoy, S. Nordone, M. Burkhard, G. A. Dean. 2005. Pre-existing immunity to pathogenic Listeria monocytogenes does not prevent induction of immune responses to feline immunodeficiency virus by a novel recombinant Listeria monocytogenes vaccine. Vaccine 23: 1479-1490. [Medline]
  27. Starks, H., K. W. Bruhn, H. Shen, R. A. Barry, T. W. Dubensky, D. Brockstedt, D. J. Hinrichs, D. E. Higgins, J. F. Miller, M. Giedlin, H. G. Bouwer. 2004. Listeria monocytogenes as a vaccine vector: virulence attenuation or existing antivector immunity does not diminish therapeutic efficacy. J. Immunol. 173: 420-427. [Abstract/Free Full Text]
  28. Brockstedt, D. G., M. A. Giedlin, M. L. Leong, K. S. Bahjat, Y. Gao, W. Luckett, W. Liu, D. N. Cook, D. A. Portnoy, T. W. Dubensky, Jr. 2004. Listeria-based cancer vaccines that segregate immunogenicity from toxicity. Proc. Natl. Acad. Sci. USA 101: 13832-13837. [Abstract/Free Full Text]
  29. Lieberman, J., F. R. Frankel. 2002. Engineered Listeria monocytogenes as an AIDS vaccine. Vaccine 20: 2007-2010. [Medline]
  30. Koelle, D. M.. 2006. Vaccines for herpes simplex virus infections. Curr. Opin. Investig. Drugs 7: 136-141. [Medline]
  31. Stanberry, L. R.. 2004. Clinical trials of prophylactic and therapeutic herpes simplex virus vaccines. Herpes 11: 161A-169A. [Medline]



This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
W. J. Muller, L. Dong, A. Vilalta, B. Byrd, K. M. Wilhelm, C. L. McClurkan, M. Margalith, C. Liu, D. Kaslow, J. Sidney, et al.
Herpes simplex virus type 2 tegument proteins contain subdominant T-cell epitopes detectable in BALB/c mice after DNA immunization and infection
J. Gen. Virol., May 1, 2009; 90(5): 1153 - 1163.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Ertelt, J. H. Rowe, T. M. Johanns, J. C. Lai, J. B. McLachlan, and S. S. Way
Selective Priming and Expansion of Antigen-Specific Foxp3-CD4+ T Cells during Listeria monocytogenes Infection
J. Immunol., March 1, 2009; 182(5): 3032 - 3038.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. Yan, J. Qiu, J. Chen, B. Ryan-Payseur, D. Huang, Y. Wang, L. Rong, J. A. Melton-Witt, N. E. Freitag, and Z. W. Chen
Selected prfA* Mutations in Recombinant Attenuated Listeria monocytogenes Strains Augment Expression of Foreign Immunogens and Enhance Vaccine-Elicited Humoral and Cellular Immune Responses
Infect. Immun., August 1, 2008; 76(8): 3439 - 3450.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. H. Rowe, T. M. Johanns, J. M. Ertelt, and S. S. Way
PDL-1 Blockade Impedes T Cell Expansion and Protective Immunity Primed by Attenuated Listeria monocytogenes
J. Immunol., June 1, 2008; 180(11): 7553 - 7557.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
I. A. Khan, R. Hakak, K. Eberle, P. Sayles, L. M. Weiss, and J. F. Urban Jr.
Coinfection with Heligmosomoides polygyrus Fails To Establish CD8+ T-Cell Immunity against Toxoplasma gondii
Infect. Immun., March 1, 2008; 76(3): 1305 - 1313.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Orr, M. T.
Right arrow Articles by Way, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Orr, M. T.
Right arrow Articles by Way, S. S.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS