The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tayade, C.
Right arrow Articles by Croy, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tayade, C.
Right arrow Articles by Croy, B. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2007, 178: 4267-4275.
Copyright © 2007 by The American Association of Immunologists, Inc.

Genetic Deletion of Placenta Growth Factor in Mice Alters Uterine NK Cells

Chandrakant Tayade1,*, David Hilchie*, Hong He*, Yuan Fang*, Lieve Moons{ddagger}, Peter Carmeliet{ddagger}, Robert A. Foster{dagger} and B. Anne Croy*,§

* Department of Biomedical Sciences and {dagger} Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada; {ddagger} Center for Transgene Technology, Flanders Interuniversity Institute for Biotechnology, University of Leuven, Leuven, Belgium; and § Department of Anatomy and Cell Biology, Queen’s University, Kingston, Ontario, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Placenta growth factor (PlGF; formerly PGF), a vascular endothelial growth factor gene family member, is expressed in human implantation sites by maternal uterine NK (uNK) and fetal trophoblast cells. Lower than normal concentrations of blood and urinary PlGF have been associated with impending onset of pre-eclampsia, a hypertensive disease of late human gestation characterized by limited intravascular trophoblast invasion. In pregnant rodents, delivery of the PlGF antagonist sFlt-1 or S-endoglin induces pre-eclampsia-like lesions. Mice genetically deleted in PlGF reproduce, but neither their implantation sites nor their uNK cell development are described. We combined real-time PCR of endometrium from nonpregnant and gestation day (gd)6–18 C57BL6/J (B6) mice with immunohistology to analyze PlGF expression in normal mouse pregnancy. To estimate the significance of uNK cell-derived PlGF, PlGF message was quantified in mesometrial decidua from pregnant alymphoid Rag2 null/common {gamma} chain null mice and in laser capture-microdissected B6 uNK cells. Histopathologic consequences from PlGF deletion were also characterized in the implantation sites from PlGF null mice. In B6, decidual PlGF expression rose between gd8–16. uNK cells were among several types of cells transcribing PlGF in decidualized endometrium. Immature uNK cells, defined by their low numbers of cytoplasmic granules, were the uNK cells displaying the greatest number of transcripts. PlGF deletion promoted the early differentiation high numbers of binucleate uNK cells (gd8) but had no other significant, morphometrically detectable impact on implantation sites. Thus, in mice, PlGF plays an important role in successful uNK cell proliferation and/or differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Placenta growth factor (PlGF;2 formerly PGF) is a vascular endothelial growth factor (VEGF) family member that regulates differentiation of vascular endothelia. Although originally described as chemotactic, mitogenic, and angiogenic for endothelial cells, PlGF is also chemotactic for monocytes and other hemopoietic cells (1). Some activities of PlGF are attributed to its role in potentiating VEGF’s effects (2). PlGF and VEGF share a common receptor (VEGF receptor (VEGFR)-1; fms-like tyrosine kinase-1). Binding of PlGF to VEGFR-1 displaces VEGF thereby increasing the bioavailability of VEGF (3). PlGF binding to VEGFR-1 transphophorylates VEGFR-2 fetal liver kinase 1, a receptor exclusive to VEGF, promoting PlGF’s VEGF-like functions (3). PlGF may transmit its own signals through VEGFR-1 independently of VEGFR-2 (2). As implied by its name, PlGF is abundantly but not exclusively expressed in pregnant uteri. Fetal cells expressing PlGF message include villous cytotrophoblasts, syncytiotrophoblasts, extravillous trophoblasts, and villous mesenchyme.

Human maternal endometrial cells also express PlGF and VEGF. VEGF is expressed by endometrial glands and macrophages, whereas uterine NK (uNK) cells express both PlGF and VEGF (4, 5, 6). uNK cells are an abundant CD56bright endometrial lymphocyte subset found transiently during endometrial decidualization late in menstrual cycles and in early pregnancy (7). Recently, human uNK cells were shown to be distinct from blood CD56bright cells by their ability to produce biologically active angiogenic factors, including PlGF, and to promote trophoblast invasion (8). VEGF-C, a molecule important for lymphatic endothelial cell differentiation, and NKG5, an endothelial cell mitogen, are expressed by human uNK cells (5, 9). Genetic studies further suggest that relationships promoting activation of human uNK cells decrease risk for pre-eclampsia (10). Low levels of PlGF have been suggested as a useful diagnostic tool for this syndrome before clinical manifestations (11, 12, 13).

Functions of human pregnancy-associated uNK cells are not fully defined, but strong evidence from animal models supports the concept that uNK cells are major participants in the early vascular changes in pregnant endometrium. Angiogenic roles have been described for murine and porcine uNK cells (VEGF mRNA and protein; Refs. 14, 15, 16, 17). Furthermore, in mice lacking uNK cells, the endometrial/maternal spiral arteries feeding into developing placentae (PL) do not undergo normally expected, pregnancy-associated changes in structure (18). IFN-{gamma} treatment of pregnant alymphoid mice induces appropriate arterial modification, suggesting that this uNK cell product has essential roles in endometrial support of PL (19). Murine uNK cells are extremely localized within implantation sites, appearing only on the mesometrial side of the uterus. Between gestation day (gd)5–11 (20, 21), uNK cells proliferate, gain increasing numbers of cytoplasmic granules, and form a transient lymphoid structure known variously as the mesometrial lymphoid aggregate of pregnancy (MLAp), metrial gland, or decidualized mesometrial triangle. This mural structure surrounds the radial branches of the uterine artery as they arborize into the endometrial spiral arteries. Pregnancy-associated structural changes in murine spiral arteries are detected histologically at gd9–10, just before the gd11 onset of death in uNK cells. An analogous decline in human uNK cell numbers occurs about midgestation (22). Murine spiral arterial modification may differ from that seen in women because intralumenal trophoblast invasion occurs in arterial segments more restricted in proximity to the PL (terminal 150 µm; Ref. 20). By midgestation, most murine uNK cells (>65%) are intimately associated with endometrial vessels and 10% are intravascular (23), suggesting that uNK cells directly influence vascular smooth muscle, endothelium, and possibly conducted responses in these vessels.

PlGF null mice (2) are born at Mendelian frequency. They are healthy, fertile, and are reported to show only minor deficits in remodeling of retinal vessels and less angiogenesis in ovarian corpora lutea than normal controls. No information is available on uNK cells and their target spiral arterial and decidual tissues in PlGF null mice. This study was undertaken to characterize PlGF in mouse implantation sites.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Male and female C57BL6/J (B6) mice were purchased from The Jackson Laboratory, housed, and mated for timed pregnancies under standard conditions at the University of Guelph. Alymphoid (NK-, T-, B-) Rag2 null/common {gamma} chain ({gamma}c) null mice on a B6 background were bred under barrier husbandry at the University of Guelph from foundation stock provided by Dr. J. P. Di Santo (Pasteur Institute, Paris, France). Some pregnant B6 and Rag2 null/{gamma}c null females were perfused with 4% paraformaldehyde, and their implantation sites were processed into paraffin blocks for immunohistochemistry. Additional implantation sites from multiple B6 matings at each of gd6, 8, 10, and 12 were frozen in isopentane chilled on dry ice and used to prepare cryostat sections for laser capture microdissection (LCM). For RNA isolation, mesometrial endometrium was dissected from nonpregnant uteri or implantation sites of three or more B6 and Rag2 null/{gamma}c null females on each of gd6, 8, 10, 12, 14, 16, and 18.

Homozygous matings of PlGF null mice and their congenic controls were prepared at Katholieke Universiteit (Leuven, Belgium). These incipient inbred mice had been repeatedly backcrossed to C57BL/6. Pregnancies from four PlGF null females and three congenic controls were examined at each time point. Mated females were perfused, and dissected implantation sites were prepared as paraffin-embedded blocks and shipped to Canada for histological study. No resorbing fetuses were detected in the PlGF null mice.

RNA isolation from C57BL/6J and Rag2 null/{gamma}c null mesometrial endometrium

Total RNA was extracted, using RNeasy mini kit (Qiagen) per the manufacturer’s instructions, from mesometrial endometrium of nonpregnant uteri or from dissected decidua basalis (DB) or MLAp of implantation sites. Similar tissues from a single pregnant uterus were pooled. Briefly, 30 mg of tissue were disrupted by homogenization and the tissue lysate was centrifuged (15,000 x g, 3 min). The cleared lysate was mixed with 700 µl of 70% ethanol. The reaction mixture was loaded on a RNeasy mini column and centrifuged (8,000 x g, 30 s). Columns were washed (500 µl each of wash buffer), centrifuged (8,000 x g, 2 min), and RNA was eluted in 50 µl of nuclease-free water. cDNA was prepared from these RNA samples using First-Strand cDNA synthesis kit (Amersham Biosciences).

LCM of uNK cells, RNA isolation, and cDNA synthesis

Implantation sites collected for LCM from gd6–12 B6 mice were embedded using Cryomatrix (ThermoShandon) in a plastic mold over dry ice. Cryostat sections were cut at 7 µm, placed on glass slides (Fisher Scientific), and either stored at –80°C for subsequent use or stained immediately using a rapid Dolichos biflorus agglutinin (DBA) lectin-staining protocol to identify uNK cells as described previously (24). DBA lectin staining produces a distinct brown coloration over the surface of all uNK cells and over the membranes encapsulating uNK cell cytoplasmic granules once granules begin to develop. LCM was performed using the PixCell IIe system (Arcturus Engineering). Stained uNK cells were evaluated at x400 microscopic magnification to estimate the number of cytoplasmic granules and the diameter of each cell. Both of these parameters normally increase as uNK cells mature (21). Approximately 200–300 morphologically homogeneous uNK cells of each of four distinct subtypes were collected by focal laser melting of the thermoplastic film from the cap onto the individual desired cells using multiple implantation sites for cell harvesting (24). The four uNK cell subtypes used were as follows: 1) agranular (AG; DBA+, <9-µm diameter); 2) immature (IM; DBA+, ~13-µm diameter, <5 cytoplasmic granules); 3) granular (DBA+, 20- to 30-µm diameter, heavily granulated <10 cytoplasmic granules); or 4) senescent (DBA+, >30-µm diameter, apoptotic nuclei, vacuolated cytoplasm, irregular rather than rounded shape >10 cytoplasmic granules). Each subtype was harvested on the gd when it was the most abundant uNK cell type present. RNA extraction from captured uNK cells was done using the Picopure RNA isolation kit (Arcturus), and two rounds of antisense RNA (aRNA) amplification were conducted using MessageAmp II aRNA kit (Ambion) per manufacturer’s instructions. The aRNA obtained after RNA amplification from the LCM-isolated uNK cells and total RNA extracted from implantation sites were reverse transcribed using the First-Strand cDNA synthesis kit (Amersham Biosciences). The resultant cDNA was used as a template for real-time PCR.

Quantitative real-time PCR

Real-time PCR (LightCycler; Roche Diagnostics) was used to quantify PlGF expression relative to beta-actin in mesometrial endometrium and in uNK cells. Primers were designed using the Primer 3 software program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.egi). PlGF primers are forward primer (TGCTGGTCATGAAGCTGTTC) reverse primer (GGACACAGGACGGACTGAAT), product size 222 bp and B-actin forward primer (TCTGGCACCACACCTTCTA) reverse primer (AGGCATACAGGGACAGCAC), product size 190 bp. For quantification of PlGF expression, the SYBR Green PCR kit (Qiagen) was used. LightCycler reactions were performed in 20 µl of total reaction volume, using the manufacturer’s instructions. PCR products were gel purified using the Wizard DNA purification system (Promega), and/or plasmid DNA with specific inserts were quantified and diluted serially to generate standard curves for the gene of interest. The resulting amplified products were sequenced to reconfirm amplification efficiency. Each reaction mixture contained 2 µl of cDNAs, 10 µl of SYBR Green I master mix, 1 µl of sense and antisense primers (0.5 µM each), and 6 µl of PCR-grade water supplied with the kit. The LightCycler program for each gene was denaturation (94°C, 15 min); PCR amplification and quantification (95°C, 10 s, 58°C, 5 s, 72°C, 20 s) with the fluorescence measurement at specific acquisition temperatures for 5 s, repeated for 45 cycles. The melting program was 70–95°C at the rate of 0.1°C/s with continuous fluorescence measurement, with the final cooling step at 40°C. Data were quantified using RelQuant LightCycler analysis software.

Histological and morphometric procedures

Midsaggital serial sections (7 µm) of implantation sites from PlGF null mice and their congenic controls were prepared. Some sections were stained with H&E for general morphology. Other sections were stained with periodic acid-Schiff’s (PAS) reagent to reveal uNK cell granules. uNK cells were enumerated in two regions, the DB and the MLAp, using an eyepiece micrometer. For each implantation site studied, a 1-mm2 area of tissue was scored on 11 medial sections, spaced to provide non-overlapping uNK cells (42 µm apart). Three implantation sites were used for each mother studied. The same 11 sections were used for morphometry (Optimas 6.2) of the spiral arteries. Three regions were outlined for each vessel: the lumen surface of the endothelium, the more densely stained matrix in the vessel wall that, in many vessels, was obscured or interrupted by uNK cells and therefore estimated as uniform over the gap area, and an unusual peripheral circumference of mixed cell composition that appeared to be a structural component of the spiral arterial walls. Areas of these regions were compared as ratios. The total surface areas of the PL, DB, and MLAp were also estimated by making three circumscribing measurements. These dimensions were the entire mesometrial side of the implantation site, the PL, including the giant cells, and the MLAp as the area from the uterine circular smooth muscle to the serosa. The area of the DB was estimated by subtraction of the sum of the latter two areas from the first area.

Immunohistochemistry and lectin histochemistry

To detect PlGF and to identify trophoblast cells, immunohistochemistry was performed using implantation sites from B6 and alymphoid mice. The primary Abs (either anti-mouse PlGF Ab (Abcam) or wide-spectrum screening cytokeratin Ab (DakoCytomation)) were applied to the sections at 1/1000 concentration overnight at 4°C. Negative controls used isotype-matched Ab to estimate nonspecific binding of the secondary Ab. PlGF staining was conducted after removal of paraffin blocking of endogenous peroxidase using 0.2% hydrogen peroxide in methanol for 20 min, and blocking of nonspecific binding using 2% BSA for 1 h at room temperature. Cytokeratin staining was conducted after proteinase-K Ag retrieval for 6 min followed by blocking in 1% BSA for 30 min. Sections were then incubated (30 min, room temperature) with HRP-labeled goat anti-mouse IgG (Southern Biotechnology Associates) at 1:500 and revealed using NovaRED for 10 min (Vector Laboratories). Between each step, tissue sections were washed with PBS. Sections were counterstained with hematoxylin before viewing and photography using a Leica photomicroscope.

To identify IM, nongranulated as well as granulated uNK cells in implantation sites from PlGF null mice and their congenic controls, the standard DBA lectin-staining protocol of Paffaro et al. was used (21). ExtrAvidin peroxidase conjugate (Sigma-Aldrich) was used to detect bound biotinylated lectin and was revealed with 3,3'-diaminobenzidine in TBS with 0.1% hydrogen peroxide. These sections were counterstained with hematoxylin.

Statistical analyses

Statistical analyses used ANOVA (SAS software 8.2; SAS Institute). A value of p < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Quantification of PlGF message in endometrium of B6 mice

To address endometrial expression of PlGF message during pregnancy, real-time PCR was used to analyze mesometrial samples from virgin or gd6–18 B6 mice (Fig. 1). PlGF expression was detected in nonpregnant (virgin) B6 endometrium, and this level of expression was not altered at gd6 or -8. By gd10, PlGF expression increased to gd16, then declined at gd18.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 1. Quantification of PlGF expression in mesometrial endometrium (virgin) or mesometrial decidua (at implantation sites) from C57BL/6 (B6) and Rag2 null/{gamma}c null (alymphoid) mice. At least three mice were used at each time point. Expression was quantified by real-time RT-PCR (Roche) using beta-actin as a housekeeping gene for relative quantification. y-axis scale, x1.0E-02. NP, Nonpregnant.

 
Localization of immunoreactive PlGF in B6 and alymphoid mouse implantation sites

To establish whether the endometrial cells expressing PlGF included or were restricted to only uNK cells, immunohistochemistry was conducted on gd10 implantation sites from B6 (Fig. 2A) and from alymphoid mice (Fig. 2B). In B6 sites, strong staining was detected in multiple endometrial cell types, including uNK cells. Significant stromal staining was noted perivascular to the spiral arteries and in smooth muscle cells. Spiral arterial endothelium appeared to be nonreactive. In alymphoid mouse implantation sites that are characterized by the absence of uNK cells and MLAp development and by decidual hypocellularity (19), PlGF was abundantly expressed in the PL. Weakly positive stromal cells were present in DB. Myometrial cells and the smooth muscle cells and endothelia of the spiral arteries appeared to be negative.


Figure 2
View larger version (156K):
[in this window]
[in a new window]

 
FIGURE 2. A, Immunohistochemical localization of PlGF in gd10 B6 implantation sites. Images a–c represent serial sections stained with DBA lectin to show uNK cells, anti-PlGF, and an isotype-matched control Ab, respectively (magnification, 50x). PlGF was strongly expressed in the PL and DB (b). PlGF-reactive uNK cells (arrows) were present in both the DB (d and e) and MLAp (f). Stromal expression of PlGF was observed around spiral arteries (*), but endothelium appeared to be negative for PlGF (d). PL, Placenta; SM, smooth muscle (magnification, x1,000 (d) and x400 (e and f)). B, Immunohistochemical localization of PlGF in gd12 alymphoid mice. The serial sections were stained with DBA lectin, PlGF, and isotype-matched control Ab (a–c), respectively. DBA lectin-reactive uNK cells were absent in alymphoid mice (a) (sections counterstained with hematoxylin). PlGF was abundantly expressed in the PL (e) with few positive stromal cells in the DB (d). TR PlGF-positive trophoblast giant cells are indicated by a white arrowhead (e) and positive stromal cells in the DB with a black arrowhead (f). Smooth muscle and endothelial cells of the spiral arteries (*) appeared negative. (Magnifications, x50 (a–c); x200 (d and e); and x400 (f).)

 
Quantification of PlGF message in endometrium of alymphoid mice

PlGF message was essentially undetectable in the mesometrial endometrium of nonpregnant alymphoid mice (Fig. 1). Pregnancy induced stable expression of PlGF to gd12. At gd6 and -8, endometrial expression of PlGF in alymphoid mice was equivalent to that in B6 mice. This result suggests that lymphocytes are not the cells in murine DB responsible for the early, postimplantation gain in PlGF expression. Between gd10–16, there was significantly less PlGF transcription in DB from alymphoid mice than from B6 mice (Fig. 1). This difference suggests that, at midgestation, most decidual PlGF is lymphocyte-derived. PlGF transcription from nonlymphoid cell types showed further waves of elevation at gd14 and -18. Transcript numbers at gd14 were still significantly lower in alymphoid than in B6 mice but at gd18, there was no significant difference. These data indicate that lymphocytes have the potential to contribute to angiogenesis in virgin and pregnant uteri.

PlGF expression in B6 uNK cells

No DBA lectin-reactive lymphocytes are present in virgin B6 uteri or in virgin or pregnant uteri from alymphoid mice. To establish when PlGF transcription occurs during the maturation of uNK cells from proliferating AG to heavily granulated, postmitotic cells, pools of 200–300 morphologically homogeneous DBA lectin-reactive uNK cells at different stages of maturation were collected from pregnant B6 uteri by LCM (Fig. 3A). PlGF expression was detected in all four B6 cell pools (AG; <5 granules; >10 granules; vacuolated). High expression was found in very early nongranulated uNK cells, and expression levels increased as granules began to appear at the IM uNK cell stage (Fig. 3B). Because no further increase in transcripts occurred in mature cells having many more granules, PlGF is unlikely to be a granule-associated product. Relative transcript numbers decreased in vacuolated uNK cells compared with IM and mature uNK cells. Loss of transcripts from vacuolated, senescent uNK cells as well as the decline in uNK cell numbers known to occur from gd12 in B6 mice, indicate that the high transcript levels detected in endometrium at gd16 and -18 must be attributed to cell types other than uNK cells.


Figure 3
View larger version (99K):
[in this window]
[in a new window]

 
FIGURE 3. A, Rapidly stained DBA lectin+ uNK cells in frozen gd10 B6 uterine sections before and after LCM (n = 3 mice/gd time point). a, Shows mature, DBA lectin-reactive uNK cells (arrowheads). b, Shows a similarly stained section after successful removal of individual uNK cells. Arrowheads indicate empty spaces previously occupied by DBA lectin-reactive uNK cells magnification, x200. B, Expression of PlGF in homogenous populations of 200–300 LCM uNK cell subsets. UNK cells were classified by maturity for dissection as AG (<9-µm diameter); IM (~13 µm, few (<5) cytoplasmic granules; granular (G) (20–30 µm, heavily granulated, round shape); and senescent (S) (>30 µm, apoptotic nuclei, vacuolated cytoplasm). PlGF expression is expressed relative to beta-actin; y-axis scale, x1.0E-01.

 
General histology and morphometric measurements of implantation sites in PlGF null mice

To determine whether PlGF deficiency modifies implantation sites, sites from PlGF null mice and their congenic controls were studied. Sites from PlGF null mice were different from the controls grossly and histologically (Fig. 4A). PlGF null implantation sites were grossly larger. Histopathology attributed this observation to more abundant endometrial (maternal) subregions (Fig. 4B). Of note was the significant enlargement of the MLAp at gd12. This endometrial subregion is where more IM, proliferative uNK cells are found in normal mice (20). PlGF null PLe were significantly smaller (p < 0.05) than the control PL at gd10 and -12 (Fig. 4B) and had not assumed a fully mature shape. Placentae from the null mice were pointed and appeared to retain the shape of the preceding ectoplacental cone stage of development. Cytokeratin reactivity was demonstrated in the PL (Fig. 4C) of both PlGF knockout and wild-type (WT) mice. At gd12, some cytokeratin-reactive migrating trophoblasts were present in DB in both PlGF null and their WT control mice.


Figure 4
View larger version (84K):
[in this window]
[in a new window]

 
FIGURE 4. A, DBA lectin-stained implantation sites from PlGF null mice (a–c) and their congenic controls (d–f) at gd10 (a and d) and gd12 (b, c, e, and f), respectively. DBA lectin-stained uNK cells (brown) were localized around vessels and scattered in MLAp and DB. The gd10 images show overall morphology, and gd12 images focus on cross-sectional cuts of the coiled spiral arteries (*) at higher power showing their dilation. g, Represents the negative control in which the specific sugar ligand N-acetyl galactosamine was used to block DBA lectin binding. (Magnification a, b, d, e, x200; magnification c, f, and g, x400.) B, Comparison of the midsaggital cross-sectional areas (mean ± SD) of MLAp, DB, and PL from PlGF null mice to congenic controls at gd10 and -12. The total surface areas for these regions were estimated by making three circumscribing measurements in the entire mesometrial side of the implantation site, the PL, including the giant cells, and the MLAp. C, Cytokeratin-reactive trophoblasts (brown, indicated by arrows) are seen predominantly in the PL layer of PlGF null (a and b) and WT (c and d) mice at gd10 (a and c) and gd12 (b and d), respectively. Images b and d represent cytokeratin positive trophoblasts associated with spiral arteries in the DB layer in PlGF knockout (KO) and WT mice, respectively. M, Mesometrial side (maternal arteries entry side). Magnifications, x400.

 
uNK cells were numerous in PlGF null mice, found in appropriate microdomains, and declined after midgestation (Fig. 5, A and B). uNK cells were significantly more abundant within the MLAp of PlGF null mice than in controls. Many of these cells had scant cytoplasm (an unusual finding) and were smaller, less granular (i.e., appeared more IM) than in the congenic controls. The remaining uNK cells found in the MLAp were extremely large. uNK cell numbers in DB resembled controls although there was more heterogeneity in cell size.


Figure 5
View larger version (91K):
[in this window]
[in a new window]

 
FIGURE 5. A, Photomicrographs of midsaggital sections of implantation sites from PlGF null mice (a–c) and PlGF WT (d–f) congenic control mice at gd8 (a and d), gd10 (b and e), and gd12 (c and f) (H & E; original magnification, x400). Arrows indicate uNK cells and * indicates a spiral artery. B, Quantification of the mean uNK cell/mm2 ± SD in the MLAp and in the DB of PlGF WT and PlGF null mice at gd8, -10, and -12. Significant differences were found in uNK cell numbers in MLAp but not in DB at gd8. Significantly more uNK cells were present in MLAp at gd10 and -12 in PlGF null compared with control mice.

 
The most unusual finding in PlGF null implantation sites was a striking elevation in the frequency of binucleated uNK cells (Fig. 6A). Significantly higher numbers of nonmature (i.e., low numbers of cytoplasmic granules), nonsenescent (intact nuclear morphology and absence of cytoplasmic vacuolation) binucleated uNK cells were quantified in MLAp and DB of PlGF null mice between gd8 to -12 than in controls (Fig. 6B). The percentage of uNK cells that were binucleated at gd8 in MLAp and DB of PlGF null mice was 30 and 40% (controls 5 and 8%), respectively. At gd10 the percentages were 15 and 10% (controls 3 and 6%), and at gd12 binucleated cells were 30 and 15% (controls 8 and 5%) of the uNK cells in MLAp and DB, respectively.


Figure 6
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 6. A, Binucleated uNK cells in PlGF null mice at gd10. Unusually high numbers of PAS-positive binucleated uNK cells (a) was a striking feature in early to midgestation implantation sites of PlGF null mice. Image b (binucleated uNK cell) represents a DBA lectin-stained uNK cell at high magnification (x1,000) with two distinct nuclei. Images c and d represent uNK cells stained with PAS and DBA, respectively, in PlGF WT controls. DBA-reactive uNK cell from PLGF WT control is shown in image e at high magnification. (Magnification, a and c, x400; magnification, b and d, x1,000.) B, Enumeration of bi- or multinucleate uNK cells in MLAp and DB in PlGF WT and PlGF null mice at gd8, -10, and -12. Significantly more binucleated uNK cells were found in PlGF null mice compared with their congenic controls (*, p < 0.05; **, p < 0.001). C, Comparison of ratios for spiral arterial mean vessel area to mean lumen area ± SD for PlGF WT and PlGF null mice at gd10 and -12. At gd10, the ratio was significantly higher for PlGF null mice than WT. No significant difference was present at gd12.

 
Normal murine uNK cells promote spiral artery remodeling (Fig. 5A). The effect of PlGF deletion on this uNK cell function was assessed by measurement of spiral artery to lumen area ratios (Fig. 6C). At gd10, the mean vessel area to lumen area ratios in PlGF null mice was significantly higher (less modification) than in the congenic controls (p < 0.05). No significant differences were found at gd12, suggesting that delayed rather than impaired uNK cell function is associated with the anomalies observed in IM uNK cells of this strain. Vessel structure in the DB of PlGF null mice differed from controls at all times studied. The smooth muscle coat around the spiral arteries was thicker than in control implantation sites.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The goal of these studies was to characterize PlGF in murine implantation sites and to evaluate whether the PlGF null mouse displayed features that would make it valuable for studies of the pathogenesis of pre-eclampsia. In humans, low levels of PlGF have been associated with pre-eclampsia (25, 26, 27, 28, 29, 30), and endometrial PlGF is reported to be an exclusive product of uNK cells in the late menstrual cycle. PlGF is also found in uNK cells from early, elective pregnancy terminations (5).

PlGF has three spliced forms, PlGF-1, PlGF-2, and PlGF-3 (31, 32). In the rhesus monkey, where three early stages of pregnancy (lacunar, early villous, and villous PL stages) were studied for PlGF expression by immunohistology (33), weak, transient stromal expression was found on vascular smooth muscle cells and glandular epithelium. Stronger staining appeared in decidual cells as pregnancy progressed, but these cells were not further characterized by lineage or morphology. Because mice have only a single PlGF gene (3), full analysis of PlGF expression in a detailed gestational time course is possible.

As anticipated from the reports of others (34), PlGF (Fig. 2) was abundantly expressed in the murine PL including trophoblast giant cells. Endometrial transcription of PlGF also occurred throughout gestation (Fig. 1).

Gestationally induced endometrial (decidual) expression occurred at times inconsistent with a conclusion that uNK cells were the exclusive source for endometrial PlGF (i.e., in both early (gd6) and late gestation (gd16–18)). The study of alymphoid mice also implicated nonlymphoid maternal sources during the first half of gestation. The elevation in PlGF transcription in alymphoid mice during the second half of gestation could be due to migrating trophoblast cells of fetal origin. There is considerable variation in the degree of fetal cell contamination of dissected mouse decidua (35), and study of a larger number of gd16–18 animals would be needed to confirm the apparent drop in PlGF transcription in gd16 alymphoid mice. In normal immunocompetent B6 mice, immunoreactive PlGF was found throughout the implantation site. Immunoreactive PlGF associated with uNK cells and with smooth muscle cells of large endometrial arteries and of the myometrial-decidual junction. These data support a previously documented role for PlGF in smooth muscle cells (36) and may explain the unusual vascular morphology observed in PlGF null mouse implantation sites.

The major histological feature found in implantation sites from PlGF null mice was the unusual elevation of binucleate uNK cells in both the MLAp and DB early in pregnancy (gd8). In normal mice, binucleate uNK cells usually represent <4% of the uNK cell population in midgestation DB and they are senescent cells (20, 37). By term, binucleate cells are ~10% of normal uNK cells. As shown in Fig. 6A, binucleate uNK cells in PlGF null mice are not morphologically senescent, and they appear to retain their functional capacity to migrate to spiral arteries and into DB (Fig. 6B). Whether these binucleate cells retain functions other than migration and whether any of their functions are at levels equivalent to mononucleate uNK cells cannot be evaluated from this histological study. The uNK cell function of spiral arterial modification was observed in PlGF null implantation sites but with slightly delayed kinetics. This process could result from exclusive actions of mononucleate uNK cells, which are reduced from normal numbers in these implantation sites by the skewed ratio toward binucleate cells or to the combined actions of mono- and binucleate uNK cells with modest functional impairment of the binucleate cells.

Functions attributed to PlGF are the support of growth, differentiation, and migration of endothelial and trophoblast cells (38). Our data suggest that terminal stages in the proliferation and cytokinesis of uNK cells during their lineage maturation also require PlGF, whereas nuclear division does not. PlGF does not appear to be required for commitment to uNK cell maturation or for uNK cell migration. The mechanism for PlGF-mediated effects during uNK cell maturation is likely cell intrinsic because studies of others addressing VEGFR1 did not demonstrate the receptor on murine uNK cells (39). Because only 30% of the gd8 uNK cells of PlGF null mice were binucleate, it is also possible that study of these mice has identified two subsets of uNK cells, perhaps those with and without angiogenic potential or possibly uNK cells of thymic and nonthymic origins (40, 41).

uNK cell division occurs predominantly in the MLAp (20), and the great enlargement of this tissue may reflect its content of very large cells because the absolute numbers of uNK cells, whereas elevated above the controls, would not be adequate to account for the gain in absolute area and in proportion to the MLAp within PlGF null implantation sites. A mild aberration in placental shape and reduced placental growth were also seen in implantation sites from PlGF mice. These outcomes may reflect a separate role for PlGF in trophoblast growth and differentiation. Alternatively, they could arise from a mechanism similar to that more readily recognized in uNK cells in which differentiation of trophoblast cells is being skewed away from proliferative cells (spongiotrophoblast) toward endo-reduplicating trophoblast giant cells. We expected that the complete absence of PlGF would significantly impact mouse implantation sites and block spiral arterial modification. This effect was not observed. Small PL were found but spiral arterial modification was only slightly delayed in PlGF null mice, not prevented as in uNK cell-deficient mice (42). Whether the pathology seen in implantation sites of PlGF null mice could be reversed by VEGF rather than PlGF treatment is a question that, when answered, may shed light on whether VEGF therapy of women at risk for pre-eclampsia will be successful.


    Acknowledgment
 
We thank Dr. D. Bienzle (University of Guelph, Guelph, Ontario, Canada) for access to the LCM and real-time PCR facility.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Chandrakant Tayade, Department of Biomedical Sciences, University of Guelph, Guelph, Ontario Canada. E-mail address: ctayade{at}uoguelph.ca Back

2 Abbreviations used in this paper: PlGF, placenta growth factor; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; uNK, uterine NK; PL, placenta; gd, gestation day; MLAp, mesometrial lymphoid aggregate of pregnancy; {gamma}c, common {gamma}-chain; LCM, laser capture microdissection; DB, decidua basalis; DBA, Dolichos biflorus agglutinin; AG, agranular; IM, immature; aRNA, antisense RNA; PAS, periodic acid-Schiff; WT, wild type. Back

Received for publication November 8, 2006. Accepted for publication January 15, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Ziche, M., D. Maglione, D. Ribatti, L. Morbidelli, C. T. Lago, M. Battisti, I. Paoletti, A. Barra, M. Tucci, G. Parise, et al 1997. Placenta growth factor-1 is chemotactic, mitogenic, and angiogenic. Lab. Invest. 76: 517-531. [Medline]
  2. Autiero, M., J. Waltenberger, D. Communi, A. Kranz, L. Moons, D. Lambrechts, J. Kroll, S. Plaisance, M. De Mol, F. Bono, et al 2003. Role of PlGF in the intra- and intermolecular cross talk between the VEGF receptors Flt1 and Flk1. Nat. Med. 9: 936-943. [Medline]
  3. Carmeliet, P., L. Moons, A. Luttun, V. Vincenti, V. Compernolle, M. De Mol, Y. Wu, F. Bono, L. Devy, H. Beck, et al 2001. Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions. Nat. Med. 7: 575-583. [Medline]
  4. Clark, D. E., S. K. Smith, D. Licence, A. L. Evans, D. S. Charnock-Jones. 1998. Comparison of expression patterns for placenta growth factor, vascular endothelial growth factor (VEGF), VEGF-B and VEGF-C in the human placenta throughout gestation. J. Endocrinol. 159: 459-467. [Abstract]
  5. Li, X. F., D. S. Charnock-Jones, E. Zhang, S. Hiby, S. Malik, K. Day, D. Licence, J. M. Bowen, L. Gardner, A. King, et al 2001. Angiogenic growth factor messenger ribonucleic acids in uterine natural killer cells. J. Clin. Endocrinol. Metab. 86: 1823-1834. [Abstract/Free Full Text]
  6. Lash, G. E., B. Schiessl, M. Kirkley, B. A. Innes, A. Cooper, R. F. Searle, S. C. Robson, J. N. Bulmer. 2006. Expression of angiogenic growth factors by uterine natural killer cells during early pregnancy. J. Leukocyte Biol. 80: 572-580. [Abstract/Free Full Text]
  7. Moffett-King, A.. 2002. Natural killer cells and pregnancy. Nat. Rev. Immunol. 2: 656-663. [Medline]
  8. Hanna, J., D. Goldman-Wohl, Y. Hamani, I. Avraham, C. Greenfield, S. Natanson-Yaron, D. Prus, L. Cohen-Daniel, T. I. Arnon, I. Manaster, et al 2006. Decidual NK cells regulate key developmental processes at the human fetal-maternal interface. Nat. Med. 12: 1065-1074. [Medline]
  9. Langer, N., D. Beach, E. S. Lindenbaum. 1999. Novel hyperactive mitogen to endothelial cells: human decidual NKG5. Am. J. Reprod. Immunol. 42: 263-272. [Medline]
  10. Hiby, S. E., J. J. Walker, K. M. O’Shaughnessy, C. W. Redman, M. Carrington, J. Trowsdale, A. Moffett. 2004. Combinations of maternal KIR and fetal HLA-C genes influence the risk of preeclampsia and reproductive success. J. Exp. Med. 200: 957-965. [Abstract/Free Full Text]
  11. Torry, D. S., H. S. Wang, T. H. Wang, M. R. Caudle, R. J. Torry. 1998. Preeclampsia is associated with reduced serum levels of placenta growth factor. Am. J. Obstet. Gynecol. 179: 1539-1544. [Medline]
  12. Levine, R. J., R. Thadhani, C. Qian, C. Lam, K. H. Lim, K. F. Yu, A. L. Blink, B. P. Sachs, F. H. Epstein, B. M. Sibai, et al 2005. Urinary placental growth factor and risk of preeclampsia. J. Am. Med. Assoc. 293: 77-85. [Abstract/Free Full Text]
  13. Venkatesha, S., M. Toporsian, C. Lam, J. Hanai, T. Mammoto, Y. M. Kim, Y. Bdolah, K. H. Lim, H. T. Yuan, T. A. Libermann, et al 2006. Soluble endoglin contributes to the pathogenesis of preeclampsia. Nat. Med. 12: 642-649. [Medline]
  14. Tayade, C., G. P. Black, Y. Fang, B. A. Croy. 2006. Differential gene expression in endometrium, endometrial lymphocytes, and trophoblasts during successful and abortive embryo implantation. J. Immunol. 176: 148-156. [Abstract/Free Full Text]
  15. Leonard, S., C. Murrant, C. Tayade, M. van den Heuvel, R. Watering, B. A. Croy. 2006. Mechanisms regulating immune cell contributions to spiral artery modification: facts and hypotheses—a review. Placenta 27: (Suppl. A):S40-S46. [Medline]
  16. Wang, C., N. Umesaki, H. Nakamura, T. Tanaka, K. Nakatani, I. Sakaguchi, S. Ogita, K. Kaneda. 2000. Expression of vascular endothelial growth factor by granulated metrial gland cells in pregnant murine uteri. Cell Tissue Res. 300: 285-293. [Medline]
  17. Wang, C., T. Tanaka, H. Nakamura, N. Umesaki, K. Hirai, O. Ishiko, S. Ogita, K. Kaneda. 2003. Granulated metrial gland cells in the murine uterus: localization, kinetics, and the functional role in angiogenesis during pregnancy. Microsc. Res. Tech. 60: 420-429. [Medline]
  18. Guimond, M. J., B. Wang, B. A. Croy. 1998. Engraftment of bone marrow from severe combined immunodeficient (SCID) mice reverses the reproductive deficits in natural killer cell-deficient tg{epsilon} 26 mice. J. Exp. Med. 187: 217-223. [Abstract/Free Full Text]
  19. Ashkar, A. A., J. P. Di Santo, B. A. Croy. 2000. Interferon {gamma} contributes to initiation of uterine vascular modification, decidual integrity, and uterine natural killer cell maturation during normal murine pregnancy. J. Exp. Med. 192: 259-270. [Abstract/Free Full Text]
  20. Peel, S.. 1989. Granulated metrial gland cells. Adv. Anat. Embryol. Cell Biol. 115: 1-112. [Medline]
  21. Paffaro, V. A., Jr, M. C. Bizinotto, P. P. Joazeiro, A. T. Yamada. 2003. Subset classification of mouse uterine natural killer cells by DBA lectin reactivity. Placenta 24: 479-488. [Medline]
  22. Bulmer, J. N., G. E. Lash. 2005. Human uterine natural killer cells: a reappraisal. Mol. Immunol. 42: 511-521. [Medline]
  23. Croy, B. A., S. Esadeg, S. Chantakru, M. van den Heuvel, V. A. Paffaro, H. He, G. P. Black, A. A. Ashkar, Y. Kiso, J. Zhang. 2003. Update on pathways regulating the activation of uterine natural killer cells, their interactions with decidual spiral arteries and homing of their precursors to the uterus. J. Reprod. Immunol. 59: 175-191. [Medline]
  24. Tayade, C., Y. Fang, G. P. Black, V. A. Paffaro, Jr, A. Erlebacher, B. A. Croy. 2005. Differential transcription of Eomes and T-bet during maturation of mouse uterine natural killer cells. J. Leukocyte Biol. 78: 1347-1355. [Abstract/Free Full Text]
  25. Taylor, R. N., J. Grimwood, R. S. Taylor, M. T. McMaster, S. J. Fisher, R. A. North. 2003. Longitudinal serum concentrations of placental growth factor: evidence for abnormal placental angiogenesis in pathologic pregnancies. Am. J. Obstet. Gynecol. 188: 177-182. [Medline]
  26. Thadhani, R., W. P. Mutter, M. Wolf, R. J. Levine, R. N. Taylor, V. P. Sukhatme, J. Ecker, S. A. Karumanchi. 2004. First trimester placental growth factor and soluble fms-like tyrosine kinase 1 and risk for preeclampsia. J. Clin. Endocrinol. Metab. 89: 770-775. [Abstract/Free Full Text]
  27. Torry, D. S., D. Mukherjea, J. Arroyo, R. J. Torry. 2003. Expression and function of placenta growth factor: implications for abnormal placentation. J. Soc. Gynecol. Investig. 10: 178-188. [Medline]
  28. Bersinger, N. A., R. A. Odegard. 2005. Serum levels of macrophage colony stimulating, vascular endothelial, and placenta growth factor in relation to later clinical onset of pre-eclampsia and a small-for-gestational age birth. Am. J. Reprod. Immunol. 54: 77-83. [Medline]
  29. Krauss, T., H. U. Pauer, H. G. Augustin. 2004. Prospective analysis of placenta growth factor (PlGF) concentrations in the plasma of women with normal pregnancy and pregnancies complicated by preeclampsia. Hypertens. Pregnancy 23: 101-111. [Medline]
  30. Solomon, C. G., E. W. Seely. 2004. Preeclampsia: searching for the cause. N. Engl. J. Med. 350: 641-642. [Free Full Text]
  31. Maglione, D., V. Guerriero, G. Viglietto, M. G. Ferraro, O. Aprelikova, K. Alitalo, S. Del Vecchio, K. J. Lei, J. Y. Chou, M. G. Persico. 1993. Two alternative mRNAs coding for the angiogenic factor, placenta growth factor (PlGF), are transcribed from a single gene of chromosome 14. Oncogene 8: 925-931. [Medline]
  32. Cao, Y., W. R. Ji, P. Qi, A. Rosin, Y. Cao. 1997. Placenta growth factor: identification and characterization of a novel isoform generated by RNA alternative splicing. Biochem. Biophys. Res. Commun. 235: 493-498. [Medline]
  33. Ghosh, D., A. M. Sharkey, D. S. Charnock-Jones, L. Dhawan, S. Dhara, S. K. Smith, J. Sengupta. 2000. Expression of vascular endothelial growth factor (VEGF) and placental growth factor (PlGF) in conceptus and endometrium during implantation in the rhesus monkey. Mol. Hum. Reprod. 6: 935-941. [Abstract/Free Full Text]
  34. Achen, M. G., J. M. Gad, S. A. Stacker, A. F. Wilks. 1997. Placenta growth factor and vascular endothelial growth factor are co-expressed during early embryonic development. Growth Factors 15: 69-80. [Medline]
  35. Rossant, J., B. A. Croy. 1985. Genetic identification of tissue of origin of cellular populations within the mouse placenta. J. Embryo. Exp. Morphol. 86: 177-189. [Medline]
  36. Ishida, A., J. Murray, Y. Saito, C. Kanthou, O. Benzakour, M. Shibuya, E. S. Wijelath. 2001. Expression of vascular endothelial growth factor receptors in smooth muscle cells. J. Cell. Physiol. 188: 359-368. [Medline]
  37. Delgado, S. R., B. A. McBey, S. Yamashiro, J. Fujita, Y. Kiso, B. A. Croy. 1996. Accounting for the peripartum loss of granulated metrial gland cells, a natural killer cell population, from the pregnant mouse uterus. J. Leukocyte Biol. 59: 262-269. [Abstract]
  38. Maglione, D., V. Guerriero, G. Viglietto, P. Delli-Bovi, M. G. Persico. 1991. Isolation of a human placenta cDNA coding for a protein related to the vascular permeability factor. Proc. Natl. Acad. Sci. USA 88: 9267-9271. [Abstract/Free Full Text]
  39. Hirashima, M., Y. Lu, L. Byers, J. Rossant. 2003. Trophoblast expression of fms-like tyrosine kinase 1 is not required for the establishment of the maternal-fetal interface in the mouse placenta. Proc. Natl. Acad. Sci. USA 100: 15637-15642. [Abstract/Free Full Text]
  40. Vosshenrich, C. A., M. E. Garcia-Ojeda, S. I. Samson-Villeger, V. Pasqualetto, L. Enault, O. Richard-Le Goff, E. Corcuff, D. Guy-Grand, B. Rocha, A. Cumano, et al 2006. A thymic pathway of mouse natural killer cell development characterized by expression of GATA-3 and CD127. Nat. Immunol. 7: 1217-1224. [Medline]
  41. Di Santo, J. P.. 2006. Natural killer cell developmental pathways: a question of balance. Annu. Rev. Immunol. 24: 257-286. [Medline]
  42. Ashkar, A. A., G. P. Black, Q. Wei, H. He, L. Liang, J. R. Head, B. A. Croy. 2003. Assessment of requirements for IL-15 and IFN regulatory factors in uterine NK cell differentiation and function during pregnancy. J. Immunol. 171: 2937-2944. [Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2007 178: 4003-4004. [Full Text]  



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
T. V. Mallidi, L. E. Craig, S. R. Schloemann, and J. K. Riley
Murine Endometrial and Decidual NK1.1+ Natural Killer Cells Display a B220+CD11c+ Cell Surface Phenotype
Biol Reprod, August 1, 2009; 81(2): 310 - 318.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. Wu, B. L. Johnson, Y. Chen, C. T. Ha, and G. S. Dveksler
Murine Pregnancy-Specific Glycoprotein 23 Induces the Proangiogenic Factors Transforming-Growth Factor Beta 1 and Vascular Endothelial Growth Factor A in Cell Types Involved in Vascular Remodeling in Pregnancy
Biol Reprod, December 1, 2008; 79(6): 1054 - 1061.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. Zhang, H. Dong, B. Wang, S. Zhu, and B. A. Croy
Dynamic Changes Occur in Patterns of Endometrial EFNB2/EPHB4 Expression During the Period of Spiral Arterial Modification in Mice
Biol Reprod, September 1, 2008; 79(3): 450 - 458.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. D. Burke, H. Dong, A. D. Hazan, and B. A. Croy
Aberrant Endometrial Features of Pregnancy in Diabetic NOD Mice
Diabetes, December 1, 2007; 56(12): 2919 - 2926.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Tayade, Y. Fang, D. Hilchie, and B. A. Croy
Lymphocyte contributions to altered endometrial angiogenesis during early and midgestation fetal loss
J. Leukoc. Biol., October 1, 2007; 82(4): 877 - 886.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tayade, C.
Right arrow Articles by Croy, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tayade, C.
Right arrow Articles by Croy, B. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS