The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, M.
Right arrow Articles by Crabtree, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, M.
Right arrow Articles by Crabtree, G. R.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*(L)-ALANINE
*CYCLOSPORIN A
*L-SERINE
The Journal of Immunology, 2007, 178: 4315-4321.
Copyright © 2007 by The American Association of Immunologists, Inc.

Enhanced NFATc1 Nuclear Occupancy Causes T Cell Activation Independent of CD28 Costimulation1

Minggui Pan2,*, Monte M. Winslow{dagger}, Lei Chen{ddagger}, Ann Kuo{ddagger}, Dean Felsher* and Gerald R. Crabtree2,{ddagger}

* Division of Oncology, {dagger} Program in Immunology, and {ddagger} Howard Hughes Medical Institute, Department of Developmental Biology and Department of Pathology, Stanford University, Stanford CA 94305


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TCR signals induce the nuclear localization of NFATc proteins, which are removed from the nucleus after rephosphorylation by glycogen synthase kinase 3 and other kinases. Rapid nuclear export might allow continuous monitoring of receptor occupancy, making the transcriptional response proportional to the duration of TCR/CD28 signaling. To investigate this possibility, we analyzed mice in which T cells express a NFATc1 variant (NFATc1nuc) with serine-to-alanine changes at the glycogen synthase kinase 3 phosphorylation sites. NFATc1nuc T cells have constitutively nuclear NFATc1, enhanced T cell activation in vivo, and calcineurin-independent proliferation in vitro. NFATc1nuc T cells are hypersensitive to TCR/CD3 stimulation, resulting in enhanced proliferation and cytokine production that is independent of CD28 costimulation. These results support the notion that CD28 inhibits nuclear export of NFATc transcription factors. In addition, NFATc1nuc destabilizes a positive feedback loop in which NFATc1 activates its own transcription as well as its targets, such as CD40 ligand and Th1/Th2 cytokines.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Maximal and sustained activation of T lymphocytes requires integration of the signaling pathways downstream of the TCR and of coreceptors such as CD28 (1). Stimulation of naive T lymphocytes through their TCR in the presence of costimulation results in activation and proliferation while TCR stimulation alone can result in anergy or cell death. TCR stimulation activates the Ca2+/calcineurin-regulated calcineurin phosphatase complex. Calcineurin dephosphorylates and activates the NFATc family of transcription factors, the activation of which is required in T cells for the induction of antigenic and tolerogenic genetic programs (2). Concurrent CD28 costimulation of CD4+ helper T cells results in the induction of genes that regulate cell cycle entry and promote survival as well as the expression of cell surface and secreted molecules that coordinate the immune response (3). The signaling pathways regulated by CD28 are controversial, but substantial evidence indicates that glycogen synthase kinase 3 (GSK3)3 is inhibited by CD28, perhaps through a pathway involving PI3K and AKT (4, 5). GSK3 is also an important regulator of WNT signaling and apoptosis and plays critical roles in many biological systems (6).

Genome-wide gene expression profiling indicates that one important aspect of CD28 signaling is the inhibition of GSK3, resulting in reduced nuclear export of nuclear NFATc proteins (7). Normally, nuclear export occurs when Dyrk1a and/or protein kinase A in the nucleus phosphorylate the serine/proline repeats and serine-rich region in the N termini of NFATc proteins (8). This primes NFAT for sequential phosphorylation by GSK3 (9, 10, 11, 12). Calcineurin inhibition affects the same group of genes as CD28 inhibition and to nearly the same degree, suggesting that reducing nuclear export of NFAT is an important functional consequence of CD28 signaling. CD28 stimulation is opposed by CTLA-4 (12, 13) and CTLA-4-deficient mice develop a fatal lymphoproliferative disorder, underscoring the importance of proper costimulation regulation in maintaining immune homeostasis (14, 15).

A number of transcription factors in yeast, flies, and mammals have nuclear export signals that might be involved in controlling their activity, but to date there is little evidence that these export sequences are actually used for this purpose. To determine in vivo whether the rapid export of NFATc1 from the nucleus plays a role in controlling T lymphocyte activation or development, we created transgenic mice expressing a NFATc1 variant (NFATc1nuc) with serine-to-alanine changes at the GSK3 phosphorylation sites at the N terminus of NFATc1, which are essential for nuclear export and cytoplasmic localization (16, 17, 18, 19). We show that failure to appropriately export NFATc1 from the nucleus results in hypersensitive T cell activation independent of CD28 costimulation. NFATc1nuc destabilizes a positive feedback loop in which NFATc1 activates its own transcription, increases the expression of CD25 and CD40 ligand (CD40L), and enhances the expression of both Th1 and Th2 cytokines.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Generation of tetracycline (Tet)-regulated NFATc1nuc mice and doxycycline treatment

NFATc1nuc, NFATc1wt, and EµSR-tTA-transgenic mice (FVB/N) were previously described (20, 21). Briefly, NFATc1nuc was made by site-directed mutagenesis and the DNA of NFATc1nuc or NFATc1wt was inserted in-frame into pS vector N-terminally to a hemagglutinin (HA) tag. The construct was digested with BamHI and Acc 65I and inserted into pUD10-3 downstream of the Tet-O promoter. The transgene was digested with SpeI, purified, and pronuclear injection was performed using B6CBAF1/J (The Jackson Laboratory) mice with standard protocol. Tet-O-NFATc1nuc or Tet-O-NFATc1wt mice were crossed to EµSR-tTA mice to generate Tet-regulated transgenic mice under EµSR promoter control (Fig. 1A). For doxycycline treatment of mice in vivo, doxycycline was given in drinking water at 200 µg/ml and changed weekly.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		FIGURE 1. Expression of transgene NFATc1nuc by Western blot and RT-PCR. A, Strategy of creating transgenic mice with regulated nuclear expression of NFATc1. Top, Diagram of nuclear NFATc1 construct. P1 (primer 1) and P2 (primer 2) stand for PCR primers used for RT-PCR in approximate positions. Tet-O, Tet-responsive promoter; SRR, serine-rich region; SP, serine/proline repeat; NES, nuclear export signal; NLS, nuclear localization signal. Middle, Diagram of tTA construct. EµµSR{alpha}, Ig H {alpha}, Ig H chain enhancer SR {alpha}{alpha} promoter. Bottom, Diagram of crossing Tet-O-NFATc1nuc mice to tTA mice to generate Tet-regulated mice (NFATc1nuc). B, Tissue lysates from a NFATc1nuc mouse was blotted with anti-HA Ab. Actin is a control. Data are representative of three separate experiments. C, NFATc1nuc expression in NFATc1nuc lymphocytes by RT-PCR. Control (WT thymocytes, lane 1), mutant thymus (lane 2), CD4+ T cells (lane 3), CD8+ T cells (lane 4), CD4–CD8– T cells (lane 6), CD4+CD8+ T cells (lane 7), and B cells (lane 5). Cells were purified by FACS. GAPDH is a control. Data are representative of three separate experiments. Two-week-old mice were used in B and C.

 
Western blot and RT-PCR

Cell or tissue lysates were separated on a SDS-polyacrylamide gel, transferred to a nitrocellulose membrane, and blotted with anti-NFATc1 (7A6; BD Pharmingen) or anti-HA (16B12; Berkeley Antibody). Nuclear extracts were prepared according to our previously published protocol in Flanagan et al. (19). Briefly, cells were washed in PBS and resuspended in 1 ml of buffer A containing 25 mM HEPES (pH 7.0), 25 mM KCl, 0.05 mM EDTA, 5 mM MgCl2, 10% glycerol, 0.05% Nonidet P-40, 1 mM DTT, plus a mixture of protease inhibitors and spun in Eppendorf tubes for 3 min. The pellets were resuspended in buffer C containing 50 mM HEPES (pH 7.6), 50 mM KCl, 0.1 mM EDTA, 1 mM DTT, 10% glycerol, and protease inhibitors and transferred to a TLA-100.2 ultracentrifuge tube. Three molar ammonium sulfate was added to bring the final concentration to 0.3 M and centrifuged at 100,000 rpm. The pellets were resuspended in buffer C. For RT-PCR, mRNA was prepared from lymphocytes using a Qiagen kit. One hundred nanograms of mRNA was used for amplification using a Qiagen kit for 30 cycles at the following cycling temperatures: 95°C (denaturing), 60°C (annealing), and 72°C (extending). Two primers (P1 and P2) located in the 5' end of the transgene (aaagaactgctcctcagtgg and tctgaaggttgtggcacg) (Fig. 1A) were used for amplification and expected product size was 340 bp.

Cell isolation, culture, and T cell proliferation assay

Naive Th cells were isolated from lymph nodes by cell sorting (FACStar; BD Biosciences) for CD4+CD62Lhigh to 99% purity (and verified as CD44low) and were plated onto 1 µg/ml anti-CD3 (clone 145-2C11; BD Pharmingen), 2 µg/ml anti-CD28 (clone 37-51; BD Pharmingen)-coated plates at 1–2 x 106 cells/ml in the presence of 1 ng/ml IL-12 and 10 µg/ml anti-IL-4 (Th1 conditions) or 10 ng/ml IL-4 and 10 µg/ml anti-IFN-{gamma} (Th2 conditions). IL-2 (100 U/ml) was added after 24 h. Cultures were expanded in 100 U/ml IL-2 after 3 days of initial culture. After 1 wk in culture, the cells were stimulated with PMA/ionomycin and production of IFN-{gamma} (Th1 differentiation) and IL-5 (Th2 differentiation) was determined by ELISA (BD Pharmingen). For proliferation assays, peripheral lymphocytes were isolated from lymph nodes of wild-type (WT) or mutant mice at the indicated ages, and 1–2 x 105cells/well were incubated in 96-well plates in triplicates at 37°C with the indicated treatment followed by pulse with 1 µCi/well [3H]thymidine for 18 h. After a total of 48–72 h, the cells were harvested and thymidine incorporation was measured using a Betaplate scintillation counter.

Flow cytometry analysis and cytokine assay

Single-cell suspension of thymocytes or peripheral lymphocytes were incubated with the indicated Abs on ice for 15–30 min, assayed with a Coulter flow cytometer, and analyzed with FlowJo software (Tree Star). For cytokine assays, cytometric beads array (BD Pharmingen) was used. Briefly, 50 µl of cell culture medium was incubated with Ab-conjugated beads for 2 h, followed by flow cytometry analysis. For cytokine assays, 2 x 105 cells/well were cultured for 24 h and either left unstimulated or stimulated with plate-bound anti-CD3 (1 µg/ml) for 24 h. Culture medium was assayed for cytokine production. Serum IgG2a level was measured using a RID kit (R&D Systems).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Failure to export NFATc1 causes T cell proliferation resistant to cyclosporin A (CsA)

To explore the function of NFATc1 in T cells, a strain of mice was constructed that express a constitutively active and nuclear NFATc1 variant (NFATc1nuc) under the control of the Tet-responsive promoter (Tet-O). We used the EµSR promoter to direct expression of the Tet transcriptional activator (tTA) to T cells, thereby allowing us to temporally control the expression of NFATc1nuc in these double-transgenic mice (referred to as NFATc1nuc mice, Fig. 1A) (20). In double-transgenic mice, NFATc1nuc expression is driven by the tTA. When the cell or mice are treated with doxycycline (a Tet derivative), NFATc1nuc expression is turned off. EµSR-tTA-transgenic mice were also crossed to a control strain of mice to express WT NFATc1, Tet-O-NFATc1wt (NFATc1wt). Using Western blotting with the anti-HA Ab, the nuclear HA-tagged NFATc1 variant (NFATc1nuc) was detected in the thymus, but not other tissues or organs (Fig. 1B, lane 10). Despite multiple attempts, NFATc1nuc protein was not detectable in peripheral lymph nodes and spleen by anti-HA Ab Western blot (Fig. 1B and Ref. 21). This reflects that a very small amount of NFATc1nuc protein was expressed by lymph node and spleen, consistent with our observation in Fig. 2A that NFATc1nuc expression was well below the level of endogenous NFATc1 isoforms (see next paragraph). Using RT-PCR (Fig. 1C), expression of NFATc1nuc was detected in NFATc1nuc thymus, CD4+, CD8+, CD4–CD8–, and CD4+CD8+ T cells but not B cells or macrophages (21). NFATc1nuc was also expressed in osteoblasts detectable only by RT-PCR where it functions as a dominant regulator of bone homeostasis as demonstrated in our recently published work (21). This expression pattern is consistent with our previous studies of the EµSR-tTA-transgenic mice (20).


Figure 2
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 2. Nuclear expression of NFATc1nuc and CsA inhibition. A, Nuclear localization of NFATc1nuc. Nuclear and cytoplasmic extracts of thymocytes from WT or NFATc1nuc mice were blotted with the indicated Abs. Thymocytes were left untreated or treated with ionomycin (I, 22 nM) or ionomycin plus CsA (I + CsA, 1µg/ml) for 1 h. Brg1 is a nuclear protein and HSP-90 is a cytoplasmic protein for controls. Lanes 1–3 are nuclear extracts purified from WT thymocytes left untreated, treated with ionomycin (I), or ionomycin plus CsA (I + CsA). Lanes 4–6 are nuclear extracts purified from NFATc1nuc thymocytes left untreated, treated with ionomycin (I), or ionomycin plus CsA (I + CsA). Lanes 7–9 are cytoplasmic extracts purified from WT thymocytes left untreated, treated with ionomycin (I), or ionomycin plus CsA (I + CsA). Lanes 10–12 are cytoplasmic extracts purified from NFATc1nuc thymocytes left untreated, treated with ionomycin (I) or ionomycin plus CsA (I + CsA). Positions of NFATc1nuc and endogenous NFATc1 protein isoforms were indicated. Relative densitometry ratios (lanes 2–6 relative to lane 1, which is designated as 1, and lanes 8–12 relative to lane, 7 which is designated as 1) were indicated under each lane after adjusting to the loading controls (anti-Brg1 and anti-HSP90). Two-week-old mice were used. Data are representative of three separate experiments. B, NFATc1nuc T cell activation in the presence of CsA. WT and NFATc1nuc lymph node T cells were treated with anti-CD3 (1µg/ml) with or without CsA (concentration indicated). Four-week-old mice were used. Data are representative of three separate experiments. C, Effect of doxycycline on NFATc1nuc expression in vivo. Western blot of thymocyte lysates from WT mice (lane 1), mice containing NFATc1nuc transgene alone but with the absence of tTA promoter (–tTA, lane 2), untreated NFATc1nuc mice (untreated, lane 3), and doxycycline-treated NFATc1nuc mice (doxycycline, lane 4). Four-week-old mice were used. Data are representative of three separate experiments.

 
We next assayed the expression of NFATc1nuc in the thymus using Western blotting with a mAb against NFATc1 (9). As shown in Fig. 2A, WT T cells contain most of the endogenous NFATc1 isoforms in the cytoplasm when unstimulated (Fig. 2A, lanes 1 and 7). As expected, when ionomycin was added to the WT T cells, all NFATc1 isoforms were imported into the nucleus (Fig. 2A, lane 2) with no detectable NFATc1 protein in the cytoplasm (Fig. 2A, lane 8). Addition of CsA removed most of the NFATc1 isoforms back to the cytoplasm (Fig. 2A, lane 3 and 9). However, in unstimulated NFATc1nuc T cells, a small amount of nuclear NFATc1 was present in the nuclear extracts (Fig. 2A, lane 4), but not in the cytoplasm (Fig. 2A, lane 10), reflecting constitutive presence of NFATc1nuc protein in the nucleus. Similar to the WT T cells, ionomycin resulted in the import of all endogenous NFATc1 isoforms into the nucleus (Fig. 2A, lanes 5 and 11). When CsA was added to the NFATc1nuc T cells, only NFATc1nuc protein was present in the nuclear extracts (Fig. 2A, lane 6), while endogenous NFATc1 isoforms were exported back to the cytoplasm (Fig. 2A, lane 12). The band density of NFATc1nuc in lane 6 of Fig. 2A is approximately one-seventh of the band density of the endogenous NFATc1 isoforms seen in lane 2 of Fig. 2A when measured by relative densitometry, indicating that NFATc1nuc expression was below the level of endogenous NFATc1 protein and hence, was not overexpressed. This is consistent with our observation in Fig. 1B that NFATc1nuc expression was not detectable by Western blotting with anti-HA Ab but only by RT-PCR (Fig. 2C). The endogenous NFATc1 isoforms represent phosphorylated NFATc1 proteins that are compartmentalized in the cytoplasm. NFATc1nuc represent the activated and dephosphorylated NFATc1 isoform migrated as the smallest molecule in the Western blot (Fig. 2A, lanes 4–6). As expected, NFATc1nuc was localized to the nucleus in the absence of Ca2+/calcineurin signals (Fig. 2A, lane 4) and was not exported even in the presence of the calcineurin inhibitor CsA (Fig. 2A, lane 6), which results in rapid nuclear export of endogenous NFATc1 (Fig. 2A, lanes 3, 9, and 12) (17, 18, 19). Peripheral lymphocytes from lymph nodes and spleen gave similar results (data not shown).

To determine whether mutant T cells retain resistance to CsA inhibition, we measured proliferation of the mutant T cells compared to the WT T cells in the presence of CsA. We found that the proliferation of NFATc1nuc T cells in response to anti-CD3 ligation was only partially (~50%) inhibited by CsA concentrations as high as 1000 ng/ml (Fig. 2B, black), in comparison to the complete inhibition of the WT T cells with a concentration of 50 ng/ml (Fig. 2B, gray). This incomplete resistance to CsA inhibition by NFATc1nuc T cells reflects the fact that in addition to NFATc1nuc, other endogenous NFATc proteins (NFATc1, c2, and c3) are also important components for T cell activation.

The Tet-O allowed us to control the expression of NFATc1nuc by administration of doxycycline to the mice. As shown in Fig. 2C, treatment of NFATc1nuc mice in vivo with doxycycline (in feeding water) completely switched off NFATc1nuc expression (Fig. 2C, lanes 3 and 4). We also found that in vitro doxycycline treatment suppressed NFATc1nuc expression within 12 h (data not shown). Consistent with these results, T cells from doxycycline-pretreated NFATc1nuc mice (NFATc1nuc off) showed normal sensitivity to CsA inhibition (data not shown).

T cells from NFATc1nuc mice develop normally but have increased Th1 and Th2 cytokine production without skewing

We found increased CD25-, CD40L-, and CD69-positive CD4+ T cells in the lymph nodes (Fig. 3, A–C) and spleen (data not shown) of NFATc1nuc mice reflecting either spontaneous T lymphocyte activation or autoreactivity. Unlike the NFATc2/NFATc3 double knockout mice (22), CD45 point mutation knock-in mice (22), and CTLA-4 knockout mice (14, 15), NFATc1nuc mice show no evidence of a lymphoproliferative disorder with normal peripheral white blood cell count, normal size and cell number of peripheral lymph nodes (2.5 vs 3.0 x 107 cell/lymph node), and spleen (1.0 vs 1.4 x 108 cell/spleen) compared to the lymphoid organs of age-matched WT mice.


Figure 3
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 3. Activation of NFATc1nuc T cells in vivo and in vitro. Histogram of CD25 (A), CD40L (B), and CD69 (C) expression on CD4+ T cells from lymph nodes of WT (blue) and NFATc1nuc (red) mice. Percentage of positive cells is indicated in parentheses. Numbers of cell are indicated in vertical axis. Four-week-old mice were used. Data are representative of three separate experiments. D and E, Th1/Th2 cytokine production by unstimulated (D) and anti-CD3-stimulated (E) lymph node lymphocytes from WT ({square}), phenotypically less apparent NFATc1nuc mice (2-wk old, Figure 3), and phenotypically more apparent NFATc1nuc mice (4-wk old, {blacksquare}). T cells from lymph nodes were purified by depleting B cells with anti-B220 Ab cross-linked to beads (BD Pharmingen). Note that the unit in Fig. 3D is nanograms per milliliter, while in Fig. 3E it is 100 ng/ml. Data are representative of three separate experiments. F, Serum IgG2a level of WT and NFATc1nuc mice phenotypically less apparent (Early, 2-wk-old mice) and more apparent (Late, 4-wk-old mice). Means from three similar experiments are represented. Asterisk, Statistically significant difference comparing IgG2a levels of phenotypically more apparent mice (Late) to WT and to phenotypically less apparent mice (Early).

 
To determine whether NFATc1nuc T cells produce increased cytokines, NFATc1nuc and control T cells were left unstimulated or stimulated in vitro with anti-CD3 to assess cytokine secretion. Unstimulated and anti-CD3-stimulated peripheral T lymphocytes from lymph nodes of NFATc1nuc mice produced increased Th1 and Th2 cytokines, including IL-2, IL-4, IL-5, TNF-{alpha}, and IFN-{gamma} (Fig. 3, D and E). In addition, as the phenotype of the mutant mice became more apparent over time (2–6 wk), characterized with appearance of cachexia, rough fur, skin inflammation, and other organ damage, the enhanced production of Th1 and Th2 cytokines became even more pronounced (Fig. 2, D and E, gray for early phenotype and black for late phenotype, compared with WT in open squares). Moreover, serum Th1 and Th2 cytokines were elevated in NFATc1nuc mice as well (data not shown). Consistent with the increased cytokine production by NFATc1nuc T cells, serum IgG2a levels was also increased in phenotypically pronounced NFATc1nuc mice (Fig. 3F, Late) compared with the WT (Fig. 3F, WT) and NFATc1nuc mice that were phenotypically not pronounced (Fig. 3F, Early). B cells from NFATc1nuc mice proliferated similarly to control B cells, consistent with the observation that NFAT1nuc was not detectable in B cells (data not shown and Fig. 1B). No differences were found in the expression of Fas, Fas ligand, TGF-beta, CD28, or CTLA-4 on NFATc1nuc T cells compared with WT T cells (data not shown).

We next determined whether doxycycline-treated mutant mice retain increased T cell activation. We found that T cells from doxycycline-treated NFATc1nuc mice proliferated and produced cytokine comparable to WT T cells (data not shown). In addition, transgenic mice expressing WT NFATc1 (NFATc1wt;Eµ-tTA) were indistinguishable from WT mice in all phenotypes examined (data not shown). These control experiments indicate that NFATc1nuc expression is required at the time of activation in vitro and that the increased nuclear occupancy on NFATc1nuc is required for the enhanced activation, proliferation,and cytokine secretion.

Calcineurin, NFATc1, NFATc2, and NFATc3 regulate lymphocyte development, differentiation, and function (3, 22, 23, 24). The increased cytokine production and proliferation could be influenced by the increased percentage of activated and memory T cells in the NFATc1nuc mice. We therefore purified naive CD4+ T cells (CD4+CD62Lhigh) by FACS sorting to 99% purity and examined their proliferation and cytokine production. Purified naive Th cells from NFATc1nuc mice showed increased production of Th1 and Th2 cytokines upon stimulation with anti-CD3 compared with naive T helpers from WT mice (Fig. 4, A and B, column U, black vs white). Under skewing culture conditions, NFATc1nuc expression did not alter the Th1 vs Th2 cell fate. As shown in Fig. 4, IFN-{gamma} production was increased under Th1 conditions but not under Th2 conditions (Fig. 4A, column Th1 and Th2), while IL-5 production was increased only under Th2 conditions but not under Th1 conditions (Fig. 4B, column Th1 and Th2). These results indicate that the nonexportable NFATc1 variant significantly enhanced T cell responses without influencing the differentiation of naive Th cells.


Figure 4
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 4. Differentiation of NFATc1nuc naive Th cells in vitro and negative selection of thymocytes in NFATc1nuc mice. A and B, Naive Th cells (CD4+CD62Lhigh) were isolated and treated under skewed or unskewed conditions as indicated. U, Unskewed condition; Th1, under Th1-skewed conditions; and Th2, under Th2-skewed conditions. WT, {square}); NFATc1nuc mutant ({blacksquare}). IFN-{gamma} represents Th1 cytokine, IL-5 represents Th2 cytokine. Asterisks, Statistically significant difference between levels of cytokine of mutant vs WT. Four-week-old mice were used. Data are representative of three separate experiments. C and D, Negative selection of thymocytes in NFATc1nuc mice in H-Y TCR-transgenic background. Thymocytes from male (C) and female (D) mice of NFATc1nuc or WT 2 wk old were analyzed by flow cytometry. T3.70 represents H-Y male Ag. The cell population expressing T3.70high was gated for CD4 and CD8 profiles. Data are representative of four mice per group.

 
The increased percentage of activated T cells in the periphery could result from a failure to properly censor the development of autoreactive T cells in the thymus, the expansion of a clonal population of T cell in the periphery, a failure to develop regulatory T cells, or a generalized increase in peripheral T cell reactivity (25). NFATc1nuc expression did not alter thymocyte-positive selection nor could NFATc1nuc drive positive selection of NFATc1nuc;TCR{alpha}–/– thymocytes (data not shown). To assess thymic-negative selection, the NFATc1nuc mice were bred to HY TCR-transgenic mice in which thymocytes are positively selected in female mice but negatively selected in male mice. NFATc1nuc;HY TCR+ female mice had normal CD8 single-positive cell development. NFATc1nuc;HY TCR+ male mice had normal negative selection consistent with the observation that the calcineurin phosphatase is dispensable for negative selection (Fig. 4, C and D, and Ref. 26). Regulatory T cells were present at normal numbers and present in NFATc1nuc thymi and peripheral lymph node organs of young mice as measured by flow cytometry, indicating that there was no gross defect in the generation of regulatory T cells (data not shown). Longitudinal studies showed no dramatic changes in Vbeta gene usage over several months, suggesting the absence of hyperproliferation and selection of specific T cell clones (data not shown). These results indicate that NFATc1nuc does not perturb T cell development, alter regulatory T cell development, or lead to the clonal expansion of autoreactive cells. Therefore, based on these observation and the hyperreactivity of NFATc1nuc CD4+ T cells in vitro, we conclude that enhanced nuclear NFAT leads to a generalized hyperresponsive T cell activation, proliferation, and function (Fig. 3).

Nuclear NFATc1 allows T cell activation independent of CD28 costimulation

Maximal and sustained T cell activation requires costimulation through CD28 (27). CD28 stimulation leads to PI3K activation and the activation of AKT (4, 5), which directly phosphorylates and inhibits the activity of GSK3 (4). Because GSK3 has been shown to be an export kinase for NFATc1 (7, 10), it is possible that one of the functions of CD28 is to block GSK3-dependent export of NFATc1, leading to the enhanced accumulation of NFATc in the nucleus. Indeed, this mechanism is consistent with our analysis of gene expression after CD3 and CD28 ligation (7) and the observation that CTLA-4 inhibits nuclear accumulation of NFAT transcription complexes (28). This model of CD28 function also predicts that mice expressing nonexportable NFATc1 should not require CD28 costimulation for full activation. This proved to be correct in experiments with bulk peripheral lymph node T cells (Fig. 5A) and purified naive Th cells (Fig. 5, B and C). As shown in Fig. 5A, NFATc1nuc T cells show much higher proliferation to anti-CD3 stimulation alone (Fig. 5A, dark gray) compared with WT T cells stimulated with anti-CD3 plus anti-CD28 (Fig. 5A, medium gray). In addition, NFATc1nuc T cells show no increased proliferation to addition of anti-CD28 on top of anti-CD3 (Fig. 5A, black) compared with anti-CD3 alone (Fig. 5A, dark gray). These results indicate that CD28 costimulation was no longer required for maximal activation of the mutant T cells expressing NFATc1nuc (Fig. 5A). We also found that NFATc1nuc naive Th cells displayed similar characteristics (Fig. 5, B and C). As shown in Fig. 5B, WT naive T cells showed little proliferation to anti-CD3 alone (Fig. 5B, light gray) but increased proliferation upon addition of anti-CD28 (Fig. 5B, medium gray), while NFATc1nuc naive Th cells showed a much higher proliferation to anti-CD3 stimulation alone (Fig. 5B, black) compared to WT naive Th cells stimulated with anti-CD3 plus anti-CD28 (Fig. 5B, medium gray). When anti-CD28 was added to the mutant naive Th cells stimulated with anti-CD3, a residual costimulation by anti-CD28 was observed (Fig. 5B, dark gray). We also determined whether IL-2 production by the NFATc1nuc naive T cells is independent of CD28 costimulation. As shown in Fig. 5C, mutant Th cells stimulated with anti-CD3 alone (Fig. 5C, gray) produced similar levels of IL-2 as the WT T naive cells stimulated with both anti-CD3 and anti-CD28 (Fig. 5C, black). Mutant Th cells stimulated with anti-CD3 plus anti-CD28 showed an added increase of IL-2 levels (Fig. 5C, black, right column). It is possible that part of the mechanism of the increased IL-2 production resulted from increased IL-2 mRNA stability in NFATc1nuc T cells (7), in addition to increased gene expression.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 5. Activation of NFATc1nuc T cells by anti-CD3 with or without anti-CD28. A, Bulk lymph node lymphocytes isolated from WT (light and medium gray) or NFATc1nuc mice (dark gray and black) were stimulated with coated anti-CD3 Ab alone (light and dark gray), or plus anti-CD28 Ab (2 mg/ml) (medium gray and black). Four-week-old mice were used. Data are representative of three separate experiments. B, Activation of naive NFATc1nuc Th cells. Purified CD4+CD62Lhigh cells from WT (light and medium gray) or NFATc1nuc mice (dark gray and black) were stimulated with coated anti-CD3 alone (light and dark gray), or plus anti-CD28 Ab (2 mg/ml; medium gray and black). Four-week-old mice were used. Data are representative of three separate experiments. C, IL-2 production by WT or NFATc1nuc naive T cells. Naive T cells purified from lymph nodes were left unstimulated (NS), stimulated with coated anti-CD3 (1 mg/ml; 3), or stimulated with coated anti-CD3 (1 mg/ml) plus anti-CD28 (2 mg/ml; 3 + 28). The first three columns were from WT mice. The last three columns were from mutant mice. Means of three experiments are represented and asterisks indicate statistically significant difference between anti-CD3 alone and anti-CD3 plus anti-CD28. Four-week-old mice were used.

 
Nuclear NFATc1 destabilizes the NFATc1-positive feedback loop

NFATc1 positively regulates its own transcription using a group of NFAT binding sites within its enhancer/promoter (29, 30). This positive feedback loop is normally opposed by Dyrk1a/GSK3-dependent export as well as by the endogenous calcineurin inhibitors such as the Down syndrome critical region 1 (DSCR1) protein and others (7, 10, 11, 12) (Fig. 6C). Expression of a nonexportable NFATc1 variant at low levels lowered the threshold for T cell activation and additionally destabilized the NFATc1-positive feedback loop leading to runaway transcription of endogenous NFATc1 (Fig. 6A) and other genes such as CD40L and Th1 and Th2 cytokines (Fig. 3). As shown in Fig. 6A, when NFATc1nuc mice were not ill, the expression of NFATc1 was low in T cells (Fig. 6A, lane 2). However, when NFATc1nuc mice became grossly ill, expression of all endogenous NFATc1 isoforms (C1 {alpha}, beta, {gamma}) was dramatically increased in the T cells (Fig. 6A, lane 3). This increase in NFATc1 may contribute to CD28 independence by increasing the total NFATc1 molecules in the cell and in the nucleus after activation, consistent with the notion that CD28 inhibits GSK3 to reduce the nuclear export of NFATc1 (4, 5). In addition, NFATc2 proteins were also increased and a greater percentage of NFATc2 was in activated and dephosphorylated form (Fig. 6B, lane 2). This positive autoregulation of NFATc1 eliminates the dependence on its upstream calcineurin signaling which normally controls the NFATc function in T cells by dephosphorylating the sites that are phosphorylated by GSK3 (Fig. 6C). NFATc1nuc is a constitutively activated mutant independent of calcineurin activation (8, 16, 17, 18, 19). Calcineurin is negatively regulated by a number of proteins such as Cabin, DSCR1, CHIP, and others (Fig. 6C) (11, 12, 31, 32, 33). The nuclear expression of constitutively activated NFATc1nuc with mutated GSK3 phosphorylation sites in T cells bypasses the negative regulation by these proteins and by GSK3, leading to deregulated expression of endogenous NFATc1 by positive autoregulation. Coupled with the increased expression of activation Ags and cytokines (Fig. 3), these results indicate that destabilizing the NFATc1-positive feedback loop can lead to CD28-independent hypersensitive activation of T cells.


Figure 6
View larger version (13K):
[in this window]
[in a new window]

  		FIGURE 6. Destabilization of NFATc1 feedback loop in NFATc1nuc T cells. A, Anti-NFATc1 Western blot of lymph node lymphocyte from WT, phenotypically less (Early, mice at 2 wk old), and more apparent (Late, mice at 4 wk old) NFATc1nuc mice. Positions of NFATc1nuc and endogenous NFATc1 isoforms (C1{alpha}, beta, and {gamma}) are indicated. Data are representative of three separate experiments. B, Anti-NFATc2 Western blot of lymph node lymphocytes from WT (mice at 2 wk old) and phenotypically apparent NFATc1nuc mice (mice at 4 wk old). Positions of phosphorylated (p-NFATc2) and dephosphorylated NFATc2 (NFATc2) are indicated. Data are representative of two separate experiments. C, Diagram of destabilization of the NFATc1-positive feedback loop leading to CD28-independent T cell activation in NFATc1nuc T cells. In the normal immune response, GSK3 and other proteins (7 8 9 10 ) negatively regulate the positive feedback of TCR-stimulated NFATc1 production (diagram on left: GSK3 with arrows, DSCR1, Cabin, CHIP). In NFATc1nuc T cells, negative regulation by GSK3 is removed by mutating the GSK3 phosphorylation sites of NFATc1 (diagram on right: disappearance of GSK3 with arrows and of DSCR1, Cabin, CHIP), destabilizing the positive feedback loop, leading to a lower threshold of T cell activation and cytokine production independent of calcineurin activation. DSCR1, Cabin, and CHIP are direct calcineurin inhibitors (11 12 31 32 33 ). Cn, Calcineurin.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The calcineurin-regulated NFATc transcription factors are key regulators of both T and B cell function (24, 34). CsA is a clinically important immunosuppressant that inhibits T cell activation by blocking calcineurin phosphatase activity and by inhibiting the nuclear import of NFATc proteins (8, 9, 10). Our data show that activation of T cells expressing the nonexportable nuclear NFATc1 variant can only be partially inhibited by CsA, indicating that NFATc1 nuclear occupancy is an important component sustaining T cell activation. TCR stimulation alone without costimulation of coreceptors such as CD28 leads to T cell anergy rather than cell activation. This is likely a result of rapid nuclear shuffling of NFAT proteins, reflecting inadequate nuclear NFAT occupancy under anti-CD3 stimulation alone. We hypothesized that costimulation of coreceptors such as CD28 inhibits GSK3, leading to continuous nuclear retention of NFAT proteins (4, 5, 7, 10). We show here that an NFATc1 variant lacking GSK3 phosphorylation sites displays constitutive nuclear expression, leading to maximal T cell activation independent of CD28 costimulation (Fig. 5). Our data indicate that enhancing nuclear occupancy of NFAT proteins is an important signaling mechanism of CD28 costimulation.

In addition to CD28, other costimulatory molecules have been shown to activate the PI3 kinase pathway. These molecules include LFA-1 (35) and ICAM (36) and these receptors may also use the mechanism of enhancing nuclear residence of NFATc1 to accomplish their costimulatory signals.

Our data are consistent with NFATc1 exerting a primarily stimulatory role in T cells consistent with the data from NFATc1-deficient T cells (37). In contrast, NFATc2 may have both an inhibitory and stimulatory role in regulating T cell anergy and activation (24, 38), and NFATc2/c3 double knockout mice develop a lymphoproliferative disorder (22). Collectively, these results highlight the multiple important roles that the NFATc transcription factor plays in regulating and coordinating the immune response.

Despite very low expression of NFATc1nuc (below that of endogenous NFATc1), NFATc1nuc mice developed a disease characterized by multiorgan damage involving the lungs, liver, kidney, and several other organs (data not shown). This disease occurs normally 2–4 wk postnatal and progresses over 2–6 wk to severe phenotype and death. However, NFATc1nuc mice still developed this disease on a TCR{alpha}- or Rag2-deficient background, indicating that the pathogenesis of the disease is T cell independent (data not shown). The disease was prevented and reversed when the mutant mice were treated with doxycycline (data not shown), indicating that expression of NFATc1nuc was responsible for the disease, but the cell type in which NFATc1nuc functions is less clear. Further studies will be required to determine the cellular and molecular mechanism that leads to this disease.

In summary, the expression of a nonexportable NFATc1 variant obviates the need for CD28 costimulation in T cell activation, indicating that one of the functions of CD28 signaling is to regulate the nuclear retention of NFATc transcription factors.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work has been supported partially by a Lymphoma Research Foundation Fellowship (to M.P.), a Stanford Graduate Fellowship (to M.M.W.), and a Howard Hughes Medical Institute Predoctoral Fellowship (to M.M.W.). Back

2 Address correspondence and reprint requests to Dr. Minggui Pan, Division of Oncology-Hematology, Kaiser Permanente Medical Center, Santa Clara, CA 95051 or Dr. Gerald R. Crabtree, Howard Hughes Medical Institute, Stanford, CA 94305. E-mail addresses: minggui.pan{at}kp.org or crabtree{at}stanford.edu Back

3 Abbreviations used in this paper: GSK3, glycogen synthase kinase; DSCR-1, Down syndrome critical region 1; CD40L, CD40 ligand; HA, hemagglutinin; Tet, tetracycline; tTA, Tet transcriptional factor; WT, wild type; CsA, cyclosporin A; CHIP, direct calcineurin inhibitor. Back

Received for publication November 22, 2006. Accepted for publication January 19, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Salomon, B., J. A. Bluestone. 2001. Complexity of CD 28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu. Rev. Immunol. 19: 225-252. [Medline]
  2. Macian, F., F. Garcia-Cozar, S.-H. Im, H. F. Horton, M. C. Byrne, A. Rao. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109: 719-731. [Medline]
  3. Crabtree, G. R.. 2001. Calcium, calcineurin, and the control of transcription. J. Biol. Chem. 276: 2313-2316. [Free Full Text]
  4. Rossig, L., C. Badorff, Y. Holzmann, A. M. Zeiher, S. Dimmeler. 2002. Glycogen synthase kinase-3 couples AKT-dependent signaling to the regulation of p21Cip1 degradation. J. Biol. Chem. 277: 9684-9689. [Abstract/Free Full Text]
  5. Pages, F., M. Ragueneau, R. Rottapel, A. Truneh, J. Nunes, J. Imbert, D. Olive. 1994. Binding of phosphatidylinositol-3-OH kinase to CD28 is required for T-cell signaling. Nature 369: 327-329. [Medline]
  6. Reya, T., H. Clevers. 2005. Wnt signaling in stem cells and cancer. Nature 434: 843-850. [Medline]
  7. Diehn, M., A. A. Alizadeh, O. J. Rando, C. L. Liu, K. Stankunas, D. Botstein, G. R. Crabtree, P. O. Brown. 2002. Genomic expression programs and the integration of the CD28 costimulatory signal in T cell activation. 2002. Proc. Natl. Acad. Sci. USA 99: 11796-11801. [Abstract/Free Full Text]
  8. Northrop, J. P., S. N. Ho, L. Chen, D. J. Thomas, L. A. Timmerman, G. P. Nolan, A. Admon, G. R. Crabtree. 1994. NF-AT components define a family of transcription factors targeted by T-cell activation. Nature 369: 497-502. [Medline]
  9. Beals, C. R., N. A. Clipstone, S. N. Ho, G. R. Crabtree. 1997. Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes Dev. 11: 824-834. [Abstract/Free Full Text]
  10. Beals, C. R., C. M. Sheridan, C. W. Turck, P. Gardner, G. R. Crabtree. 1997. Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science 275: 1930-1933. [Abstract/Free Full Text]
  11. Arron, J. R., M. M. Winslow, A. Polleri, C.-P. Chang, H. Wu, X. Gao, J. Neilson, L. Chen, J. J. Heit, N. Yamasaki, et al 2006. NFAT dysregulation by increased dosage of DSCR1 and DYRK1A on chromosome 21. Nature 441: 595-601. [Medline]
  12. Gwack, Y., S. Sharma, J. Nardone, B. Tanasa, A. Iuga, S. Srikanth, H. Okamura, D. Bolton, S. Feske, P. G. Hogan, A. Rao. 2006. A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as regulators of NFAT. Nature 441: 646-651. [Medline]
  13. Engelhardt, J. J., T. J. Sullivan, P. J. Allison. 2006. CTLA-4 overexpression inhibits T cell responses through a CD28–B7-dependent mechanism. J. Immunol. 177: 1052-1061. [Abstract/Free Full Text]
  14. Tivol, E. A., F. Borriello, A. N. Schweitzer, W. P. Lynch, J. A. Bluestone, A. H. Sharp. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3: 541-546. [Medline]
  15. Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K. P. Lee, C. B. Thompsom, H. Griesser, T. W. Mak. 1995. Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science 270: 985-988. [Abstract/Free Full Text]
  16. Okamura, H., J. Aramburu, C. Garcia-Rodriguez, J. P. Viola, A. Raghavan, M. Tahiliani, X. Zhang, J. Qin, P. G. Hogan, A. Rao. 2000. Concerted dephosphorylation of the transcription factor NFAT1 induces a conformational switch that regulates transcriptional activity. Mol. Cell 6: 539-550. [Medline]
  17. Neilson, J., K. Stankunas, G. R. Crabtree. 2001. Monitoring the duration of antigen-receptor occupancy by calcineurin/glycogen-synthase-kinase-3 control of NF-AT nuclear shuttling. Curr. Opin. Immunol. 13: 346-350. [Medline]
  18. Timmerman, L. A., N. A. Clipstone, S. N. Ho, J. P. Northrop, G. R. Crabtree. 1996. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383: 837-840. [Medline]
  19. Flanagan, W. M., B. Corthesy, R. J. Bram, G. R. Crabtree. 1991. Nuclear association of a T-cell transcription factor blocked by FK506 and cyclosporin A. Nature 352: 803-807. [Medline]
  20. Felsher, D. W., J. M. Bishop. 1999. Reversible tumorigenesis by Myc in hematopoietic lineages. Mol. Cell 4: 199-205. [Medline]
  21. Winslow, M. M., M. Pan, M. Starbuck, E. M. Gallo, L. Deng, G. Karsenty, G. R. Crabtree. 2006. Calcineurin/NFAT signaling in osteoblasts regulates bone mass. Dev. Cell 10: 771-782. [Medline]
  22. Rengarajan, J., B. Tang, L. H. Glimcher. 2002. NFATc2 and NFATc3 regulate TH2 differentiation and modulate TCR-responsiveness of naive TH cells. Nat. Immunol. 3: 48-54. [Medline]
  23. Majeti, R., Z. Xu, T. G. Parslow, J. L. Olson, D. I. Daikh, N. Killeen, A. Weiss. 2000. An inactivating point mutation in the inhibitory wedge of CD45 causes lymphoproliferation and autoimmunity. Cell 103: 1059-1069. [Medline]
  24. Peng, S. L., A. J. Gerth, A. M. Ranger, L. H. Glimcher. 2001. NFATc1 and NFATc2 together control both T and B Cell activation and differentiation. Immunity 14: 13-20. [Medline]
  25. Kisielow, P., H. Bluthmann, U. D. Staerz, M. Steinmetz, H. V. Boehmer. 1998. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333: 742-746.
  26. Neilson, J. R., M. M. Winslow, E. M. Hur, G. R. Crabtree. 2004. Calcineurin B1 is essential for positive but not negative selection during thymocyte development. Immunity 20: 255-266. [Medline]
  27. Chambers, C. A., J. P. Allison. 1999. Costimulatory regulation of T cell function. Curr. Opin. Cell Biol. 11: 203-210. [Medline]
  28. Brunner, M. C., C. A. Chambers, F. Chan, J. Hanke, A. Winoto, J. P. Allison. 1999. CTLA-4-mediated inhibition of early events of T cell proliferation. J. Immunol. 15: 5813-5820.
  29. Chuvpilo, S., E. Jankevics, D. Tyrsin, A. Akimzhanov, D. Moroz, M. K. Jha, J. Schulze-Luehrmann, B. Santner-Nanan, E. Feoktistova, T. König, et al 2002. Autoregulation of NFATc1/A expression facilitates effector T cell to escape from rapid apoptosis. Immunity 16: 881-895. [Medline]
  30. Zhou, B., R. Q. Cron, B. Wu, A. Genin, Z. Wang, S. Liu, P. Robson, H. S. Baldwin. 2002. Regulation of the murine Nfatc1 gene by NFATc2. J. Biol. Chem. 277: 10704-10711. [Abstract/Free Full Text]
  31. Lai, M. M., P. E. Burnett, H. Wolosker, S. Blackshaw, S. H. Snyder. 1998. Cain, a novel physiologic protein inhibitor of calcineurin. J. Biol. Chem. 273: 18325-18331. [Abstract/Free Full Text]
  32. Sun, L., H.-D. Youn, C. Loh, M. Stolow, W. He, J. O. Liu. 1998. Cabin1, a negative regulator for calcineurin signaling in T lymphocytes. Immunity 8: 703-711. [Medline]
  33. Kafadar, K. A., H. Zhu, M. Snyder, M. S. Cyert. 2003. Negative regulation of calcineurin signaling by Hrr25p, a yeast homolog of casein kinase I. Genes Dev. 17: 2698-2708. [Abstract/Free Full Text]
  34. Macian, F.. 2005. NFAT proteins: key regulators of cell development and function. Nat. Immunol. 5: 474-484.
  35. Van Seventer, G. A., E. Bonvini, H. Yamada, A. Conti, S. Stringfellow, C. H. June, S. Shaw. 1992. Costimulation of T cell receptor/CD3-mediated activation of resting human CD4+ T cells by leukocyte function-associated antigen-1 ligand intercellular cell adhesion molecule-1 involves prolonged inositol phospholipid hydrolysis and sustained increase of intracellular Ca2+ levels. J. Immunol. 149: 3872-3880. [Abstract]
  36. Chirathaworn, C., J. Kohlmeier, S. Tibbetts, L. Rumsey, M. Chan, S. Benedict. 2002. Stimulation through intercellular adhesion molecule-1 provides a second signal for T cell activation. J. Immunol. 168: 5330-5337.
  37. Yoshida, H., H. Nishina, H. Takimoto, L. M. Marengère, C. Andrew, A. C. Wakeham, D. Bouchard, Y. Kong, T. Ohteki, A. Shahinian, et al 1998. The Transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production. Immunity 8: 115-124. [Medline]
  38. Xanthoudakis, S., J. P. B. Viola, K. Shaw, C. Luo, J. D. Wallace, P. T. Bozza, T. Curran, A. Rao. 1996. An enhanced immune response in mice lacking the transcription factor NFAT1. Science 272: 892-895. [Abstract]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C. Scotta, M. Soligo, C. Camperio, and E. Piccolella
FOXP3 Induced by CD28/B7 Interaction Regulates CD25 and Anergic Phenotype in Human CD4+CD25- T Lymphocytes
J. Immunol., July 15, 2008; 181(2): 1025 - 1033.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, M.
Right arrow Articles by Crabtree, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, M.
Right arrow Articles by Crabtree, G. R.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*(L)-ALANINE
*CYCLOSPORIN A
*L-SERINE

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS