|
|
||||||||




* Department of Biomedical Sciences and
Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada;
Center for Transgene Technology, Flanders Interuniversity Institute for Biotechnology, University of Leuven, Leuven, Belgium; and
Department of Anatomy and Cell Biology, Queens University, Kingston, Ontario, Canada
| Abstract |
|---|
|
|
|---|
chain null mice and in laser capture-microdissected B6 uNK cells. Histopathologic consequences from PlGF deletion were also characterized in the implantation sites from PlGF null mice. In B6, decidual PlGF expression rose between gd816. uNK cells were among several types of cells transcribing PlGF in decidualized endometrium. Immature uNK cells, defined by their low numbers of cytoplasmic granules, were the uNK cells displaying the greatest number of transcripts. PlGF deletion promoted the early differentiation high numbers of binucleate uNK cells (gd8) but had no other significant, morphometrically detectable impact on implantation sites. Thus, in mice, PlGF plays an important role in successful uNK cell proliferation and/or differentiation. | Introduction |
|---|
|
|
|---|
Human maternal endometrial cells also express PlGF and VEGF. VEGF is expressed by endometrial glands and macrophages, whereas uterine NK (uNK) cells express both PlGF and VEGF (4, 5, 6). uNK cells are an abundant CD56bright endometrial lymphocyte subset found transiently during endometrial decidualization late in menstrual cycles and in early pregnancy (7). Recently, human uNK cells were shown to be distinct from blood CD56bright cells by their ability to produce biologically active angiogenic factors, including PlGF, and to promote trophoblast invasion (8). VEGF-C, a molecule important for lymphatic endothelial cell differentiation, and NKG5, an endothelial cell mitogen, are expressed by human uNK cells (5, 9). Genetic studies further suggest that relationships promoting activation of human uNK cells decrease risk for pre-eclampsia (10). Low levels of PlGF have been suggested as a useful diagnostic tool for this syndrome before clinical manifestations (11, 12, 13).
Functions of human pregnancy-associated uNK cells are not fully defined, but strong evidence from animal models supports the concept that uNK cells are major participants in the early vascular changes in pregnant endometrium. Angiogenic roles have been described for murine and porcine uNK cells (VEGF mRNA and protein; Refs. 14, 15, 16, 17). Furthermore, in mice lacking uNK cells, the endometrial/maternal spiral arteries feeding into developing placentae (PL) do not undergo normally expected, pregnancy-associated changes in structure (18). IFN-
treatment of pregnant alymphoid mice induces appropriate arterial modification, suggesting that this uNK cell product has essential roles in endometrial support of PL (19). Murine uNK cells are extremely localized within implantation sites, appearing only on the mesometrial side of the uterus. Between gestation day (gd)511 (20, 21), uNK cells proliferate, gain increasing numbers of cytoplasmic granules, and form a transient lymphoid structure known variously as the mesometrial lymphoid aggregate of pregnancy (MLAp), metrial gland, or decidualized mesometrial triangle. This mural structure surrounds the radial branches of the uterine artery as they arborize into the endometrial spiral arteries. Pregnancy-associated structural changes in murine spiral arteries are detected histologically at gd910, just before the gd11 onset of death in uNK cells. An analogous decline in human uNK cell numbers occurs about midgestation (22). Murine spiral arterial modification may differ from that seen in women because intralumenal trophoblast invasion occurs in arterial segments more restricted in proximity to the PL (terminal 150 µm; Ref. 20). By midgestation, most murine uNK cells (>65%) are intimately associated with endometrial vessels and 10% are intravascular (23), suggesting that uNK cells directly influence vascular smooth muscle, endothelium, and possibly conducted responses in these vessels.
PlGF null mice (2) are born at Mendelian frequency. They are healthy, fertile, and are reported to show only minor deficits in remodeling of retinal vessels and less angiogenesis in ovarian corpora lutea than normal controls. No information is available on uNK cells and their target spiral arterial and decidual tissues in PlGF null mice. This study was undertaken to characterize PlGF in mouse implantation sites.
| Materials and Methods |
|---|
|
|
|---|
Male and female C57BL6/J (B6) mice were purchased from The Jackson Laboratory, housed, and mated for timed pregnancies under standard conditions at the University of Guelph. Alymphoid (NK-, T-, B-) Rag2 null/common
chain (
c) null mice on a B6 background were bred under barrier husbandry at the University of Guelph from foundation stock provided by Dr. J. P. Di Santo (Pasteur Institute, Paris, France). Some pregnant B6 and Rag2 null/
c null females were perfused with 4% paraformaldehyde, and their implantation sites were processed into paraffin blocks for immunohistochemistry. Additional implantation sites from multiple B6 matings at each of gd6, 8, 10, and 12 were frozen in isopentane chilled on dry ice and used to prepare cryostat sections for laser capture microdissection (LCM). For RNA isolation, mesometrial endometrium was dissected from nonpregnant uteri or implantation sites of three or more B6 and Rag2 null/
c null females on each of gd6, 8, 10, 12, 14, 16, and 18.
Homozygous matings of PlGF null mice and their congenic controls were prepared at Katholieke Universiteit (Leuven, Belgium). These incipient inbred mice had been repeatedly backcrossed to C57BL/6. Pregnancies from four PlGF null females and three congenic controls were examined at each time point. Mated females were perfused, and dissected implantation sites were prepared as paraffin-embedded blocks and shipped to Canada for histological study. No resorbing fetuses were detected in the PlGF null mice.
RNA isolation from C57BL/6J and Rag2 null/
c null mesometrial endometrium
Total RNA was extracted, using RNeasy mini kit (Qiagen) per the manufacturers instructions, from mesometrial endometrium of nonpregnant uteri or from dissected decidua basalis (DB) or MLAp of implantation sites. Similar tissues from a single pregnant uterus were pooled. Briefly, 30 mg of tissue were disrupted by homogenization and the tissue lysate was centrifuged (15,000 x g, 3 min). The cleared lysate was mixed with 700 µl of 70% ethanol. The reaction mixture was loaded on a RNeasy mini column and centrifuged (8,000 x g, 30 s). Columns were washed (500 µl each of wash buffer), centrifuged (8,000 x g, 2 min), and RNA was eluted in 50 µl of nuclease-free water. cDNA was prepared from these RNA samples using First-Strand cDNA synthesis kit (Amersham Biosciences).
LCM of uNK cells, RNA isolation, and cDNA synthesis
Implantation sites collected for LCM from gd612 B6 mice were embedded using Cryomatrix (ThermoShandon) in a plastic mold over dry ice. Cryostat sections were cut at 7 µm, placed on glass slides (Fisher Scientific), and either stored at 80°C for subsequent use or stained immediately using a rapid Dolichos biflorus agglutinin (DBA) lectin-staining protocol to identify uNK cells as described previously (24). DBA lectin staining produces a distinct brown coloration over the surface of all uNK cells and over the membranes encapsulating uNK cell cytoplasmic granules once granules begin to develop. LCM was performed using the PixCell IIe system (Arcturus Engineering). Stained uNK cells were evaluated at x400 microscopic magnification to estimate the number of cytoplasmic granules and the diameter of each cell. Both of these parameters normally increase as uNK cells mature (21). Approximately 200300 morphologically homogeneous uNK cells of each of four distinct subtypes were collected by focal laser melting of the thermoplastic film from the cap onto the individual desired cells using multiple implantation sites for cell harvesting (24). The four uNK cell subtypes used were as follows: 1) agranular (AG; DBA+, <9-µm diameter); 2) immature (IM; DBA+,
13-µm diameter, <5 cytoplasmic granules); 3) granular (DBA+, 20- to 30-µm diameter, heavily granulated <10 cytoplasmic granules); or 4) senescent (DBA+, >30-µm diameter, apoptotic nuclei, vacuolated cytoplasm, irregular rather than rounded shape >10 cytoplasmic granules). Each subtype was harvested on the gd when it was the most abundant uNK cell type present. RNA extraction from captured uNK cells was done using the Picopure RNA isolation kit (Arcturus), and two rounds of antisense RNA (aRNA) amplification were conducted using MessageAmp II aRNA kit (Ambion) per manufacturers instructions. The aRNA obtained after RNA amplification from the LCM-isolated uNK cells and total RNA extracted from implantation sites were reverse transcribed using the First-Strand cDNA synthesis kit (Amersham Biosciences). The resultant cDNA was used as a template for real-time PCR.
Quantitative real-time PCR
Real-time PCR (LightCycler; Roche Diagnostics) was used to quantify PlGF expression relative to
-actin in mesometrial endometrium and in uNK cells. Primers were designed using the Primer 3 software program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.egi). PlGF primers are forward primer (TGCTGGTCATGAAGCTGTTC) reverse primer (GGACACAGGACGGACTGAAT), product size 222 bp and B-actin forward primer (TCTGGCACCACACCTTCTA) reverse primer (AGGCATACAGGGACAGCAC), product size 190 bp. For quantification of PlGF expression, the SYBR Green PCR kit (Qiagen) was used. LightCycler reactions were performed in 20 µl of total reaction volume, using the manufacturers instructions. PCR products were gel purified using the Wizard DNA purification system (Promega), and/or plasmid DNA with specific inserts were quantified and diluted serially to generate standard curves for the gene of interest. The resulting amplified products were sequenced to reconfirm amplification efficiency. Each reaction mixture contained 2 µl of cDNAs, 10 µl of SYBR Green I master mix, 1 µl of sense and antisense primers (0.5 µM each), and 6 µl of PCR-grade water supplied with the kit. The LightCycler program for each gene was denaturation (94°C, 15 min); PCR amplification and quantification (95°C, 10 s, 58°C, 5 s, 72°C, 20 s) with the fluorescence measurement at specific acquisition temperatures for 5 s, repeated for 45 cycles. The melting program was 7095°C at the rate of 0.1°C/s with continuous fluorescence measurement, with the final cooling step at 40°C. Data were quantified using RelQuant LightCycler analysis software.
Histological and morphometric procedures
Midsaggital serial sections (7 µm) of implantation sites from PlGF null mice and their congenic controls were prepared. Some sections were stained with H&E for general morphology. Other sections were stained with periodic acid-Schiffs (PAS) reagent to reveal uNK cell granules. uNK cells were enumerated in two regions, the DB and the MLAp, using an eyepiece micrometer. For each implantation site studied, a 1-mm2 area of tissue was scored on 11 medial sections, spaced to provide non-overlapping uNK cells (42 µm apart). Three implantation sites were used for each mother studied. The same 11 sections were used for morphometry (Optimas 6.2) of the spiral arteries. Three regions were outlined for each vessel: the lumen surface of the endothelium, the more densely stained matrix in the vessel wall that, in many vessels, was obscured or interrupted by uNK cells and therefore estimated as uniform over the gap area, and an unusual peripheral circumference of mixed cell composition that appeared to be a structural component of the spiral arterial walls. Areas of these regions were compared as ratios. The total surface areas of the PL, DB, and MLAp were also estimated by making three circumscribing measurements. These dimensions were the entire mesometrial side of the implantation site, the PL, including the giant cells, and the MLAp as the area from the uterine circular smooth muscle to the serosa. The area of the DB was estimated by subtraction of the sum of the latter two areas from the first area.
Immunohistochemistry and lectin histochemistry
To detect PlGF and to identify trophoblast cells, immunohistochemistry was performed using implantation sites from B6 and alymphoid mice. The primary Abs (either anti-mouse PlGF Ab (Abcam) or wide-spectrum screening cytokeratin Ab (DakoCytomation)) were applied to the sections at 1/1000 concentration overnight at 4°C. Negative controls used isotype-matched Ab to estimate nonspecific binding of the secondary Ab. PlGF staining was conducted after removal of paraffin blocking of endogenous peroxidase using 0.2% hydrogen peroxide in methanol for 20 min, and blocking of nonspecific binding using 2% BSA for 1 h at room temperature. Cytokeratin staining was conducted after proteinase-K Ag retrieval for 6 min followed by blocking in 1% BSA for 30 min. Sections were then incubated (30 min, room temperature) with HRP-labeled goat anti-mouse IgG (Southern Biotechnology Associates) at 1:500 and revealed using NovaRED for 10 min (Vector Laboratories). Between each step, tissue sections were washed with PBS. Sections were counterstained with hematoxylin before viewing and photography using a Leica photomicroscope.
To identify IM, nongranulated as well as granulated uNK cells in implantation sites from PlGF null mice and their congenic controls, the standard DBA lectin-staining protocol of Paffaro et al. was used (21). ExtrAvidin peroxidase conjugate (Sigma-Aldrich) was used to detect bound biotinylated lectin and was revealed with 3,3'-diaminobenzidine in TBS with 0.1% hydrogen peroxide. These sections were counterstained with hematoxylin.
Statistical analyses
Statistical analyses used ANOVA (SAS software 8.2; SAS Institute). A value of p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
To address endometrial expression of PlGF message during pregnancy, real-time PCR was used to analyze mesometrial samples from virgin or gd618 B6 mice (Fig. 1). PlGF expression was detected in nonpregnant (virgin) B6 endometrium, and this level of expression was not altered at gd6 or -8. By gd10, PlGF expression increased to gd16, then declined at gd18.
|
To establish whether the endometrial cells expressing PlGF included or were restricted to only uNK cells, immunohistochemistry was conducted on gd10 implantation sites from B6 (Fig. 2A) and from alymphoid mice (Fig. 2B). In B6 sites, strong staining was detected in multiple endometrial cell types, including uNK cells. Significant stromal staining was noted perivascular to the spiral arteries and in smooth muscle cells. Spiral arterial endothelium appeared to be nonreactive. In alymphoid mouse implantation sites that are characterized by the absence of uNK cells and MLAp development and by decidual hypocellularity (19), PlGF was abundantly expressed in the PL. Weakly positive stromal cells were present in DB. Myometrial cells and the smooth muscle cells and endothelia of the spiral arteries appeared to be negative.
|
PlGF message was essentially undetectable in the mesometrial endometrium of nonpregnant alymphoid mice (Fig. 1). Pregnancy induced stable expression of PlGF to gd12. At gd6 and -8, endometrial expression of PlGF in alymphoid mice was equivalent to that in B6 mice. This result suggests that lymphocytes are not the cells in murine DB responsible for the early, postimplantation gain in PlGF expression. Between gd1016, there was significantly less PlGF transcription in DB from alymphoid mice than from B6 mice (Fig. 1). This difference suggests that, at midgestation, most decidual PlGF is lymphocyte-derived. PlGF transcription from nonlymphoid cell types showed further waves of elevation at gd14 and -18. Transcript numbers at gd14 were still significantly lower in alymphoid than in B6 mice but at gd18, there was no significant difference. These data indicate that lymphocytes have the potential to contribute to angiogenesis in virgin and pregnant uteri.
PlGF expression in B6 uNK cells
No DBA lectin-reactive lymphocytes are present in virgin B6 uteri or in virgin or pregnant uteri from alymphoid mice. To establish when PlGF transcription occurs during the maturation of uNK cells from proliferating AG to heavily granulated, postmitotic cells, pools of 200300 morphologically homogeneous DBA lectin-reactive uNK cells at different stages of maturation were collected from pregnant B6 uteri by LCM (Fig. 3A). PlGF expression was detected in all four B6 cell pools (AG; <5 granules; >10 granules; vacuolated). High expression was found in very early nongranulated uNK cells, and expression levels increased as granules began to appear at the IM uNK cell stage (Fig. 3B). Because no further increase in transcripts occurred in mature cells having many more granules, PlGF is unlikely to be a granule-associated product. Relative transcript numbers decreased in vacuolated uNK cells compared with IM and mature uNK cells. Loss of transcripts from vacuolated, senescent uNK cells as well as the decline in uNK cell numbers known to occur from gd12 in B6 mice, indicate that the high transcript levels detected in endometrium at gd16 and -18 must be attributed to cell types other than uNK cells.
|
To determine whether PlGF deficiency modifies implantation sites, sites from PlGF null mice and their congenic controls were studied. Sites from PlGF null mice were different from the controls grossly and histologically (Fig. 4A). PlGF null implantation sites were grossly larger. Histopathology attributed this observation to more abundant endometrial (maternal) subregions (Fig. 4B). Of note was the significant enlargement of the MLAp at gd12. This endometrial subregion is where more IM, proliferative uNK cells are found in normal mice (20). PlGF null PLe were significantly smaller (p < 0.05) than the control PL at gd10 and -12 (Fig. 4B) and had not assumed a fully mature shape. Placentae from the null mice were pointed and appeared to retain the shape of the preceding ectoplacental cone stage of development. Cytokeratin reactivity was demonstrated in the PL (Fig. 4C) of both PlGF knockout and wild-type (WT) mice. At gd12, some cytokeratin-reactive migrating trophoblasts were present in DB in both PlGF null and their WT control mice.
|
|
|
| Discussion |
|---|
|
|
|---|
PlGF has three spliced forms, PlGF-1, PlGF-2, and PlGF-3 (31, 32). In the rhesus monkey, where three early stages of pregnancy (lacunar, early villous, and villous PL stages) were studied for PlGF expression by immunohistology (33), weak, transient stromal expression was found on vascular smooth muscle cells and glandular epithelium. Stronger staining appeared in decidual cells as pregnancy progressed, but these cells were not further characterized by lineage or morphology. Because mice have only a single PlGF gene (3), full analysis of PlGF expression in a detailed gestational time course is possible.
As anticipated from the reports of others (34), PlGF (Fig. 2) was abundantly expressed in the murine PL including trophoblast giant cells. Endometrial transcription of PlGF also occurred throughout gestation (Fig. 1).
Gestationally induced endometrial (decidual) expression occurred at times inconsistent with a conclusion that uNK cells were the exclusive source for endometrial PlGF (i.e., in both early (gd6) and late gestation (gd1618)). The study of alymphoid mice also implicated nonlymphoid maternal sources during the first half of gestation. The elevation in PlGF transcription in alymphoid mice during the second half of gestation could be due to migrating trophoblast cells of fetal origin. There is considerable variation in the degree of fetal cell contamination of dissected mouse decidua (35), and study of a larger number of gd1618 animals would be needed to confirm the apparent drop in PlGF transcription in gd16 alymphoid mice. In normal immunocompetent B6 mice, immunoreactive PlGF was found throughout the implantation site. Immunoreactive PlGF associated with uNK cells and with smooth muscle cells of large endometrial arteries and of the myometrial-decidual junction. These data support a previously documented role for PlGF in smooth muscle cells (36) and may explain the unusual vascular morphology observed in PlGF null mouse implantation sites.
The major histological feature found in implantation sites from PlGF null mice was the unusual elevation of binucleate uNK cells in both the MLAp and DB early in pregnancy (gd8). In normal mice, binucleate uNK cells usually represent <4% of the uNK cell population in midgestation DB and they are senescent cells (20, 37). By term, binucleate cells are
10% of normal uNK cells. As shown in Fig. 6A, binucleate uNK cells in PlGF null mice are not morphologically senescent, and they appear to retain their functional capacity to migrate to spiral arteries and into DB (Fig. 6B). Whether these binucleate cells retain functions other than migration and whether any of their functions are at levels equivalent to mononucleate uNK cells cannot be evaluated from this histological study. The uNK cell function of spiral arterial modification was observed in PlGF null implantation sites but with slightly delayed kinetics. This process could result from exclusive actions of mononucleate uNK cells, which are reduced from normal numbers in these implantation sites by the skewed ratio toward binucleate cells or to the combined actions of mono- and binucleate uNK cells with modest functional impairment of the binucleate cells.
Functions attributed to PlGF are the support of growth, differentiation, and migration of endothelial and trophoblast cells (38). Our data suggest that terminal stages in the proliferation and cytokinesis of uNK cells during their lineage maturation also require PlGF, whereas nuclear division does not. PlGF does not appear to be required for commitment to uNK cell maturation or for uNK cell migration. The mechanism for PlGF-mediated effects during uNK cell maturation is likely cell intrinsic because studies of others addressing VEGFR1 did not demonstrate the receptor on murine uNK cells (39). Because only 30% of the gd8 uNK cells of PlGF null mice were binucleate, it is also possible that study of these mice has identified two subsets of uNK cells, perhaps those with and without angiogenic potential or possibly uNK cells of thymic and nonthymic origins (40, 41).
uNK cell division occurs predominantly in the MLAp (20), and the great enlargement of this tissue may reflect its content of very large cells because the absolute numbers of uNK cells, whereas elevated above the controls, would not be adequate to account for the gain in absolute area and in proportion to the MLAp within PlGF null implantation sites. A mild aberration in placental shape and reduced placental growth were also seen in implantation sites from PlGF mice. These outcomes may reflect a separate role for PlGF in trophoblast growth and differentiation. Alternatively, they could arise from a mechanism similar to that more readily recognized in uNK cells in which differentiation of trophoblast cells is being skewed away from proliferative cells (spongiotrophoblast) toward endo-reduplicating trophoblast giant cells. We expected that the complete absence of PlGF would significantly impact mouse implantation sites and block spiral arterial modification. This effect was not observed. Small PL were found but spiral arterial modification was only slightly delayed in PlGF null mice, not prevented as in uNK cell-deficient mice (42). Whether the pathology seen in implantation sites of PlGF null mice could be reversed by VEGF rather than PlGF treatment is a question that, when answered, may shed light on whether VEGF therapy of women at risk for pre-eclampsia will be successful.
| Acknowledgment |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 Address correspondence and reprint requests to Dr. Chandrakant Tayade, Department of Biomedical Sciences, University of Guelph, Guelph, Ontario Canada. E-mail address: ctayade{at}uoguelph.ca ![]()
2 Abbreviations used in this paper: PlGF, placenta growth factor; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; uNK, uterine NK; PL, placenta; gd, gestation day; MLAp, mesometrial lymphoid aggregate of pregnancy;
c, common
-chain; LCM, laser capture microdissection; DB, decidua basalis; DBA, Dolichos biflorus agglutinin; AG, agranular; IM, immature; aRNA, antisense RNA; PAS, periodic acid-Schiff; WT, wild type. ![]()
Received for publication November 8, 2006. Accepted for publication January 15, 2007.
| References |
|---|
|
|
|---|
26 mice. J. Exp. Med. 187: 217-223.
contributes to initiation of uterine vascular modification, decidual integrity, and uterine natural killer cell maturation during normal murine pregnancy. J. Exp. Med. 192: 259-270. Related articles in The JI:
This article has been cited by other articles:
![]() |
T. V. Mallidi, L. E. Craig, S. R. Schloemann, and J. K. Riley Murine Endometrial and Decidual NK1.1+ Natural Killer Cells Display a B220+CD11c+ Cell Surface Phenotype Biol Reprod, August 1, 2009; 81(2): 310 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Wu, B. L. Johnson, Y. Chen, C. T. Ha, and G. S. Dveksler Murine Pregnancy-Specific Glycoprotein 23 Induces the Proangiogenic Factors Transforming-Growth Factor Beta 1 and Vascular Endothelial Growth Factor A in Cell Types Involved in Vascular Remodeling in Pregnancy Biol Reprod, December 1, 2008; 79(6): 1054 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, H. Dong, B. Wang, S. Zhu, and B. A. Croy Dynamic Changes Occur in Patterns of Endometrial EFNB2/EPHB4 Expression During the Period of Spiral Arterial Modification in Mice Biol Reprod, September 1, 2008; 79(3): 450 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Burke, H. Dong, A. D. Hazan, and B. A. Croy Aberrant Endometrial Features of Pregnancy in Diabetic NOD Mice Diabetes, December 1, 2007; 56(12): 2919 - 2926. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tayade, Y. Fang, D. Hilchie, and B. A. Croy Lymphocyte contributions to altered endometrial angiogenesis during early and midgestation fetal loss J. Leukoc. Biol., October 1, 2007; 82(4): 877 - 886. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |