|
|
||||||||


,¶

* Iron Genes and Immune System Laboratory, Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal;
Iron Genes and Immune System Laboratory, Instituto de Ciências Biomédicas Abel Salazar, Porto, Portugal;
Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal;
Lysosome and Peroxysome Unit, Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal; and
¶ Lysosome and Peroxysome Unit, Instituto de Ciências Biomédicas Abel Salazar, Porto, Portugal
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
2-microglobulin (
2m), and only this heterodimer (HFE/
2m) is able to travel through the standard secretory pathway toward the cell surface (2). The observation that HFE binds to transferrin receptor I (TfR1), a homodimeric cell surface glycoprotein that acts as the receptor for iron-loaded transferrin, implicated HFE in the regulation of iron homeostasis (3). The majority of HH patients carry an HFE mutation, in which cysteine at position 282 is changed to tyrosine (C282Y) (2). This mutation prevents the formation of an intramolecular disulfide bridge in the
3 domain of HFE abrogating
2m association and inhibiting the trafficking of protein toward the cell surface (4). The C282Y mutant protein is retained in the endoplasmic reticulum (ER) and middle Golgi compartment, fails to undergo late Golgi processing, and is subjected to accelerated degradation (5).
Accumulation of unfolded or misfolded proteins in the ER activates specific signaling pathways that are collectively referred to as the unfolded protein response (UPR). These pathways act to alleviate stress by enhancing the folding and/or degradation of misfolded proteins, and by reducing the rate of protein synthesis (6). H chain binding protein (BiP; also termed GRP78), an ER chaperone protein, is a key UPR sensor. In the absence of stress conditions, BiP binds to a number of ER stress-transducing proteins, dsRNA-activated protein kinase-like ER kinase, activating transcription factor-6 (ATF6), and inositol-requiring 1 (Ire1) homologues
and
. This interaction keeps them inactive until the accumulation of misfolded proteins sequesters BiP and leads to the release and activation of the ER stress transducers (7, 8). Activation of protein kinase-like ER kinase results in the phosphorylation of proteins that regulate protein translation and UPR signaling (9). ATF6 is a transcription factor that becomes cleaved and relocates to the nucleus, where it promotes expression of UPR-responsive genes (10, 11). Ire1 proteins are RNases that mediate the alternative splicing of X box-binding protein-1 (XBP-1) mRNA to produce an active transcription factor that likewise promotes transcription of UPR-responsive genes (12).
The UPR activation has several important physiological implications (6). Of relevance in this work are recent studies investigating whether MHC-I degradation caused by human CMV proteins (US11 and US2) is sensitive to whether or not a cell is experiencing UPR stress (13, 14). MHC-I molecules are cell surface glycoproteins expressed in virtually all nucleated mammalian cell types. MHC-I molecules present Ags to CD8+ T cells. These Ags are mainly derived from the proteolysis of cytosolic proteins, including those that are normally derived from infecting viruses (15, 16, 17). The resulting peptides are translocated into the ER lumen by the TAP1/TAP2 heterodimer (18, 19), where they are further processed by the ER-associated aminopeptidase (20, 21). The formation of the peptide-loading complex facilitates the binding of peptide to MHC-I/
2m heterodimers (22). At this stage, a set of quality control mechanisms acts to ensure that high-affinity peptides are loaded onto class I molecules (23). The newly formed peptide-loaded MHC-I molecules are then released from the peptide-loading complex and delivered to the cell surface via the standard secretory pathway.
We have shown recently that the C282Y HFE mutation interferes with MHC-I peptide loading and optimization in the ER, and that cells carrying the mutant protein display reduced cell surface expression of MHC-I molecules (24). Given that misfolding ER proteins are capable of activating the UPR and the recent studies on the virally induced UPR and MHC-I processing (13, 14), we hypothesized that MHC-I anomalies observed in HFE C282Y PBMCs might arise as a result of an ER stress associated with the mutant HFE proteins. In this study, we test this hypothesis and demonstrate that an active UPR associated with the HFE C282Y mutant protein does indeed impair MHC-I cell surface expression.
| Materials and Methods |
|---|
|
|
|---|
The following Abs were used: the mAb W6/32 (DakoCytomation) recognizes MHC-I molecules; HC10 (mouse anti-human MHC-I) recognizes free MHC-I H chains (a gift from J. Neefjes, The Netherlands Cancer Institute, Amsterdam, The Netherlands); 8C-10 (mouse anti-human HFE) recognizes HFE/
2m heterodimers (a gift from R. Ehrlich, Department of Cell Research and Immunology, Tel Aviv University, Tel Aviv, Israel); rabbit anti-HFE cytoplasmic tail (CT) (25); mouse anti-KDEL (detects BiP and GRP94) and rabbit anti-
-actin (Abcam); donkey anti-mouse FITC-conjugated secondary Ab (Jackson ImmunoResearch Laboratories); FITC anti-CD71 (TfR1) (BD Pharmingen); and mouse anti-E-cadherin (Beckman Coulter).
The HFE wild-type (wt)-pcDNA3 construct was a gift from L. Salter-Cid (RW Johnson Pharmaceutical Research Institute, San Diego, CA). HLA-A2-pcDNA3.1 and
2m-pcDNA3.1 constructs were a gift from H. Drakesmith (University of Oxford, Oxford, U.K.). CMV-driven ATF6-DN (26) and XBP-1-DN (27) plasmids were a gift from R. Prywes (Columbia University, New York, NY) and L. Glimcher (Harvard School of Public Health, Boston, MA), respectively. The pEP7-nATF6-FL vector expressing a nuclear targeted and transcriptionally active fragment of ATF6 (nATF6; aa 1373) was generated by pfu (Stratagene) PCR amplification using human embryonic kidney 293 cell cDNA as template and specific sense (GGGAAGCTTGCCACCATGGGGGAGCCGGCTGGGGTTGCCGGCACCATGGAG) and antisense (CCCCCTCGTCGACGGGACTTTAAGCCTCTGGTTCTCTGACACAACTTC) primers. PCR products were cloned into the HindIII and SalI sites of the FLAG-tagged pEP7-FL vector, as described previously (28). A plasmid encoding the spliced form of XBP-1 (sXBP-1) was a gift from K. Mori (Kyoto University, Kyoto, Japan) and acted as template for a pfu PCR amplification using the specific sense (GGGAAGCTTGCCACCATGGTGGTGGTGGCAGCCGCGCCGAAC) and antisense (CCCCCTCGTCGACACACTAATCAGCTGGGGAAAGAGTTCATTGGC) primers. The amplified product was cloned into the HindIII and SalI sites of the pEP7-FL vector to give the pEP7-sXBP-1-FL vector.
Cells
PBMCs were obtained from healthy blood donors (wt HFE) and HH patients (HFE C282Y homozygous) at the HH Clinic, Santo António General Hospital (Porto, Portugal), after informed consent was obtained, according to the declaration of Helsinki. The study protocol was approved by the hospitals ethical board. When possible, in each individual experiment subjects were matched by sex and age. PBMCs were isolated following an established procedure. Briefly, after centrifugation over Lymphoprep (Nycomed), PBMCs were washed with HBSS. Contaminating RBCs were lysed in 10 mM Tris and 150 mM NH4Cl (pH 7.4) at 37°C for 10 min. Human embryonic kidney 293T cells were obtained from the American Type Culture Collection.
HFE genotyping
HFE genotyping was done using the Hemochromatosis StripAssayB kit (ViennaLab), according to the manufacturers protocol.
Site-directed mutagenesis
The QuikChange site-directed mutagenesis kit (Stratagene) was used as described in manufacturers protocol to produce the HFE C282Y and the HLA-A2 C283Y constructs. Mutagenesis was confirmed by DNA sequencing of both strands.
Transfections
For the RT-PCR, flow cytometry, and metabolic labeling experiments, 293T cells were transiently transfected using lipofectamine 2000 (Invitrogen Life Technologies) in 60-mm plates, according to the manufacturers protocol. At the time of transfection, cells were 9095% confluent. Opti-MEM was used to dilute both DNA and lipofectamine at a final DNA:lipofectamine ratio of 1:2.5. After transfection, cells were incubated for 48 h in DMEM w/GlutaMAX medium (Invitrogen Life Technologies) containing 1% of penicillin/streptomycin/amphotericin solution (Sigma-Aldrich) and 10% heat-inactivated FBS.
RT-PCR
Total RNA was extracted using the TRIzol reagent (Invitrogen Life Technologies), according to the manufacturers protocol. For analysis of actin, BiP, C/EBP homologous protein (CHOP), and HFE gene expression, cDNA was reverse transcribed and amplified from 100 ng of total RNA using Access RT-PCR (Promega) following manufacturers instructions. After separation on 1.5% agarose gels with ethidium bromide (Sigma-Aldrich), the specific bands were quantified with ImageQuant v5.1 software. The primer sequences used for the amplifications were as follows: BiP, 5'-CCTGGGTGGCGGAACCTTCGATGTG-3' and 5'-CTGGACGGGCTTCATAGTAGACCGG-3'; CHOP, 5'-GCCTTTCTCCTTTGGGACACTGTCCAGC-3' and 5'-CTCGGCGAGTCGCCTCTACTTCCC-3'; and HFE, 5'-ATGGGCCCGCGAGCCAGGCCGGCGCTTCT-3' and 5'-TCACTCACGTTCAGCTAAGACGTAGTGCC-3'.
For analysis of XBP-1 splicing, 5 µg of RNA was reverse transcribed using ThermoScript RT-PCR system (Invitrogen Life Technologies), following manufacturers instructions. PCR amplification was performed with the DFS-TaqDNA polymerase (Bioron) using a previously described pair of primers that differentiate between the sXBP-1 and unspliced form of XBP-1 (12). Amplified products were resolved on 2% agarose gels. Pharmacological induction of the UPR was performed by incubating the cells with 2 mM DTT (Sigma-Aldrich) for 5 h (29).
Quantitative real-time RT-PCR
For real-time PCR analysis, total RNA was extracted with TRIzol reagent (Invitrogen Life Technologies), according to the manufacturers instructions. Following treatment with 2 U/sample of RQ1 DNase, in the presence of 50 U/sample of RNase inhibitor (Invitrogen Life Technologies), for 30 min at 37°C, 1 µg of RNA was reverse transcribed, using Thermoscript reverse transcriptase (Invitrogen Life Technologies), following the manufacturers instructions. Expression of MHC-I (HLA-A) was evaluated by quantitative real-time PCR with the ABI PRISM 7700 instrument (Applied Biosystems). Quantitative real-time PCR was conducted in triplicates, using 1x SYBR Green PCR Master Mix (Applied Biosystems). Quantification of
-actin gene expression was performed as a control. Relative expression levels were calculated as 2^(cycle threshold human
-actin cycle threshold HLA-A x 10,000) (for details see ABI PRISM 7700, User Bulletin 2). MHC-I (HLA-A allele) primer sequences are as follows: 5'-CACGAGCTCCGTGTCCTGGGTCTG-3' and 5'-AAGGATTACATCGCCCTGAACG AGGAC-3'.
Flow cytometry
Forty-eight hours after transfection, 293T cells were stained for surface HFE, TfR, E-cadherin, and MHC-I. Briefly, 5 x 105 cells were washed in ice-cold PBS, 0.2% BSA, and 0.1% NaN3, followed by incubation at 4°C with a saturating amount of primary Ab for 30 min in 96-well plates. After three washes, cells were incubated with secondary Ab for 30 min on ice. Cells were washed twice, and flow cytometry analysis was performed in a FACSCalibur. For each sample, a minimum of 10,000 events was acquired. To define the background staining, irrelevant mAbs of the same isotype were used. We frequently observed two histogram peaks in the experiments, which may reflect the existence of the two following populations of cells: transfected and nontransfected.
Metabolic labeling
Forty-eight hours after transfection, 2.5 x 106 293T cells were starved for 1 h in cysteine/methionine-free DMEM medium (Invitrogen Life Technologies) supplemented with 1% L-glutamine and labeled for 3 h with 140 µCi/ml Pro-Mix L-[35S]cysteine/methionine (Amersham Biosciences). After labeling, cells were washed three times with HBSS and lysed in ice-cold lysis buffer (300 mM NaCl, 50 mM Tris-HCl (pH 7.4), 1% Triton X-100, Complete EDTA Free-protease inhibitor mixture (Roche Diagnostics), and 10 mM iodoacetamide (Sigma-Aldrich). The nuclei and cell debris were removed by centrifugation, and the lysates were precleared with 100 µl of protein A-Sepharose beads slurry (50%) for 1 h at 4°C. The lysates containing equivalent amounts of TCA-precipitable radioactivity were incubated at 4°C with anti-KDEL. Immunocomplexes were pulled down with protein A-Sepharose beads and washed three times in ice-cold lysis buffer. After addition of gel-loading buffer solution (30) with 10% 2-ME and boiling for 5 min, samples were loaded on 10% SDS-PAGE.
SDS-PAGE and quantitation
Ten percent SDS-PAGE was performed using a Bio-Rad Mini Protean II kit. Gels were fixed in 10% acetic acid and 40% methanol, incubated for 30 min with Amplify solution (Amersham Biosciences), dried, and exposed to a radioactivity storage screen. Quantitation was performed using a Typhoon PhosphorImager (Amersham Biosciences) with ImageQuant v5.1 software.
Western blot
Total protein concentration from whole cell lysates was determined with RC/DC Protein Assay (Bio-Rad) and 30 µg (PBMC) or 20 µg (293T-transfected cells) separated by SDS-PAGE. The proteins were then transferred to a nitrocellulose Hybond-C membrane (Amersham Biosciences). After blocking at 4°C with 5% dry milk/0.05% Tween 20 in PBS (PBS-T), the membrane was incubated with anti-HFE (CT) and anti-KDEL or HC10, washed three times with PBS-T, and detected with the respective HRP-conjugated secondary Ab (Molecular Probes) and an ECL substrate (Pierce). As a loading control, the membrane was stripped using Restore WB Stripping Buffer (Pierce) and incubated with anti-
-actin.
Statistical analysis
To test the significance of the differences observed, Students t test was used. In all tests, the statistical significance was two sided and considered at p < 0.05. Data are displayed as mean ± 1 SD.
| Results |
|---|
|
|
|---|
We have demonstrated recently that PBMCs derived from HFE C282Y homozygous patients have decreased MHC-I cell surface expression (24). To help explain the molecular and cellular mechanisms linking this phenotype with mutant HFE, we developed a cell line model for use in parallel with experiments on human PBMCs. The 293T cell line was chosen because it does not produce endogenous HFE and, as all nucleated cells, expresses MHC-I (Fig. 1, A, B, and D). Western blot analysis was used to demonstrate expression of the HFE wt and C282Y proteins in transient transfection experiments, and flow cytometry used to confirm previous reports (4, 5) that the C282Y mutant is unable to travel to the cell surface (Fig. 1, B and C). Most importantly, however, quantitative real-time PCR showed that MHC-I mRNA levels were unaffected by expression of either the wt or mutant HFE proteins (Fig. 1D). In these studies, and unless otherwise stated, a plasmid encoding
2m was cotransfected with HFE expression vectors to ensure that sufficient quantity of this protein was available for HFEs correct assembly.
|
To determine whether the UPR is activated in cells expressing the C282Y mutant form of HFE, the mRNA and/or protein levels of three UPR targets, BiP and GRP94 (two ER-resident chaperones) and CHOP, were assessed. Increased levels of both BiP and CHOP gene transcripts were found by RT-PCR in 293T cells transiently cotransfected with HFE C282Y/
2m compared with mock-treated and HFE wt/
2m-expressing cells (Fig. 2A). Forty-eight hours after HFE C282Y/
2m cotransfection, there was a 2.9-fold increase in BiP and a 4.7-fold increase in CHOP gene transcript levels in relation to mock 293T cells. HFE wt/
2m cotransfection led to a 1.3- and 1.4-fold increase in BiP and CHOP levels, respectively. A similar and statistically significant (p < 0.01) result was found when PBMCs isolated from C282Y homozygous HH patients were compared with PBMCs from control groups (Fig. 3A). BiP and CHOP mRNA levels were respectively 2.0- and 1.8-fold higher in C282Y homozygous PBMCs.
|
|
2m-expressing cells when compared with HFE wt/
2m-cotransfected or mock cells (Fig. 2B). Although these studies demonstrated a specific C282Y-induced increase in the expression of UPR-related markers, we were interested also in examining the changes in UPR signaling that occur as a consequence of mutant HFE expression. To do this, we looked for Ire1-mediated signaling as demonstrated by increased splicing of XBP-1. The 293T cells were transfected with empty vector, vector expressing the C282Y HFE mutant, or vector expressing the sXBP-1 as a positive control. Mock-transfected cells were cultured in the presence or absence of UPR-inducing DTT for 5 h before harvest. Total RNA was extracted and RT-PCR was performed using primers that differentiate between the unspliced form of XBP-1 and sXBP-1 (19-base difference). These experiments clearly demonstrated that Ire1 signaling and alternative splicing of XBP-1 are occurring in the C282Y-expressing cells. The combined data from these experiments suggested that the level of alternative splicing was similar to that associated with the pharmacological induction of UPR signaling by DTT (Fig. 4).
|
3 domain correct assembly is the stimulus for the UPR activation
To confirm that the UPR activation occurs as a result of the inability to correctly assemble the
3 domain of HFE C282Y protein, the same point mutation was inserted in the HLA-A2 allele of MHC-I. HFE and MHC-I proteins are structurally very similar and share high amino acid identity (31). The cysteine at position 282 involved in the formation of an intramolecular disulfide bridge in the
3 domain of HFE (essential for
2m association) (2) is conserved in MHC-I (at position 283), playing the same role in the folding and
2m association of this protein. Thus, by inserting this mutation in MHC-I (HLA-A2 C283Y), a protein with the same folding defect (incorrect assembly of the
3 domain) of HFE C282Y is produced. The 293T cells transiently cotransfected with the HLA-A2 C283Y mutant expression vector and
2m exhibited BiP and CHOP mRNA as well as BiP and GRP94 protein levels comparable to those observed in the HFE C282Y-transfected cells (Fig. 2), suggesting that the
3 domain misfolding is the stress stimulus that leads to the UPR activation. Unlike its mutant counterpart, overexpression of the wt MHC-I protein in 293T cells did not activate the UPR (Fig. 2C).
The MHC-I anomalies observed in HFE C282Y mutant cells are not due to limiting
2m
We have demonstrated previously that PBMCs from HH patients expressing C282Y have a reduced cell surface expression of MHC-I (24). We wondered whether C282Y expression in the transfected cell model was likewise associated with decreased surface expression of MHC-I. The 293T cells were transfected to express the wt or C282Y mutant forms of HFE in the presence or absence of supplemental (i.e., cotransfected)
2m. Fig. 5A shows that the expression of either HFE wt or HFE C282Y in the absence of supplemented
2m resulted in decreased surface expression of MHC-I molecules compared with controls. This effect appears specific for surface expression of MHC-I because no differences were observed in surface expression of TfR1 and E-cadherin (Fig. 5C).
|
2m, the introduction of HFE wt would lead to competition for the available endogenous
2m. The reduction of cell surface MHC-I in HFE wt-expressing cells in Fig. 5A could therefore be due to the sequestration of the free
2m pools by the overexpressed protein. This would not be a feature of HFE C282Y expression due to its inability to bind
2m. To test this hypothesis,
2m was cotransfected with HFE wt or HFE C282Y in 293T cells. Flow cytometry analysis performed 48 h posttransfection showed partial rescuing of MHC-I cell surface expression after
2m cotransfection with HFE wt, but not with HFE C282Y (Fig. 5B).
These results appear to exclude
2m competition as an explanation for decreased surface expression of MHC-I, and instead appear to link protein misfolding with the observed MHC-I defects. Consistent with this, we noted that expression of the UPR-inducing HLA-A2 C283Y mutant also decreased surface expression of MHC-I (Fig. 5A).
An active UPR decreases MHC class I cell surface expression
To date, we had demonstrated that HFE C282Y induces a cellular UPR and that HFE C282Y-expressing cells have reduced cell surface expression of MHC-I. To specifically test whether the MHC-I defect was a consequence of the UPR, we applied two independent approaches. First, we transfected cells to express active isoforms of the UPR signaling transcription factors ATF6 (nATF6) and XBP-1 (sXBP-1). Both proteins were independently capable of activating the UPR in transfected 293T cells, as indicated by induced increases in BiP and GRP94 protein levels (Fig. 6A, upper panel, second and third lanes, respectively). Flow cytometry analysis revealed that both treatments were capable, along with C282Y-expressing cells, of significantly (p < 0.05) decreasing MHC-I cell surface expression compared with mock-treated cells (Fig. 6, B (middle histogram) and C). It is important to note that this effect was specific for cell surface MHC-I because the UPR induced by misfolding C282Y or sXBP-1 did not appear to give rise to any corresponding changes in total MHC-I expression (Fig. 6D).
|
Blocking UPR signaling rescues surface MHC-I expression
These data supported our hypothesis linking nonspecific UPR signaling with specific decreases in cell surface expression of MHC-I. Furthermore, having demonstrated in Fig. 4 that C282Y promotes splicing of XBP-1, and now showing in Fig. 6 that sXBP-1 can decrease cell surface expression of MHC-I, we believed that we had experimental evidence specifically linking C282Y-associated UPR with reduced surface MHC-I. Nevertheless, a second independent approach was applied to confirm this connection. Specifically, we wondered whether blocking UPR signaling, through the use of a dominant-negative XBP-1 protein, could rescue the decrease in surface MHC-I observed in C282Y-expressing cells.
Fig. 7 shows the results from transfection experiments performed to test this. In these experiments, the decrease in surface MHC-I that was associated with C282Y expression was similar to the significant decreases achieved through treatment of mock-transfected cells with DTT, or expression of the UPR signaling protein-sXBP-1. Cotransfection of XBP-1-DN to block UPR signaling significantly rescued surface MHC-I expression in C282Y-expressing cells. Similar results were obtained when a dominant-negative ATF6 protein was cotransfected with HFE C282Y (data not shown).
|
| Discussion |
|---|
|
|
|---|
The results obtained after introducing a MHC-I protein (HLA-A2) carrying a similar point mutation (C283Y) as HFE (C282Y), and hence prone to the same folding defect, further corroborate that this particular mutation is sufficient to abrogate the correct assembly and maturation of the protein, leading to the UPR activation. A link between the expression of a misfolded classical MHC-I protein and induction of the UPR was also recently demonstrated in the context of HLA-B27 (34).
With the purpose of investigating changes in MHC-I cell surface expression resulting from activation of the UPR, nATF6 or sXBP-1 was expressed on 293T cells. These experiments showed that UPR activation leads to the down-regulation of membrane-bound MHC-I molecules. This effect was specific for MHC-I cell surface expression because the UPR did not appear to affect total MHC-I expression. A comparable effect on MHC-I expression was observed in HFE C282Y-transfected cells.
We have described previously that MHC-I cell surface expression is decreased in HFE C282Y mutant PBMCs (24). The impact of HFE wt and C282Y overexpression on MHC-I expression in 293T cells was assessed in the present study. The results showed a significant reduction in surface-expressed MHC-I after the expression of each protein. The effect observed in HFE wt-expressing cells is reverted by HFE wt/
2m cotransfection being attributed to the competition between HFE wt and MHC-I for binding with the available
2m pool. A similar explanation for the MHC-I cell surface expression reduction in HFE wt-overexpressing cells was suggested previously (35). The MHC-I down-regulation following HFE C282Y expression cannot be explained in the same way. Indeed, considering that the C282Y mutation impairs the HFE/
2m association, the overexpression of HFE C282Y protein should not lead to the depletion of the free
2m pool. Instead, UPR activation appears to be the primary cause of decreased MHC-I in HFE C282Y-expressing cells. The results obtained with the ATF6-DN (data not shown) and the XBP-1-DN expression vectors consolidate our conclusions that a UPR is the source of the MHC-I anomalies described in HFE C282Y mutant cells. Indeed, the strong correlation between the XBP-1 alternative splicing levels (Fig. 4) and the reduction in MHC-I expression obtained in HFE C282Y- or sXBP-1-expressing cells, or in DTT-treated cells (Fig. 7), suggests that UPR signaling pathways mediate this HFE C282Y/MHC-I cross-talk. Furthermore, the UPR induced by the HFE C282Y provides a corrective measure for an insult that occurred in the ER, whereas in the case of sXBP-1 or nATF6 expression the ER is not subjected to a stress of any kind. This indicates that the effect on MHC-I is not due to the stress conditions in the ER, but a direct consequence of the UPR signaling pathway. The exact mechanisms behind the UPR/MHC-I cross-talk warrant further investigation.
A relationship between the ER exit and the UPR, namely through the modulation of cargo proteins levels, has already been described, suggesting that this stress response affects protein traffic from and beyond the ER (36, 37). The finding that the time spent by MHC-I complexes in the ER determines the extent of the peptide-loading optimization (38) suggests that its reduced cell surface expression in HFE C282Y mutant cells is the outcome of an incomplete peptide optimization due to the premature ER release in UPR active cells. In fact, we have shown recently that, in HFE 282Y mutant cells, MHC-I peptide loading and ER egress occur faster than in wt cells (24). Furthermore, thermostability assays and MHC-I endocytosis experiments showed that in the HFE mutant cells there is a premature MHC-I/peptide dissociation that is in accordance with the higher amount of free MHC-I H chains present at the cell surface and the increased MHC-I endocytosis rate observed in the HFE C282Y mutant cells (24).
The observed reduction of MHC class I expression as a consequence of the UPR may have some significance for work on viral immune evasion. In fact, several viruses lead to the activation of the UPR signaling pathway in infected cells. Although the reason for this is incompletely understood (13, 14, 39, 40, 41), it may constitute one of the mechanisms that viruses have evolved to evade immune surveillance.
Several examples of UPR activation by mutations that compromise the correct folding and intracellular trafficking of the proteins have already been reported (6). Most of them relate to a pathological condition either due to the proteins loss of function or through the implication in other cellular processes. In this study, we report that a point mutation (C282Y) in HFE leads to the UPR activation and that this mechanism has an impact on the cell surface expression of MHC-I molecules. Based on these findings, we suggest that the UPR activation that occurs in response to the HFEs misfolding of the C282Y mutant could be a contributing factor to the immunological defects reported in HH patients (42, 43, 44). A link between the UPR signaling pathway and MHC-I Ag presentation pathway is now established. The challenge for future studies is 2-fold, as follows: to elucidate the influence of the UPR on proteins involved in iron metabolism and the oxidative stress associated with iron overload and to test the impact of the MHC-I defects on the reported anomalies in lymphocyte numbers linked to severe iron overload in HH.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was financed by grants from Innova/American Portuguese Biomedical Research Fund (United States; Principal Investigator: M.d.S.) and Fundação para a Ciência e a Tecnologia/Calouste Gulbenkian Foundation (Portugal; Principal Investigator: M.d.S.), and Grants POCI/SAU-MMO/61129/2004 and SFRH/BPD/14639/2003 (Principal Investigator: J.V.F.). S.F.d.A. is recipient of a PhD fellowship (SFRH/BD/11348/2002) funded by the National Foundation for Science and Technology (Portugal). ![]()
2 Address correspondence and reprint requests to Dr. Maria de Sousa, Iron Genes and Immune System, Instituto de Biologia Molecular e Celular, Rua do Campo Alegre 823, 4150-180 Porto, Portugal. E-mail address: mdesousa{at}ibmc.up.pt ![]()
3 Abbreviations used in this paper: HH, hereditary hemochromatosis; ATF6, activating transcription factor-6;
2m,
2-microglobulin; BiP, H chain binding protein; CHOP, C/EBP homologous protein; CT, cytoplasmic tail; ER, endoplasmic reticulum; Ire1, inositol-requiring 1; XBP-1, X box-binding protein-1; sXBP-1, spliced form of XBP-1; TfR1, transferrin receptor 1; UPR, unfolded protein response; wt, wild type; MFI, mean fluorescence intensity; nATF6, nuclear targeted and transcriptionally active fragment of ATF6. ![]()
Received for publication September 5, 2006. Accepted for publication January 5, 2007.
| References |
|---|
|
|
|---|
2-microglobulin interaction and cell surface expression. J. Biol. Chem. 272: 14025-14028.
2-microglobulin, intracellular processing, and cell surface expression of the HFE protein in COS-7 cells. Proc. Natl. Acad. Sci. USA 94: 12384-12389.
-induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Immunol. 3: 1169-1176. [Medline]This article has been cited by other articles:
![]() |
S. F. de Almeida, G. Picarote, J. V. Fleming, M. Carmo-Fonseca, J. E. Azevedo, and M. de Sousa Chemical Chaperones Reduce Endoplasmic Reticulum Stress and Prevent Mutant HFE Aggregate Formation J. Biol. Chem., September 21, 2007; 282(38): 27905 - 27912. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |