The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prehn, J. L.
Right arrow Articles by Targan, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prehn, J. L.
Right arrow Articles by Targan, S. R.
The Journal of Immunology, 2007, 178: 4033-4038.
Copyright © 2007 by The American Association of Immunologists, Inc.

The T Cell Costimulator TL1A Is Induced by Fc{gamma}R Signaling in Human Monocytes and Dendritic Cells

John L. Prehn, Lisa S. Thomas, Carol J. Landers, Qi T. Yu, Kathrin S. Michelsen and Stephan R. Targan1

Inflammatory Bowel Disease Center, Cedars-Sinai Medical Center, Los Angeles, California 90048


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The recently described TL1A/DR3 ligand/receptor pair mediates strong costimulation of Th1 cells. Activation of T and NK cells induces DR3 expression, permitting soluble recombinant TL1A to increase IFN-{gamma} production and proliferation of these cells. Gut T cells and macrophages express TL1A, especially in Crohn’s disease (CD), and there is a strong association between CD and tl1a single nucleotide polymorphisms. Murine studies implicate TL1A in gut inflammation. To determine whether professional T cell-activating cells can express TL1A, fresh blood monocytes and monocyte-derived dendritic cells were stimulated with various activating ligands, including TLR agonists, IFN-{gamma}, and immune complexes. Fc{gamma}R stimulation strongly induced TL1A mRNA in both cell types, which correlated with the detection of TL1A on the cell surface and in cell culture medium. TLR agonists capable of inducing IL-6 and TNF-{alpha} in monocytes and dendritic cells did not induce surface nor soluble TL1A. Furthermore, we demonstrate that TL1A production in monocytes leads to enhancement of T cell responses. The induction of TL1A on APCs via specific pathway stimulation suggests a role for TL1A in Th1 responses to pathogens, and in CD.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The most recently identified member of the TNF superfamily, TL1A (1), is a strong costimulator of T cells. Activation of T cells by anti-CD3 or by IL-12/IL-18 induces expression of the TL1A receptor death domain receptor 3 (DR3,2 TNFSFR25). In T cells, ligation of DR3 by TL1A (or agonist Ab) activates NF-{kappa}B and cIAP-2 and leads to powerful costimulation of IFN-{gamma} production and proliferation, but not to apoptosis as in other cells (2). Coactivation is most evident for CD4+CCR9+ T cells, which constitute ~4% of circulating CD4+ cells, and have many characteristics that are the same as T cells in the gut lamina propria (3), especially in small bowel, where nearly all T cells are CCR9+ (4). When activated by IL-12 and IL-18, these cells are particularly sensitive to TL1A, which at concentrations as low as 1 ng/ml, or less, augments IFN-{gamma} production an average of 10-fold (5). In addition, peripheral CD4+CCR9+ T cells constitutively express surface membrane TL1A, which appears to costimulate IFN-{gamma} production via T cell-T cell interaction, as evidenced by diminished IFN-{gamma} production in the presence of Abs blocking TL1A (5).

Evidence for involvement of TL1A in mucosal inflammation in Crohn’s disease includes our finding of increased TL1A expression on the surface membrane of mucosal T cells (6). Further evidence was provided by Bamias et al. (7), who demonstrated positive TL1A staining of T cells and macrophages in tissue sections from small bowel and colonic lamina propria. Thus, TL1A expression occurs on more than one cell type as part of the inflammatory response in inflammatory bowel diseases. These diseases reflect an aberrant reaction to microbial flora and highlight the critical role of the host/microbial interface. TL1A was implicated in promoting the Th1 response in a model of intestinal inflammation when mice transgenic for decoy receptor 3 (DcR3) were infected with Listeria monocytogenes. Hsu et al. (8) reported attenuation of the effective Th1 response, a skewing to Th2 cytokine production, and increased mortality in the infected transgenic mice. Although DcR3 binds Fas and LIGHT (Ref. 1 and references therein) in addition to TL1A, additional experiments supported the conclusion that binding and inactivation of TL1A by DcR3 accounted for the effects of the transgene (8). A recent study has provided a genetic perspective on the role of TL1A in the human Th1 mucosal response in Crohn’s disease. This genome-wide association study revealed a highly significant association of single nucleotide polymorphism haplotypes of the tl1a gene with Crohn’s disease in a large cohort of Japanese patients as well as in two separate, smaller European cohorts (9). Recently, Bamias et al. (10) demonstrated that TL1A and its receptor DR3 are up-regulated in inflamed gut mucosa in two distinct murine models of ileal inflammation. TL1A seems to be primarily expressed by lamina propria dendritic cells (DC).

Taken together, these findings identify TL1A as a major factor in Th1-type responses, particularly in host/bacterial pathogen mucosal responses, and especially in Crohn’s disease (11). Therefore, understanding the ligand-receptor interactions and downstream pathways that can regulate TL1A expression in both innate as well as adaptive immune cell types will provide insight into this cytokine’s role in mucosal host defense as well as disease pathogenesis. Given this evidence implicating TL1A in Th1 responses, we investigated TL1A expression by APCs, such as blood monocytes and in vitro-derived DC following activation of several types of known activating pathways, including TLR ligands, IFN-{gamma}, and Fc{gamma}R activation. In this study, we demonstrate that Fc{gamma}R activation induces a strong up-regulation of TL1A mRNA in monocytes as well as DC, and that Fc{gamma}R activation resulted in the appearance of TL1A in supernatants and on the surface of a fraction of monocytes and DC. In contrast, TLR ligands did not up-regulate TL1A substantially while inducing strong TNF-{alpha} and IL-6 secretion in monocytes and DC. Furthermore, in monocyte-T cell cocultures, Fc{gamma}R activation resulted in enhanced IFN-{gamma} production by T cells that could be blocked by anti-TL1A Abs. Substantial TL1A production following Fc{gamma}R activation, perhaps by contact with opsonized bacteria, defines a new mechanism by which monocytes and DC, by producing TL1A, can drive DR3+ cells, such as NK and activated T cells, to very highly activated functional states by either direct contact of APCs with T cells or via soluble TL1A.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell isolation and culture

Blood was obtained from normal donors after informed consent in accordance with procedures established by the Cedars-Sinai Institutional Review Board. PBMC were isolated on standard Ficoll-Hypaque density gradients. Subsequent isolation of monocytes was performed using the Monocyte Isolation Kit II (Miltenyi Biotec) according to the manufacturer’s protocol. Monocyte preparations were routinely >90% pure as determined by esterase stain (Sigma-Aldrich). Monocytes were cultured in RPMI 1640 containing 2 mM glutamine and 25 mM HEPES buffer (Mediatech) supplemented with 10% FBS, 50 µg/ml gentamicin (Omega Scientific), and 0.25 µg/ml amphotericin B (Gemini Bioproducts). To obtain monocyte-derived DC, GM-CSF (100 ng/ml) and IL-4 (30 ng/ml; both from PeproTech) were added with 2-ME (50 µM), and the cells were cultured for 7 days (12). CD4+ T cells were isolated from PBMC using the human T lymphocyte Enrichment Set (BD Biosciences) and cultured for 24 h in the presence of human IL-12 (final concentration, 2 ng/ml; PeproTech) and human IL-18 (final concentration, 50 ng/ml; R&D Systems) in RPMI complete medium.

Stimulation of DC and monocytes

Monocytes and monocyte-derived DC were plated in 12-well plates and stimulated for 6, 12, 18, and 24 h. Monocyte and DC induction of mRNA and protein were accomplished using optimal activation concentrations of agonists defined either in the literature (IFN-{gamma}, N-palmitoyl-S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-[R]-Cys-[S]-Ser-[S]-Lys(4) trihydrochloride (Pam3CSK4) or by prior titration experiments (LPS and CBir flagellin) The concentrations used were IFN-{gamma} (10 ng/ml; R&D Systems), LPS (phenol-water extracted from Escherichia coli K235, 50 ng/ml; gift from Dr. S. N. Vogel, Department of Microbiology & Immunology, University of Maryland, Baltimore, MD), Pam3CSK4 (300 ng/ml; InvivoGen), and full-length recombinant CBir1 flagellin (10 µg/ml (13)), respectively. Plate-bound, cross-linked human IgG (plate IC) was prepared by incubating 1 ml of human IgG (Jackson ImmunoResearch Laboratories) in PBS (0.5 mg/ml) per well of a 12-well plate for 1 h to overnight, followed by washing with PBS, and incubation with 750 µl of mouse anti-human IgG (Jackson ImmunoResearch Laboratories) in PBS (20 µg/ml) for 1 h. Coated plates were washed with PBS before plating cells for stimulation.

Coculture of CD4+ T cells with monocytes

After a 24-h culture of CD4+ T cells, medium was replaced with fresh medium supplemented with IL-12 and IL-18 and cells were added to autologous monocytes. Before cocultures, monocytes were incubated with immune complex (IC) or left untreated overnight (18 h). At the time of coculture, recombinant human TL1A (final concentration, 50 ng/ml) (6), TL1A Abs (final concentration,15 µg/ml) (6) or control Abs (IgG2b, final concentration: 15 µg/ml; eBioscience) were added to the cells. Cocultures were incubated for 2 days and supernatants were harvested and analyzed for IFN-{gamma} production by ELISA.

Real-time PCR analyses

Total RNA was isolated from monocytes and monocyte-derived DC using TRIzol (Invitrogen Life Technologies) according to the manufacturer’s protocol. TL1A and beta-actin transcripts were amplified by quantitative real-time RT-PCR with TaqMan probes and primers designed using Beacon Design 4.0 (Premier Biosoft International). TL1A (TNFSF15) is the predominant product of the four exon tl1a TNF superfamily gene, although another transcript (encoding VEGI) can be produced from a transcript initiated at the 3' end of the gene (1), and, thus, we chose a primer/probe set specific for TL1A: the forward primer (in exon 1) was CTTCCTTGCAGGACTCACCAC, the reverse primer (in exon 2) was GCTGATGTGAAGGTGCAAACTC, and the probe (in exon 1) was 5'-FAM/ACCTGCTTGTCAGCCAGCTCCGG-3'BHQ_1. The beta-actin forward primer was GACTACCTCATGAAGATCCTCACC, the reverse primer was TCTCCTTAATGTCACGCACGATT, and the probe was 5'-FAM/CGGCTACAGCTTCACCACCACGGC-3'BHQ_1. Five hundred nanograms of total RNA was used in each RT reaction, with oligo(dT) as primer, using the Omniscript kit and protocol (Qiagen). PCR was done on 1/4 the RT reaction in duplicate as follows: 50°C for 2 min, 95°C for 2 min, then 50 cycles at 95°C for 15 s, and 60°C for 1 min. Assays were performed following the predeveloped TaqMan assay reagents protocol for Platinum qPCR mix (Invitrogen Life Technologies) in an iCycler (Bio-Rad). The iCycler Optical system Interface (Bio-Rad) was used to analyze samples. Duplicates differing by less than one cycle were averaged and amount of transcript was analyzed as 2E (threshold cycle beta-actin – threshold cycle TL1A) for each sample and expressed as percentage of beta-actin. Statistical significance was determined by Student’s t test. A value of p < 0.01 was considered to be statistically significant.

ELISA

TL1A was quantified in undiluted supernatants from stimulated cells using an ELISA and mAbs developed at Human Genome Sciences. The capture mAb was mAb 04H08, the detector was biotinylated mAb 16H02, and the standard was recombinant soluble TL1A (aa 72–251). Biotinylated detector Ab was bound by streptavidin-HRP and plates were developed by a standard amplified color reaction (14) and read in a plate reader (Molecular Devices). This ELISA has a detection limit of 0.2 ng/ml TL1A. Human IL-6 or TNF-{alpha} concentrations were measured by ELISA (eBioscience). Supernatants from cells treated with various stimuli were harvested after 6 h (TNF-{alpha}) or 18 h (IL-6), respectively. Human IFN-{gamma} was measured by ELISA as described previously (6).

Flow cytometry

Monocytes or DC stimulated by plate-bound IC for 6–16 h were stained with mAb 04H08 (IgG2b; Human Genome Sciences), washed, stained with biotinylated goat anti-mouse IgG2b (CALTAG), washed, and stained with allophycocyanin-conjugated streptavidin (CALTAG). Fixed cells were analyzed on a Cyan (DakoCytomation) flow cytometer.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Fc{gamma}R signaling induces TL1A mRNA expression in monocytes and monocyte-derived DC

The potent costimulation of activated T cells by recombinant TL1A, and its apparent involvement in Th1 mediated immune responses, led us to ask whether endogenous TL1A was induced in APCs, and, therefore, would be available to costimulate T cells in vivo. To determine which stimulus modalities might induce TL1A in monocytes and DC, we stimulated cells for up to 24 h with each of several ligands known to activate these cell types, i.e., the TLR2 agonist Pam3CSK4, the TLR4 ligand LPS, CBir1 flagellin, which is a ligand of TR5 (chosen because it was identified as a dominant Ag by serological expression cloning (13)), IFN-{gamma}, and plate-bound cross-linked human IgG (plate IC) (see Materials and Methods) (Fig. 1). TL1A transcript was quantified by real-time PCR using a primer/probe set specific for exons 1 and 2 of the full-length transcript (1) (see Materials and Methods). As shown in Figs. 1 and 2, the most potent inducer for both cell types was plate IC (p < 0.001). TL1A mRNA expression was expressed as percentage of beta-actin (see Materials and Methods). TL1A mRNA peaked by 6 h in DC, but continued to increase over 12–18 h in monocytes. In experiments in which mRNA was quantified after 6 h of stimulation (Fig. 2) and expressed as a percentage of beta-actin, the TLR ligands, LPS, and Pam3CSK4 induced very low levels of TL1A transcript in monocytes. CBir1 flagellin and IFN-{gamma} were ineffective inducers in both cell types. Previous publications reported TL1A up-regulation in human endothelial cells (HUVECs) upon stimulation with IL-1beta and TNF-{alpha} (1, 15). We, however, could not detect TL1A mRNA up-regulation in response to IL-1beta or TNF-{alpha} in human monocytes (data not shown), suggesting distinct cell-type specific signaling pathways.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

 
FIGURE 1. Expression of TL1A mRNA by monocytes and DC. Fresh monocytes from blood (A) and DC (B) were stimulated by plate-bound IgG (•), LPS ({blacksquare}), Pam3CSK4 ({diamondsuit}), CBir1 flagellin ({diamond}), and IFN-{gamma} (x). TL1A transcript was quantitated by real-time RT-PCR and expressed as percent actin transcript level (A and B). One representative experiment of two time-course experiments is shown.

 

Figure 2
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 2. TL1A mRNA induction by stimulation of fresh monocytes (A, n = 5) and DC (B, n = 4) by plate-bound IgG for 6 h. TL1A transcript was quantitated by real-time RT-PCR and expressed as percent beta-actin transcript level.

 
Induction of soluble TL1A from monocytes and monocyte-derived DC by Fc{gamma}R but not TLR ligands nor IFN-{gamma} receptor agonist

To determine whether induction of TL1A mRNA led to protein expression, TL1A was measured in supernatants following stimulation of monocytes and DC using the same agonists that were used in Fig. 1. Plate IC induced TL1A in supernatants beginning at 6 h (Fig. 3). This increased rapidly thereafter with levels that closely paralleled peak mRNA levels (see Fig. 1). None of the TLR agonists, nor IFN-{gamma}, induced soluble TL1A. Because TLR signaling of both monocytes and DC induced inflammatory cytokines, we examined whether the same agonists could induce IL-6 and/or TNF-{alpha} from monocytes and/or DC. The same supernatants from experiments in Fig. 3 were measured for IL-6 (Fig. 4, A and B) and TNF-{alpha} secretion (Fig. 4, C and D). All ligands were capable of inducing high levels of IL-6 in monocytes and DC. Therefore, the lack of TL1A induction by these ligands was due to differences in pathways capable of inducing TL1A and IL-6 and not due to overall defective activation signaling. Furthermore, agonists of TLR4, TLR2, and TLR5 as well as Fc{gamma}R, all induced TNF-{alpha} secretion from both monocytes and DC (Fig. 4, C and D). Therefore, TLR signaling could induce TNF-{alpha}, but not TL1A, whereas Fc{gamma}R induced high levels of TL1A from both monocytes and DC.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 3. Expression of soluble TL1A by monocytes and monocytes-DC. Fresh monocytes from blood (A) and DC (B) were stimulated by plate-bound IgG (•), LPS ({blacksquare}), Pam3CSK4 ({diamondsuit}), CBir1 flagellin ({diamond}), and IFN-{gamma} (x). TL1A in supernatants was quantified by ELISA (A and B). One representative experiment of two time-course experiments is shown.

 

Figure 4
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 4. TNF-{alpha} and IL-6 secretion by monocytes and DC upon stimulation with IFN-{gamma}, TLR ligands, and IC. Monocytes or DC were stimulated with IFN-{gamma} (10 ng/ml), LPS (50 ng/ml), Pam3CSK4 (300 ng/ml), flagellin (10 µg/ml), and plate-bound IgG for 6 h (TNF-{alpha}) or 18 h (IL-6), respectively. TNF-{alpha} (C and D) and IL-6 (A and B) responses were measured in supernatants by ELISA. Data shown are means ± SD of one representative experiment of two independent experiments.

 
Fc{gamma}R signaling induces the expression of membrane TL1A on monocytes and monocyte-derived DC

TNF secretion from monocytes is generated by membrane expression followed by TNF-{alpha}-converting enzyme (TACE) cleavage, which results in the release of TNF into the surrounding medium. Furthermore, using flow cytometry, we have previously detected TL1A on the surface of T cells isolated from Crohn’s disease lamina propria (6). By identifying the putative N-terminal transmembrane domain in full-length TL1A, Migone et al. (1) demonstrated that similar to TNF-{alpha}, TL1A is expressed on the membrane. Because plate IC induced TL1A, mRNA, and soluble protein, we hypothesized that TL1A also might be expressed on the membrane of monocytes and DC stimulated by this pathway. Staining of monocytes stimulated for 16 h revealed that about one-half of the cells (range, 44.2–53.1% in four independent experiments) were strongly positive for TL1A (Fig. 5), while DC stained at this time point showed an average of 12.6% positive cells (range, 8.6–17.4 in four individual experiments, Fig. 5). To further characterize the TL1A surface expression upon IC stimulation, we performed time-course experiments. Stimulation of monocytes with IC revealed an increase of TL1A+ monocytes as early as 6 h after stimulation with IC (Table I). The number of TL1A+ monocytes was sustained for up to 16 h while the mean fluorescence intensity (MFI) increased over time. Taken together, the increase in TL1A mRNA upon IC stimulation represents the increased numbers of TL1A+ monocytes and up-regulated TL1A surface expression as well as increased soluble TL1A.


Figure 5
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 5. Induction of cell surface TL1A on monocytes (A, C, E, and G) and DC (B, D, F, and H) without stimulation (A and B) and after stimulation with LPS (C and D), Pam3CSK4 (E and F), and plate-bound IgG (16 h; G and H). Cells were stained for flow cytometry with a TL1A-specific mAb (shaded) or isotype control (unshaded) as detailed in Materials and Methods. Representative of four experiments with monocytes and four experiments with DC, respectively.

 

View this table:
[in this window]
[in a new window]

 
Table I. Time course of TL1A induction on the cell surface of monocytesa

 
It was conceivable that TLR and/or IFN-{gamma} signaling could induce membrane-bound but not soluble TL1A. We therefore investigated the surface expression of TL1A following TLR and IFN-{gamma} stimulation and found no induction of either surface (Fig. 5) or soluble (Fig. 3) TL1A by these pathways.

Fc{gamma}R signaling of monocytes enhances IFN-{gamma} production by CD4+ T cells through induction of TL1A expression

To determine whether Fc{gamma}R induced TL1A expression in monocytes has a functional consequence, we used an IL-12/IL-18-primed CD4+ T cell culture system. We have demonstrated that this system is very sensitive to low concentrations of TL1A when IFN-{gamma} production is used as the readout (14). To see whether monocyte-induced TL1A could enhance IL-12/IL-18-primed CD4+ T cell production of IFN-{gamma}, CD4+ T cells from healthy donors were incubated overnight with IL-12/IL-18. The following day, T cells were cocultured with autologous monocytes that had been pretreated with or without IC. After an additional 48 h, supernatants were collected and assayed for IFN-{gamma}. As shown in Fig. 6, we observed an at least 5-fold increase of IFN-{gamma} production by IL-12/IL-18-primed CD4+ T cells cocultured with IC-treated monocytes compared with untreated cells (Fig. 6A). To determine whether this additional increase of IFN-{gamma} production was due to TL1A induced by Fc{gamma}R signaling, we used blocking TL1A Ab in the cocultures. In titration experiments, we determined the maximal inhibitory efficiency of this TL1A Ab to be ~50% under the same experimental conditions as used above (data not shown). The additional increase of IFN-{gamma} production by CD4+ T cells cocultured with IC-treated monocytes was inhibited by an average of 36% (Fig. 6B). Taken together these data demonstrate that the TL1A induced by Fc{gamma}R signaling of monocytes is biologically active in vitro and results in enhanced IFN-{gamma} production by CD4+ T cells.


Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 6. TL1A enhances IFN-{gamma} production by CD4+ T cells in cocultures with monocytes. A, CD4+ T cells were isolated and incubated overnight with IL-12 and IL-18. The next day, T cells were either cultured alone or cocultured with monocytes that had been preincubated with or without IC overnight. After 48 h, supernatants were harvested and analyzed for IFN-{gamma} production by ELISA. B, Cocultures of CD4+ T cells and IC-treated monocytes were left untreated or incubated with anti-TL1A or control Abs. After 48 h, supernatants were harvested and analyzed for IFN-{gamma} production by ELISA. Representative data of three experiments with similar results is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Our finding that both membrane and soluble TL1A are induced in APC and that this TL1A can enhance IFN-{gamma} production by CD4+ T cells adds a new dimension to the physiology of these cells and highlights the importance of Fc{gamma}R signaling as a major APC activation pathway. Given the potent costimulatory action of TL1A on T cells and NK cells which we recently reported (5), our new finding that TL1A expression on APC is powerfully up-regulated by IC deserves further investigation, because it suggests that APC possess yet another Fc{gamma}R-dependent mechanism by which they may activate, polarize, or amplify the T cell response. Much is known about TLR signaling in DC and the cooperative effect of stimulation via more than one pathway (16). However, Fc{gamma}R stimulation by itself has been shown to lead to full maturation of DC (17), in terms of MHC class II and CD80/86 expression, and, in this study, Fc{gamma}R signaling by itself strongly induced TL1A. Signal transduction by activating Fc{gamma}R comprises some downstream events not shared by TLR- or STAT-mediated signaling, such as increase in intracellular Ca2+ (18), which may be required for effective TL1A induction. Most Fc{gamma}R+ cells coexpress excitatory and inhibitory receptors and ligands will presumably engage both types (18). Exactly how cells are so strongly stimulated by IC, and, more generally, how a given stimulus may activate excitatory vs inhibitory Fc{gamma}R remain to be determined, as does how the IC stimulus we have used may relate to that provided by various types of in vivo IC or by opsonized targets. Experiments in mice, for instance, demonstrate Fc{gamma}R-mediated augmentation of Ag presentation (19), but also IC stimulation of monocytes and DC can abrogate IL-12 production and shift the DC from Th1 to Th2 inducers (20). Interfering with inhibitory signaling by Fc{gamma}R on DC stimulated by IC resulted in enhanced maturation and stimulated a strong T cell-mediated antimelanoma response in mice (21). The experiments of Hsu et al. (8) with DcR3-transgenic mice infected with Listeria monocytogenes emphasized the requirement for TL1A in mounting the efficacious Th1 response in wild-type mice. The predominance of the Fc{gamma}R signaling pathway in triggering TL1A expression in APC, perhaps initiated in vivo by contact with opsonized pathogens, implies that APC-derived TL1A may also play a role in amplification of the recall response.

We have previously provided evidence that T cell membrane TL1A contributes to IFN-{gamma} production (5). Although TL1A lacks a consensus signal sequence, it does contain a putative N-terminal transmembrane region, followed by a potential protease cleavage site (1). Following an inducing stimulus, TL1A appears on the cell membrane; thus, cleavage from the membrane may account for its appearance in supernatants. We observed a high surface expression of TL1A after Fc{gamma}R stimulation in monocytes but only a modest induction of TL1A surface expression in DC. However, supernatant of DC stimulated with IC contain higher soluble TL1A concentrations than monocyte supernatants. This might suggests a difference in the protease activity in DC and monocytes and might reflect different functional consequences of membrane vs soluble TL1A in monocytes and DC favoring direct APC-T cell interaction for monocytes and indirect activation of T cells via DC.

Fc{gamma}R stimulation induces TL1A in peripheral monocytes and DC, but whether this pathway is relevant for mucosal T cells must be determined. Most DC studied in the gut produce IL-10 and appear to be tolerogenic. Smythies et al. (22) recently discovered that Fc{gamma}R, CD14, and other proinflammatory receptors are stably down-regulated on intestinal lamina propria macrophages. This finding may imply that Fc{gamma}R-mediated induction of TL1A in the lamina propria, like LPS activation of TLR4, is also nonfunctional. Hence, the clearly documented involvement of TL1A in intestinal inflammation (8) may arise from stimulation of other Fc{gamma}R-bearing APC, perhaps on cells infiltrating from blood (23) or within the mesenteric nodes (8). Recently, a network of DC has been demonstrated within the muscular layer of the intestine in mice, and these cells express CD14 and Fc{gamma}R (24). The role of these DC and the provenance of monocytes and DC involved in TL1A-mediated potentiation of the inflammatory response in the gut remain to be elucidated.

The present findings show that TL1A is centrally involved in the response of monocytes and DC to specific activating stimuli, as previously shown for T and NK cells (14). In T and NK cells, costimulation by TL1A is controlled by activation-induced expression of its receptor, DR3 (14), as well as by expression of TL1A on the surface membrane in T cells (6). In monocytes and DC, Fc{gamma}R stimulation induces surface and soluble TL1A. Fc{gamma}R-induced TL1A in monocytes leads to enhancement of T cell responses. Cocultures of T cells with monocytes that have been treated with IC greatly enhanced IFN-{gamma} release. The enhanced IFN-{gamma} release could be substantially blocked with anti-TL1A Abs, which suggests that the enhanced IFN-{gamma} secretion by IL-12/IL-18-primed T cells was at least partially TL1A mediated. Thus, the potent costimulatory activity of TL1A is tightly controlled and brought into play only by specific activating pathways. In contrast to the reported IL-1beta- and TNF-{alpha}-induced TL1A up-regulation in human endothelial cells (1, 15), we did not observe TL1A up-regulation in response to IL-1beta or TNF-{alpha} in human monocytes (data not shown).

The role of TL1A in gut inflammation has been circumstantial until the recent results of a genome-wide scan by Yamazaki et al. (9), showing strong association of the tl1a gene single nucleotide polymorphisms with Crohn’s disease, implying a functional involvement. The experiments of Hsu et al. (8) in DcR3-transgenic mice further substantiated a functional requirement for TL1A in mounting a Th1 response to intestinal infection. Recently, Bamias et al. (10) demonstrated a significant up-regulation of TL1A and its receptor DR3 in the inflamed mucosa in two different murine models of ileitis, which confirmed earlier findings in inflammatory bowel disease patients (7).

The foregoing demonstration that induction of TL1A on APC via specific activating pathways represents the first report that the receptor/ligand pair DR3/TL1A is at the center of immune response initiation. When these findings are followed up by additional functional experiments in relevant patient populations, a variety of unanswered questions concerning normal and dysregulated inflammatory response may be elucidated.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Stephan R. Targan, Division of Gastroenterology, Inflammatory Bowel Disease Center, and Immunobiology Institute, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Suite D4063, Los Angeles CA 90048. E-mail address: targans{at}cshs.org Back

2 Abbreviations used in this paper: DR3, death domain receptor 3; DC, dendritic cell; DcR3, decoy receptor 3; IC, immune complex; MFI, mean fluorescence intensity; Pam3CSK4, N-palmitoyl-S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-[R]-Cys-[S]-Ser-[S]-Lys(4) trihydrochloride. Back

Received for publication November 13, 2006. Accepted for publication January 8, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Migone, T. S., J. Zhang, X. Luo, L. Zhuang, C. Chen, B. Hu, J. S. Hong, J. W. Perry, S. F. Chen, J. X. Zhou, et al 2002. TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity 16: 479-492. [Medline]
  2. Wen, L., L. Zhuang, X. Luo, P. Wei. 2003. TL1A-induced NF-{kappa}B activation and c-IAP2 production prevent DR3-mediated apoptosis in TF-1 cells. J. Biol. Chem. 278: 39251-39258. [Abstract/Free Full Text]
  3. Papadakis, K. A., C. Landers, J. Prehn, E. A. Kouroumalis, S. T. Moreno, J. C. Gutierrez-Ramos, M. R. Hodge, S. R. Targan. 2003. CC chemokine receptor 9 expression defines a subset of peripheral blood lymphocytes with mucosal T cell phenotype and Th1 or T-regulatory 1 cytokine profile. J. Immunol. 171: 159-165. [Abstract/Free Full Text]
  4. Kunkel, E. J., J. J. Campbell, G. Haraldsen, J. Pan, J. Boisvert, A. I. Roberts, E. C. Ebert, M. A. Vierra, S. B. Goodman, M. C. Genovese, et al 2000. Lymphocyte CC chemokine receptor 9 and epithelial thymus-expressed chemokine (TECK) expression distinguish the small intestinal immune compartment: epithelial expression of tissue-specific chemokines as an organizing principle in regional immunity. J. Exp. Med. 192: 761-768. [Abstract/Free Full Text]
  5. Papadakis, K. A., D. Zhu, J. L. Prehn, C. Landers, A. Avanesyan, G. Lafkas, S. R. Targan. 2005. Dominant role for TL1A/DR3 pathway in IL-12 plus IL-18-induced IFN-{gamma} production by peripheral blood and mucosal CCR9+ T lymphocytes. J. Immunol. 174: 4985-4990. [Abstract/Free Full Text]
  6. Prehn, J. L., S. Mehdizadeh, C. J. Landers, X. Luo, S. C. Cha, P. Wei, S. R. Targan. 2004. Potential role for TL1A, the new TNF-family member and potent costimulator of IFN-{gamma}, in mucosal inflammation. Clin. Immunol. 112: 66-77. [Medline]
  7. Bamias, G., C. Martin, 3rd, M. Marini, S. Hoang, M. Mishina, W. G. Ross, M. A. Sachedina, C. M. Friel, J. Mize, S. J. Bickston, et al 2003. Expression, localization, and functional activity of TL1A, a novel Th1-polarizing cytokine in inflammatory bowel disease. J. Immunol. 171: 4868-4874. [Abstract/Free Full Text]
  8. Hsu, T. L., Y. Y. Wu, Y. C. Chang, C. Y. Yang, M. Z. Lai, W. B. Su, S. L. Hsieh. 2005. Attenuation of Th1 response in decoy receptor 3 transgenic mice. J. Immunol. 175: 5135-5145. [Abstract/Free Full Text]
  9. Yamazaki, K., D. McGovern, J. Ragoussis, M. Paolucci, H. Butler, D. Jewell, L. Cardon, M. Takazoe, T. Tanaka, T. Ichimori, et al 2005. Single nucleotide polymorphisms in TNFSF15 confer susceptibility to Crohn’s disease. Hum. Mol. Genet. 14: 3499-3506. [Abstract/Free Full Text]
  10. Bamias, G., M. Mishina, M. Nyce, W. G. Ross, G. Kollias, J. Rivera-Nieves, T. T. Pizarro, F. Cominelli. 2006. Role of TL1A and its receptor DR3 in two models of chronic murine ileitis. Proc. Natl. Acad. Sci. USA 103: 8441-8446. [Abstract/Free Full Text]
  11. Young, H. A., M. G. Tovey. 2006. TL1A: a mediator of gut inflammation. Proc. Natl. Acad. Sci. USA 103: 8303-8304. [Free Full Text]
  12. Chapuis, F., M. Rosenzwajg, M. Yagello, M. Ekman, P. Biberfeld, J. C. Gluckman. 1997. Differentiation of human dendritic cells from monocytes in vitro. Eur. J. Immunol. 27: 431-441. [Medline]
  13. Lodes, M. J., Y. Cong, C. O. Elson, R. Mohamath, C. J. Landers, S. R. Targan, M. Fort, R. M. Hershberg. 2004. Bacterial flagellin is a dominant antigen in Crohn disease. J. Clin. Invest. 113: 1296-1306. [Medline]
  14. Papadakis, K. A., J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, S. R. Targan. 2004. TL1A synergizes with IL-12 and IL-18 to enhance IFN-{gamma} production in human T cells and NK cells. J. Immunol. 172: 7002-7007. [Abstract/Free Full Text]
  15. Kim, S., L. Zhang. 2005. Identification of naturally secreted soluble form of TL1A, a TNF-like cytokine. J. Immunol. Methods 298: 1-8. [Medline]
  16. Napolitani, G., A. Rinaldi, F. Bertoni, F. Sallusto, A. Lanzavecchia. 2005. Selected Toll-like receptor agonist combinations synergistically trigger a T helper type 1-polarizing program in dendritic cells. Nat. Immunol. 6: 769-776. [Medline]
  17. Regnault, A., D. Lankar, V. Lacabanne, A. Rodriguez, C. Thery, M. Rescigno, T. Saito, S. Verbeek, C. Bonnerot, P. Ricciardi-Castagnoli, S. Amigorena. 1999. Fc{gamma} receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J. Exp. Med. 189: 371-380. [Abstract/Free Full Text]
  18. Ravetch, J. V., S. Bolland. 2001. IgG Fc receptors. Annu. Rev. Immunol. 19: 275-290. [Medline]
  19. Hamano, Y., H. Arase, H. Saisho, T. Saito. 2000. Immune complex and Fc receptor-mediated augmentation of antigen presentation for in vivo Th cell responses. J. Immunol. 164: 6113-6119. [Abstract/Free Full Text]
  20. Anderson, C. F., M. Lucas, L. Gutierrez-Kobeh, A. E. Field, D. M. Mosser. 2004. T cell biasing by activated dendritic cells. J. Immunol. 173: 955-961. [Abstract/Free Full Text]
  21. Kalergis, A. M., J. V. Ravetch. 2002. Inducing tumor immunity through the selective engagement of activating Fc{gamma} receptors on dendritic cells. J. Exp. Med. 195: 1653-1659. [Abstract/Free Full Text]
  22. Smythies, L. E., M. Sellers, R. H. Clements, M. Mosteller-Barnum, G. Meng, W. H. Benjamin, J. M. Orenstein, P. D. Smith. 2005. Human intestinal macrophages display profound inflammatory anergy despite avid phagocytic and bacteriocidal activity. J. Clin. Invest. 115: 66-75. [Medline]
  23. Grimm, M. C., W. E. Pullman, G. M. Bennett, P. J. Sullivan, P. Pavli, W. F. Doe. 1995. Direct evidence of monocyte recruitment to inflammatory bowel disease mucosa. J. Gastroenterol. Hepatol. 10: 387-395. [Medline]
  24. Flores-Langarica, A., S. Meza-Perez, J. Calderon-Amador, T. Estrada-Garcia, G. Macpherson, S. Lebecque, S. Saeland, R. M. Steinman, L. Flores-Romo. 2005. Network of dendritic cells within the muscular layer of the mouse intestine. Proc. Natl. Acad. Sci. USA 102: 19039-19044. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Exp. Med.Home page
B. P. Pappu, A. Borodovsky, T. S. Zheng, X. Yang, P. Wu, X. Dong, S. Weng, B. Browning, M. L. Scott, L. Ma, et al.
TL1A-DR3 interaction regulates Th17 cell function and Th17-mediated autoimmune disease
J. Exp. Med., May 12, 2008; 205(5): 1049 - 1062.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. N. Forthal, G. Landucci, J. Bream, L. P. Jacobson, T. B. Phan, and B. Montoya
Fc{gamma}RIIa Genotype Predicts Progression of HIV Infection
J. Immunol., December 1, 2007; 179(11): 7916 - 7923.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
L. J. ROBINSON, C. W. BORYSENKO, and H. C. BLAIR
Tumor Necrosis Factor Family Receptors Regulating Bone Turnover: New Observations in Osteoblastic and Osteoclastic Cell Lines
Ann. N.Y. Acad. Sci., November 1, 2007; 1116(1): 432 - 443.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
Shuang Chen, M. H. Wong, D. J. Schulte, M. Arditi, and K. S. Michelsen
Differential expression of Toll-like receptor 2 (TLR2) and responses to TLR2 ligands between human and murine vascular endothelial cells
Innate Immunity, October 1, 2007; 13(5): 281 - 296.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prehn, J. L.
Right arrow Articles by Targan, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prehn, J. L.
Right arrow Articles by Targan, S. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS