The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radhakrishnan, S.
Right arrow Articles by Pease, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radhakrishnan, S.
Right arrow Articles by Pease, L. R.
The Journal of Immunology, 2007, 178: 3583-3592.
Copyright © 2007 by The American Association of Immunologists, Inc.

Induction of a Th1 Response from Th2-Polarized T Cells by Activated Dendritic Cells: Dependence on TCR:Peptide-MHC Interaction, ICAM-1, IL-12, and IFN-{gamma}1

Suresh Radhakrishnan*, Karla R. Wiehagen*, Vesna Pulko*, Virginia Van Keulen*, William A. Faubion*,{dagger}, Keith L. Knutson* and Larry R. Pease2,*

* Department of Immunology and {dagger} Division of Gastroenterology, Department of Internal Medicine, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN 55905


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Dendritic cells (DC) are important regulators of T cell immunity. The degree of stimulation, the pattern of costimulatory molecules expressed, and the cytokines secreted by DC dictate the nature of the effector and memory cells generated, particularly with respect to their Th1 or Th2 phenotypes. In this study, we demonstrate that the addition of activated DC to spleen cultures containing established Th2-polarized CD4+ T cells was sufficient to suppress Th2 and induce Th1 cytokines in a recall response, a phenomenon referred to as phenotype reversal. The ability of activated DC to induce phenotype reversal displayed exquisite Ag specificity. The DC activator B7-DC cross-linking Ab (XAb) was >10,000-fold more efficient at inducing phenotype reversal than the TLR agonists CpG-oligodeoxynucleotide and Gardiquimod. Characterization of the mechanisms governing phenotype reversal revealed the requirement for cognate interaction between the TCR:peptide-MHC complex, the expression of the costimulation/adhesion molecule ICAM-1, and secretion of IL-12 and IFN-{gamma} by the activated DC. The requirement for the costimulation/adhesion molecule SLAM (signaling lymphocytic activation molecule) was found to be quantitative. Thus, activation of DC, particularly by crosslinking B7-DC, can modulate well-established Th2 T cell responses in an Ag-specific manner. Because the regulation of mouse and human DC by B7-DC XAb overlaps in several significant ways, immune modulation with B7-DC XAb is a potential strategy for treating Th2-mediated diseases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The adaptive immune response displays flexibility both in the selective activation of Ag-specific cells and in the instruction of the effector mechanisms to be used by the selected responders. The existing paradigm specifies that molecular features of invading pathogens orient the host immune response to the nature of the infection by providing ligands for pattern recognition receptors expressed predominantly by cells in the innate immune compartment (1). Ags expressed by the invading pathogens provide specific targets for adaptive effector lymphocytes and direct the specificity of the ensuing response (2). Critical to the flexibility of the immune response is the notion that the nature of the Ag receptor expressed by any given lymphocyte is independent of the array of effector mechanisms that the cells can be programmed to execute (3). Both clonal selection of Ag-reactive lymphocytes and instruction regarding the effector mechanisms to be deployed occur in the secondary lymphoid organs as a result of interactions between APC, Ag-specific effectors, and a growing list of cells capable of regulating these interactions (4).

Although the effector phase of the immune response is a continuum with respect to the extent that various effector options are activated, the repertoire of possible responses has been described by the extremes, giving rise to the notion of response polarity. Thus, Th1 responses accentuating the production of IFN-{gamma} and T cell-mediated cytotoxic killing have been shown to provide effective intracellular antiviral activity, whereas Th2 responses featuring the production of IL-4 and supporting particular Ab isotypes are more associated with protection against extracellular pathogens (5, 6, 7).

The immune response can be ineffective or even problematic when orchestrated adaptive responses go awry. Allergic immune responses are strongly Th2-polarized responses (8) against seemingly innocuous environmental stimuli. The offending Ag sensitizes the host, selectively activating Ag-reactive lymphocytes and providing the cues to mobilize mucosal defenses that include IgE production and the recruitment of eosinophils. Upon re-exposure to the allergen, the ensuing recall responses can be very strong, causing significant discomfort or, in extreme cases, be fatal. On the other side of the spectrum, cancers that are effectively targeted by Th1-polarized immune responses can condition the host to respond ineffectively using Th2-associated effector mechanisms (9, 10, 11). The cancers can then grow unabated even when being actively recognized and targeted, albeit ineffectively, by the immune system. Clearly, it would be of great interest to be able to intervene and alter the polarity of established immune responses (12, 13).

Although the role of APC in activating and determining the polarity of naive T cells in the secondary lymphoid organs is well established (14), the ability of APC to direct the responses of memory T cells is less well understood. Studies using experimental models of Th2-polarized inflammatory airway disease clearly demonstrate that recall responses are flexible and can be manipulated toward an innocuous Th0/Th1 polarity by stimulating pattern recognition receptors expressed by cells of the innate immune compartment (15). Using peripheral blood cells from patients with known allergies to common environmental Ags, the polarity of recall responses by human memory T cells have been manipulated in a similar manner (16, 17, 18, 19). However, the cellular and molecular mechanisms mediating the phenotypic reversal of Th2-polarized cells are poorly defined. Stimuli have been applied either systemically to animals or to complex populations of cells in vitro, making it difficult to discern the identity of interacting cells and obscuring the key molecular interactions that regulate polarity modulation. In this study we describe the ability of defined populations of activated dendritic cells (DC)3 to mediate phenotype reversal of T cell polarity. We have used this system to define the requirement for T cell recognition of activated DC for the reprogramming of established Th2 polarity toward a Th1 response by taking advantage of an IgM Ab that binds to B7-DC/PD-L2. The B7-DC acts as a ligand for programmed death 1 (PD-1) expressed on activated T cells (20, 21) and activates DC when crosslinked with the B7-DC cross-linking Ab (XAb) (22, 23, 24, 25).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice and reagents

C57BL/6J, BALB/CJ, B6.129S4-Cd80tm1ShrCd86tm1Shr/J (26), B6.129S4-Icam1tm1Jcgr/J (27), and C.129s1(B6)-Il12atm1Jm/J (28) mice were purchased from The Jackson Laboratory. Signaling lymphocytic activation molecule (SLAM)–/– (29) mice were maintained at the Mayo Clinic (Rochester, NY). The LY9–/– (30) mice and the CD4+ Stat4–/–tmgru/J (31), Stat6–/–tmgru/J (32), C57BL/6-IFN-{gamma}tm1Ts (33), and 129-IFN-{gamma}Rtm1 (34) mice along with their appropriate haplotype-matched controls were a gift of Dr. M. Rodriguez, Mayo Clinic. All experiments were conducted using Mayo Clinic Institutional Animal Care and Use Committee-approved protocols. The clonal CD4+ T cell line clone 10 was previously described (35). Control Ab and B7-DC XAb were purified as described (22). The class II IgM Ab (25–9-3), Abs against mouse IFN-{gamma}-FITC (clone XMG1.2), IL-4-PE (clone 11B11) CD3-PerCP (clone 145-2C11), and CD4-PerCP (RM4-5) were purchased from BD Biosciences. An Ab against CD40 (clone 1C10) and an Ab against mouse B7-DC of IgG isotype (clone TY-25) were purchased from eBioscience. CpG (TCCATGACGTTCCTGACGTT) was synthesized at the Mayo Clinic Molecular Biology Core Facility (Rochester, MN). Polyinosinic:polycytidylic acid (pI:C) was purchased from Calbiochem. Gardiquimod was purchased from InvivoGen. LPS, OVA, and BSA were all purchased from Sigma-Aldrich. CpG, LPS, pI:C, and Gardiquimod were frozen at –20 as 1 mg/ml stock. T cell enrichment kits were purchased from R&D Systems. Cytokine ELISA kits for measuring IL-4, IL-5, and IFN-{gamma} were purchased from eBioscience.

Multiplexed microsphere cytokine immunoassay

A Bio-Rad mouse cytokine panel was used for this study. The kit measures concentrations of IL-3, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12(p70), GM-CSF, M-CSF, IL-17, IFN-{gamma}, and RANTES. The assay was performed as per the manufacturer’s direction along with standards. Briefly, 100 ml of Bio-Plex assay buffer were added to each well of a MultiScreen MABVN 1.2-µm microfiltration plate followed by the addition of 50 µl of the multiplex bead preparation. After washing of the beads with the addition of 100 µl of wash buffer, 50 µl the samples or standards were added to each well and incubated with shaking for 30 min at room temperature. The plate was then washed three times followed by incubation of each well in 25 µl of premixed detection Abs for 30 min with shaking. The plate was further washed and 50 µl of streptavidin solution was added to each well and incubated for 10 min at room temperature with shaking. The beads were given a final washing and resuspended in 125 µl of Bio-Plex assay buffer. Cytokine levels in the culture supernatant were quantitated by analyzing 100 µl of each sample on a Bio-Plex using Bio-Plex Manager software, version 4.0. Standard curves were generated with a mixture of cytokine standards provided by the supplier and eight serial dilutions ranging from 0 to 32,000 pg/ml.

Generation of mouse DC

DC from the mouse bone marrow was generated as previously described (22). In brief, bone marrow was isolated from the long bones of the hind legs. Erythrocytes were lysed by treatment with ammonium chloride/potassium bicarbonate/EDTA at 37°C. The remaining cells were plated at the density of 1 x 106/ml in six-well plates (BD Biosciences) in RPMI 1640 containing 10 ng/ml murine GM-CSF and 1 ng/ml murine IL-4 (PeproTech). The cells were incubated at 37°C with 5% CO2. After 48 h, the cells were washed and replated with RPMI 1640 containing the same concentration of GM-CSF and IL-4 for another 5 days.

Induction of Th2 polarity

Mice were immunized by an i.p. injection of 1 mg of OVA or BSA adsorbed to 1 mg of alum (Pierce). Experimental mice were later sacrificed and splenocytes were harvested as early as 2 wk or as late as 8 wk after injection and used to generate Ag-specific recall responses.

In vitro cytokine production and proliferation

Recall responses from sensitized splenocytes were assayed for cytokine production or proliferation. Briefly, after making a single cell suspension RBC were lysed by hypertonic shock using ammonium chloride/potassium bicarbonate/EDTA. Cells were counted and resuspended at 3 million cells/ml in RPMI 1640 (Cambrex) along with an Ag and a panel of activators. OVA and BSA were used as Ags, prepared at a concentration of 2 mg/ml, and titrated at half-log dilutions. Splenocytes were used at 3 x 105 cells per well in 100 µl. DC, used as stimulators, were pulsed with 1 mg/ml OVA, BSA, or sperm whale myoglobulin and treated with the indicated activators overnight at 10 µg/ml. The DC were washed extensively before being used to stimulate Th2-polarized T cells or the T cell line clone 10. Supernatants were harvested after 48 h and stored frozen at –20°C until used in ELISA-based cytokine assays as per the manufacturer’s instructions using commercial kits. The plates were read using a SoftPro plate reader. In some experiments, cells were then pulsed with [3H]thymidine during the last 18 h of the 72-h incubation period. Cells were then harvested and counted for the incorporation of [3H]thymidine (Packard Instrument).

DC and T cell enrichment

CD11c+ DC were enriched from cultures by positive selection using magnetic bead sorting (Miltenyi Biotec). CD11c+ DC enrichment varied from 70 to 85%. The remaining cells were CD11cCD11bhighGr-1int, a phenotype consistent with macrophage-like cells. No CD3+ cells were detected in the enriched DC cultures. In T cell enrichment experiments, cell suspensions were fractionated using a mouse T cell enrichment kit as per the manufacturer’s instructions (R&D Systems). Briefly, splenocytes were incubated in a T cell enrichment column for 15 min followed by washing and elution with the buffer provided by the manufacturer. The purity of isolated T cells was assessed by flow cytometry as described previously (22). The isolated T cells were >98% CD3+.

Intracellular cytokine staining

Splenocytes that were stimulated with Ag-pulsed DC for 48 h were incubated with 1 µg/ml brefeldin A (GolgiPlug) as per the manufacturer’s instructions for 4 h before being fixed and permeabilized using the Cytofix/Cytoperm kit (BD Pharmingen). After the addition of the IFN-{gamma} FITC Ab and the IL-4 PE Ab, cells were incubated on ice for 30 min and subjected to flow cytometry. Data were analyzed using Cell Quest Software (BD Bioscience).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The polarity of the recall response by sensitized spleen cells to Ag rechallenge can be modulated in vitro

Because the treatment of sensitized mice with the TLR-9 agonist CpG-oligodeoxynucleotide (CpG-ODN) (17) or the DC activator B7-DC XAb (36, 37) can modulate the polarity of Ag-specific recall responses and protect mice from experimental inflammatory airway disease, we surmised that sensitized T cells can be reprogrammed by interacting with activated DC to mitigate immune-based pathogenesis in models of experimental allergic asthma. To investigate the mechanisms that mediate the polarity modulation of recall responses, we sought to recapitulate these events in vitro using spleen cells from mice immunized with chicken OVA adsorbed to the Th2-polarizing adjuvant alum (OVA/alum). Spleen cells isolated 14 or more days after initial immunization respond vigorously to rechallenge with OVA in culture, producing a wide array of cytokines characteristic of Th2 responses (Table I). When the DC activator B7-DC XAb (10 µg/ml) was added to the spleen cell cultures along with OVA, the levels of Th2 cytokines recovered in 48 h were reduced and, concomitantly, the levels of the Th1 cytokines IFN-{gamma} and IL-12 were increased. This pattern was observed using multiple cultures assessed over a 72-h period. For most of the subsequent experiments IL-4 and IFN-{gamma} were selected as prototypic cytokines representing the Th2 and Th1 response patterns, respectively, for the analyses described below.


View this table:
[in this window]
[in a new window]

 
Table I. Crosslinking B7-DC suppresses Th2 cytokines and induces Th1 cytokinesa

 
In subsequent experiments, the range of cytokines observed by using ELISA to measure cytokine levels was consistently higher than those observed using the multiplex-based measurements. The multiplex technology employs commercially prepared reagents and proprietary analytical algorithms. To resolve the basis of the differences in absolute levels of cytokines detected using the two methods, we assessed the IL-4 and IFN-{gamma} levels in the same samples used in the multiplex analysis in a subsequent analysis by ELISA and found substantially different estimates of the cytokines. These ELISA-based estimates were in agreement with the levels measured by ELISA throughout this report. Specifically, in the samples yielding IL-4 estimates of 42.6 ± 5 pg/ml from control Ab-treated spleen cells and 21 ± 1 pg/ml in B7-DC XAb-treated spleen cells by multiplex analysis, we found 710 ± 3 pg/ml and 3 ± 1 pg/ml for these same samples by ELISA. Similarly, for IFN-{gamma} levels where the multiplex platform indicated 51± 1 pg/ml in the samples from control-treated samples, by using ELISA we found no measurable levels of IFN-{gamma}, whereas in supernatants from cultures treated with B7-DC XAb, 994 ± 3 pg/ml IFN-{gamma} was found in comparison to the estimate using the multiplex platform of 283 ± 0.4 pg/ml. Both methods indicated a strong shift in polarity from Th2 to Th1 following the treatment of spleen cells with B7-DC XAb. The value of the multiplex system is that it provided insight into the directional change of an array of cytokines, suggesting a global change in the polarity of cytokine production. Nevertheless, it is clear that conclusions derived from these studies, all of which include paired controls in each experiment, should be interpreted cautiously with regard to the absolute quantities of cytokine produced.

B7-DC XAb is an efficient polarity modulator of the recall response by spleen cells in culture

Although stimulation of the in vitro recall response against OVA was strongly modulated from Th2 to Th1 by the DC activator B7-DC XAb, the TLR agonists CpG-ODN, pI:C, LPS, and Gardiquomod and the CD40 agonist anti-CD40 Ab only partially modulated the response. All of the DC activators were added to the cultures at 10 µg/ml. As shown in Fig. 1A, levels of IL-4 were sharply reduced in spleen cell cultures treated with B7-DC XAb, whereas TLR and CD40 agonists induced moderate to no reductions. None of the cultures that received TLR or CD40 agonists produced IFN-{gamma} within 48 h of treatment (Fig. 1B). The relative ability of B7-DC XAb, CpG-ODN, and Gardiquimod to inhibit IL-5 production was studied in an experiment in which decreasing amounts of the DC activators were added along with an Ag to spleen cultures of Ag/alum-presensitized spleen cells. On a molar basis, B7-DC XAb (0.06 µg/ml) was 6 x 104 more potent than CpG-ODN (6.6 µg/ml) and 105 more potent than Gardiquimod (2.2 µg/ml) at completely inhibiting IL-5 levels in the cultures as measured by ELISA.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
FIGURE 1. A B7-DC XAb but not a TLR or CD40 agonist induces a polarity shift in recall responses by sensitized spleen cells. Spleen cells obtained from mice polarized toward a Th2 phenotype were stimulated with OVA in presence of control IgM Ab, B7-DC XAb, CpG, pI:C, or anti-CD40 ({alpha}CD40) for 48 h. The supernatants were analyzed by ELISA for IL-4 (A) or IFN-{gamma} (B). Other controls shown are supernatants from naive splenocytes stimulated with OVA alone, cytokine secretion in absence of Ag, and stimulation of spleen cells with Ag plus an IgG Ab (clone TY-25) that binds to B7-DC. All estimates are based on supernatant samples from triplicate cultures.

 
Several important controls were included in these experiments that demonstrated that the observed responses are Ag-specific recall responses (Fig. 1). When naive spleen cells were pulsed with Ag and incubated with B7-DC XAb, neither IL-4 nor IFN-{gamma} were detected in the 48-h supernatants. Spleen cells activated with B7-DC XAb but not pulsed with Ag also failed to induce the cytokines, demonstrating that the recall response is Ag driven. Finally, the treatment of DC with Ag together with an IgG Ab (clone TY-25) that binds B7-DC did not induce polarity-modulating activity by the APC. Treatment of spleen cultures with an anti-class II IgM Ab (25–9-3) that binds to the spleen cells together with Ag did not modulate the profile of the cytokines produced (data not shown). Together, the absence of immune modulatory activity exhibited by three control Abs (sHIgM39, TY25, and 25-9-3) highlight the unique activity of the B7-DC XAb IgM Ab used in these studies.

Bone marrow-derived DC treated with B7-DC XAb modulate the polarity of the recall response

When, instead of adding Ab and Ag directly to a spleen cell culture of Ag-sensitized cells, DC treated in a separate culture for 24 h with Ag together with B7-DC XAb were added to the spleen cell culture (Fig. 2A), the polarity of the ensuing recall response by the sensitized spleen cells was also modulated from Th2 to Th1 (Fig. 2, B and C). Cultures receiving sham-treated DC produced IL-4 and no detectable IFN-{gamma}, while cells receiving DC activated with B7-DC XAb produced IFN-{gamma} and very low levels of IL-4. In contrast, when DC treated with 10 µg/ml CpG-ODN, pI:C, LPS, Gardiquimod, or anti-CD40 Ab were added to the sensitized spleen cell cultures, IL-4 was produced concomitantly with IFN-{gamma} (Fig. 2, D and E). Inhibition of IL-4 production was dependent on the concentration of the TLR agonist used to stimulate the DC cultures, approaching the levels achieved with 10 µg/ml B7-DC XAb/ml only when 20 µg/ml TLR agonist was used (Fig. 2, F and G).


Figure 2
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 2. Pretreatment of DC with activators mimics the addition of the activators into the culture. Spleen cells from mice that were polarized toward a Th2 phenotype were restimulated in vitro with DC (A) treated with control IgM Ab or B7-DC XAb for 48 h. Supernatants were analyzed for IL-4 (B) or IFN-{gamma} (C). D and E are similar to B and C except that the presensitized splenocytes were incubated with DC treated with various agonists including TLR ligands or anti-CD40 ({alpha}CD40). F and G show IL4 and IFN-{gamma} levels, respectively, from spleen cells stimulated with DC that were pretreated with 20 µg/ml (filled bars), 10 µg/ml (open bars), or 5 µg/ml (shaded bars) TLR9 agonist CpG or the TLR7/8 agonist Gardiquimod.

 
The finding that spleen cell cultures stimulated with TLR and CD40 agonists produced both IL-4 and IFN-{gamma} raised the question of whether the cells were producing both cytokines or whether some responding cells were more sensitive to the modulation of polarity than others. To investigate this question, intracellular levels of cytokines were visualized by flow cytometry following permeabilization of the spleen cell cultures and staining with fluorochrome-labeled Abs specific for IL-4 and IFN-{gamma}. CD4+ T cells from cultures modulated with sham control Ab displayed the highest level of staining with IL-4-specific Ab (Fig. 3A). After treatment with B7-DC XAb, the levels of IL-4 dropped and the cells expressing IFN-{gamma} predominated (Fig. 3B). In contrast, CD4+ T cells from cultures treated with TLR or CD40 agonists displayed an intermediate phenotype with a substantial number of cells staining positive for both IL-4 and IFN-{gamma} following treatment with each of these immune modulators (Fig. 3, C–G). Few cells were present in the cultures activated with TLR agonists or anti-CD40 that displayed the exclusive IL-4- or IFN-{gamma}-producing phenotypes characteristic of cultures treated with sham modulating Ab or B7-DC XAb.


Figure 3
View larger version (40K):
[in this window]
[in a new window]

 
FIGURE 3. B7-DC XAb induces Th1 cells whereas TLR ligation yields Th0 cells in splenic recall responses. Th2 primed splenocytes were restimulated for 48 h with Ag-pulsed DC that were treated for 16 h with 10 ng/ml control IgM Ab, B7-DC XAb, anti-CD40 ({alpha}CD40), pI:C, CpG, LPS, or Gardiquimod. The spleen cells were permeabilized and stained for CD4, IL-4, and IFN-{gamma}. Intracellular cytokine levels were assessed on CD4+ cells by flow cytometry.

 
To address whether activated DC were interacting directly with T cells to achieve polarity modulation, two experiments were performed. Bone marrow-derived, Ag-pulsed DC were activated with control Ab or B7-DC XAb and enriched for CD11c+ cells (Fig. 4A) and found to be devoid of CD3+ cells (not shown). These enriched DC were cocultured with purified or cloned Ag-sensitized T cells isolated from OVA/alum-presensitized mice. Purified T cells, 98% pure as judged by flow cytometry (Fig. 4B), responded by producing the Th2 cytokine IL-4 when stimulated with Ag-pulsed DC activated with control Ab (Fig. 4C) and by producing IFN-{gamma} when stimulated with B7-DC XAb Ag-pulsed DC (Fig. 4D). In a second experiment, a long-term established Th2-polarized CD4+ T cell clone (35) specific for sperm whale myoglobulin responded the same way by secreting IL-4 in response to Ag-pulsed, CD11c+-enriched DC treated with an isotype control Ab (Fig. 4E) and by switching to the production of IFN-{gamma} when coincubated with DC pulsed with Ag and stimulated with B7-DC XAb (Fig. 4F). Together, these two studies demonstrate that interactions between activated DC and T cells are sufficient to modulate the immune response from Th2 polarity to Th1.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

 
FIGURE 4. Phenotype reversal of purified Th2-polarized T cells by enriched DC populations. CD11c+, CD11b+, Gr-1int, and CD3 cells were isolated from GM-CSF, IL-4-supplemented bone marrow cultures treated with control IgM Ab (A) or B7-DC XAb (data not shown) plus Ag. CD11c cells in the enriched fraction were CD11b+CD3. Highly enriched splenic T cells isolated from OVA/alum immunized mice were >98% CD3+ (B). Cytokine levels were assessed by ELISA in 48-h culture supernatants following coculture of the enriched DC and T cell populations (C and D). Enriched DC from cultures pulsed with sperm whale myoglobulin treated with control IgM Ab or B7-DC XAb were coincubated with a CD4+ sperm whale myoglobulin-specific cloned T cell line for 48 h (E and F). Culture supernatants were assessed for cytokines by ELISA.

 
Requirement for signal 1 from the modulating DC during polarity modulation of the splenic recall response

The requirement for Ag shown in Fig. 1 implies that responding splenic T cells that undergo the polarity shift must recognize Ag presented by DC in the context of MHC Ag-presenting molecules in the course of the recall response. To evaluate this assumption directly and distinguish between the requirement for Ag to drive the recall response and the possible requirement for Ag to induce a shift in polarity, allogeneic MHC-mismatched DC were pulsed with Ag, washed extensively, and tested for their ability to modulate the polarity of a recall response following coculture with Th2-polarized primed spleen cells. The inability of MHC-mismatched DC to activate the Ag-specific recall response indicates that the recognition of an Ag in the context of MHC molecules on the Ag pulsed DC is required to mobilize the response.

In an independent set of cultures, the spleen cells were also given Ag, providing an independent source of Ag from the Ag presented by the immune-modulating DC. Therefore, the effects of the activated immune modulatory DC on the recall responses were visualized in the context of strong ongoing endogenous signal 1 by DC providing Th2 stimulatory signals. As shown in Fig. 5, A and B, the addition of syngeneic Ag-pulsed DC treated with isotype control Ab to sensitized spleen cultures that had either been pulsed or not pulsed with Ag resulted in a strongly Th2-polarized response. When Ag-pulsed DC activated with B7-DC XAb were instead added to comparable spleen cell cultures, even in the presence of endogenous Th2 polarizing signals, a Th1-associated IFN-{gamma} response ensued. In these experiments, naive spleen cells generated neither a Th2 or Th1 response within the 48-h observation period when treated with B7-DC XAb-activated, Ag-pulsed DC (not shown). The ability of the allogeneic DC to be recognized by some elements of the spleen cell culture is indicated by the MLR response visualized by enhanced DNA synthesis in the culture (Fig. 5C).


Figure 5
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 5. B7-DC XAb-mediated phenotype reversal is restricted by appropriate MHC molecules and is Ag specific. Spleen cells from Th2-polarized mice were restimulated in vitro with Ag-pulsed, control IgM Ab-treated syngenic DC for 48 h. The cultures were either pulsed or not pulsed with Ag to assess by ELISA the interactions of endogenous and added APC. Supernatants from the cultures were assayed for IL-4 (A) and IFN-{gamma} (B). C depicts the proliferative response of Th2-polarized T cells to allogenic DC in a MLR assessed by the incorporation of [3H]thymidine. Open symbols represent the response of splenocytes to syngenic DC while filled symbols represents the response of splenocytes to allogenic DC. In D and E, the inability of Ag pulsed, control IgM, or B7-DC XAb-treated DC to modulate the polarity of cytokine production of Th2-polarized, OVA-specific T cells was assessed by ELISA. WT, wild type. F–I show the Ag specificity of the phenotype reversal response. F and G, The responses of cultures presensitized to OVA; H and I, Responses of cells presensitized to BSA. The splenocytes were restimulated with the appropriate Ag along with OVA-pulsed DC treated with isotype control IgM Ab ({circ}) or B7-DC XAb (•) or with BSA pulsed DC treated with isotype control IgM Ab ({square}) or B7-DC XAb ({blacksquare}).

 
In an independent set of experiments, B7-DC XAb-activated DC derived from class II deficient mice were used to probe the MHC dependence of the observed immune modulatory effects. In these experiments, DC were derived from class II-knockout bone marrow, pulsed with Ag, and treated with B7-DC XAb or control Ab overnight. The DC were then added to spleen cell cultures from OVA/alum-presensitized mice to determine whether the ability of DC to modulate the polarity of the recall response was class II dependent. As shown in Fig. 5, D and E, class II-deficient DC were unable to induce a recall response, confirming the importance of MHC/TCR interactions in this process. We conclude from these experiments that sensitized Th2-polarized T cells must receive signal 1 to be reprogrammed by B7-DC XAb-activated DC to respond with Th1 polarity.

The Ag specificity of polarity modulation was observed in animals immunized either with OVA or BSA. Spleen cell cultures were rechallenged with the appropriate presensitizing Ag, OVA, or BSA along with increasing numbers of isotype control-treated or B7-DC XAb-treated DC pulsed with one Ag or the other. As shown in Fig. 5, F–I, the polarity shift induced by B7-DC XAb-activated DC was Ag specific in that only DC pulsed with the sensitizing Ag could mediate the shift. Down-regulation of IL-4 and up-regulation of IFN-{gamma} occurred at approximately the same point in the titration curves for both Ags in cultures receiving varying numbers of Ab-stimulated DC.

B7-DC XAb polarization of the T cell response is long lived in that spleen cells isolated >8 wk after Ab treatment responded with a Th1 phenotype when rechallenged with Ag (data not shown). Immunization of mice with the unrelated Ag BSA in the context of the Th2-polarizing adjuvant alum resulted in cells that responded to a rechallenge with BSA by producing IL-4 and no IFN-{gamma}. This demonstrates that B7-DC XAb modulates only the response to the Ags present at the time of treatment and does not alter the polarity of subsequent responses that are elicited in the absence of the immune modulator.

Contribution of adhesion molecules to DC-mediated modulation of the polarity of the recall response

The finding that Ag recognition of activated DC is required to support the reprogramming of the cytokine response by sensitized T cells implies that cell-to-cell contact may be an important aspect of communication between these cells. Treatment of DC with B7-DC XAb resulted in up-regulation of the adhesion molecules ICAM-1, SLAM, and LY-9 (21). To assess the importance of molecules known to function in communication between APC and T cells, DC genetically deficient in key regulatory molecules were assessed for their ability to modulate the polarity of recall responses. The importance of SLAM expression in supporting the modulation of the polarity of the recall response is indicated by relative inefficiency of SLAM-deficient DC using the standard numbers of APC and spleen cells to promote a Th1 response as compared with wild-type DC. Initial studies indicated that DC deficient in SLAM expression down-regulated IL-4 expression but did not induce IFN-{gamma}. This same effect (IL-4 inhibition in the absence of induced IFN-{gamma}) can be achieved by reducing the number of Ag-pulsed wild-type DC activated with B7-DC XAb added to the spleen cultures by 10-fold (Fig. 5, F–I). To evaluate whether this deficiency to induce IFN-{gamma} was quantitative or qualitative in nature, the number of SLAM-deficient DC added to the spleen cultures was varied. Under these conditions, IFN-{gamma} was not induced when the standard number of DC were added (106) but was induced when the number of APC was increased 10-fold (Fig. 6, A and B). Therefore, although the expression of SLAM is not required for polarity reprogramming, this costimulatory adhesion molecule facilitates the process. In contrast, the DC deficient for the SLAM homologue LY9 were just as effective as wild-type DC in modulating the polarity of the recall response (data not shown). Ag-pulsed, ICAM-1-deficient DC failed to down-regulate IL-4 production or up-regulate IFN-{gamma} when added to sensitized, Th2-polarized spleen cells irrespective of whether 106 or 107 DC were used (Fig. 6, C and D). These data support the view that SLAM expression by DC enhances the efficiency of DC to promote a polarity switch of activated/memory T cells but that ICAM-1 is critical for this function.


Figure 6
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 6. Importance of SLAM and ICAM-1 for B7-DC XAb-induced phenotype reversal. Wild-type Th2-polarized spleen cells were stimulated for 48 h with Ag-pulsed DC that were wild type (circles) or SLAM deficient (squares) (A and B) or wild type (circles) or ICAM-1 deficient (squares) (C and D). Culture supernatants were assayed for IL-4 (A) or IFN-{gamma} (B). Open symbols represent DC treated with 10 µg/ml isotype control Ab. Closed symbols represent DC treated with 10 µg/ml B7-DC XAb. E and F are similar to C and D except that wild-type DC or DC deficient for B7.1 and B7.2 were tested for the ability to modulate the polarity of the recall response of the presensitized spleen cell cultures.

 
Costimulation by CD80/CD86 is not required for modulation of the polarity of the recall response

Consistent with the nature of recall responses, the expression of the costimulatory molecules B7.1 (CD80) and B7.2 (CD86) by B7-DC XAb-activated DC were not required to induce a Th1-polarized recall response by sensitized spleen cells (Fig. 6, E and F). This is in contrast to the requirement of these important costimulatory molecules for the generation of sensitized T cells in first place (data not shown).

Requirement for a signal 3 to modulate the polarity of the recall response

We next examined other possible signals emanating from activated DC that could determine the ability of these cells to efficiently direct a change in the polarity of responding sensitized T cells. We have found that bone marrow-derived DC activated with B7-DC XAb secrete IL-6, TNF-{alpha}, IFN-{gamma}, and IL-12 (21, 22, and Table I). As these cytokines seemed likely candidates for important immunomodulatory signals that could influence the polarity of induced recall responses, DC deficient in their ability to express these cytokines were evaluated for their ability to direct a Th1-polarized recall response in vitro. Although IL-6- and TNF-{alpha}-deficient DC functioned just as efficiently as wild-type DC (data not shown), significant changes were observed when IFN-{gamma}- and IL-12-deficient DC were used (Fig. 7, A–D). Although B7-DC XAb-activated, IFN-{gamma}-knockout DC were able to down-regulate IL-4 production, they were not able to induce IFN-{gamma} production by sensitized wild-type spleen cells. B7-DC XAb-activated, IL-12-knockout DC neither down-regulated IL-4 nor up-regulated IFN-{gamma} production, even when 10-fold more DC were added to the cultures (data not shown). This indicates that the cytokines produced by activated DC are important factors in programming the polarity of the recall response.


Figure 7
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 7. IFN-{gamma} AND IL-12 produced by B7-DC XAb DC is crucial for the modulation of the recall response of Th2-polarized spleen cells. A–D depict IL-4 and IFN-{gamma} production by Th2-polarized spleen cells that were stimulated with wild-type DC derived from cytokine-deficient KO mice. The DC were pulsed with Ag and treated with either control IgM Ab or B7-DC XAb 16 h before addition to the spleen cultures. A and B are similar to C and D, except that IL-12-deficient DC (C and D) were used to stimulate the Th2 spleen cells instead of IFN-{gamma}–/– DC (A and B). E and F are similar to A and D, except that STAT4- and STAT6-deficient DC (E and F) were used to stimulate the Th2 spleen cells instead of IFN-{gamma} receptor DC (G and H). In G and H, IL-4 and IFN-{gamma} responses from wild-type or IFN-{gamma} receptor-deficient (IFN-{gamma}R–/–) Th2-polarized splenocytes that were stimulated with Ag-pulsed wild-type DC treated with control IgM Ab or B7-DC XAb.

 
To assess the possible importance of Th1- or Th2-polarizing cytokines on DC function, DC deficient in the expression of the STAT4 and STAT 6 transcription factors were activated with B7-DC XAb and tested for their ability to modulate the polarity of recall responses by wild-type sensitized spleen cells. As shown in Fig. 7, E and F, DC derived from STAT4- and STAT6-knockout mice were able to modulate the recall response of OVA-sensitized spleen cells, inhibiting the expression of IL-4 and inducing the expression of IFN-{gamma}. Because the IL-12 receptor signals through a STAT4-dependent pathway, the finding that DC derived from STAT4 deficient mice can induce a polarity switch by sensitized spleen cell cultures indicates that IL-12 is not likely acting on the B7-DC XAb-activated DC but rather functions on responding T cells. Similarly, the requirement for IFN-{gamma} production by the activated DC to induce IFN-{gamma} secretion by spleen cells during the recall response implies an important role for IFN-{gamma} receptors on responding Ag-specific T cells. This hypothesis is supported by the inability of IFN-{gamma} receptor-deficient Ag-sensitized spleen cells to produce IFN-{gamma} in a recall response induced by wild-type B7-DC XAb-activated DC (Fig. 7, G and H).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Treatment of OVA/alum-sensitized mice with the DC activator B7-DC XAb at the time of Ag rechallenge results in phenotype reversal of Th cell polarity from Th2 to Th1 (36, 37). In the current studies, we have found that B7-DC XAb-induced shifts in polarity remain stable throughout an 8-wk observation period following Ab treatment. Moreover, this stable phenotype is specific for the original immunogen, because immunization with a second unrelated Ag, BSA/alum, induced a Th2 recall response upon re-exposure to BSA.

Spleen cells isolated from mice presensitized with OVA/alum exhibit a predominant Th2 recall response in vitro when re-challenged with OVA (Table I). As shown in this report, the treatment of Th2-polarized spleen cells with B7-DC XAb plus Ag or the treatment of purified or clonal Th2-polarized T cells with B7-DC XAb-activated, Ag-pulsed DC resulted in a phenotype reversal of the T cells to Th1 polarity in just 48 h. The ability to modulate polarity in vitro provides experimental systems for examining the mechanisms governing these phenotypes.

Phenotype reversal was initially described by others using two methods (15, 16, 17, 18, 19, 38, 39). Ectopic expression of Th1- or Th2-inducing transcription factors into pre-established mouse Th2 or Th1 cells, respectively, induced phenotype reversal. Similar effects were achieved by stimulating human allergen-specific Th2 cells with Ag in presence of various TLR ligands, including pI:C, CpG, or the TLR-7 agonist Resiquimod over the course of a 2-wk culture period. In our 48-h culture system, stimulation with TLR ligands in the presence of Ag was relatively ineffective but was able to suppress the Th2 response to some degree. A strong polarity shift could be achieved in the 48-h mouse cultures by coincubation of the spleen cells with enriched populations of DC activated with TLR or CD40 agonists, indicating that the differences between the potency of TLR agonists needed to induce a polarity shift in the current study compared with that reported in previous studies are possibly quantitative rather than qualitative.

The nature of the regulatory events that determine Th polarity remains an active area of investigation. Arguments suggesting that the differentiation of T cells into Th1- or Th2-skewed polarity is reversible, partially reversible, or irreversible have been advanced (40, 41, 42, 43). We have not examined the structure of chromatin in the presensitized, Th2-polarized, and Ag-specific T cells that are induced in our studies to respond by producing Th1-associated cytokines. Although we know that these cells display stable phenotypes for at least 2 mo, either Th2 before being reprogrammed or Th1 after being reprogrammed, we have not determined whether the T cells can be reprogrammed because they reside in an intermediate state of differentiation or whether the signals provided by activated DC are capable of inducing the kind of chromatin remodeling that reverses chromatin changes normally associated with terminally differentiated phenotypes.

In the current study we have focused on the intercellular signals emanating from B7-DC XAb-activated DC that induce the phenotype reversal of polarized T cells. One approach was to use Ag-pulsed B7-DC XAb-activated DC lacking the appropriate regulatory molecules known to modulate T cell function. To analyze the role of peptide-MHC:TCR interaction in B7-DC XAb-mediated induction of phenotype reversal, Ag pulsed B7-DC XAb-treated DC that were of syngenic origin, allogenic origin, or derived from MHC class II-knockout mice. Only syngeneic DC were capable of mediating phenotype reversal. This finding, along with the Ag specificity of the modulatory signals, indicates the importance of one-to-one interaction involving Ag-specific primed T cells and DC expressing appropriate peptide-MHC complexes for inducing phenotype reversal.

We next analyzed the importance of costimulation in the B7-DC XAb-mediated polarity shift. Various costimulatory molecules have been implicated in regulating Th responses, including CD28:B7, ICAM-1:LFA-1, and SLAM-SLAM interactions. CD28:B7 interaction has been shown to contribute to Th lineage commitment, particularly in the context of suboptimal antigenic stimulation (44, 45, 46). In our model system, the lack of B7.1 and B7.2 did not have an impact on B7-DC XAb-mediated polarity shift. This could be partially explained by the fact that the B7-DC XAb-treated DC are inducing a recall response, an activation response known not to be dependent on the expression of B7-1 and B7-2.

ICAM1/2:LFA-1 interactions have been shown to result in the skewing of immune responses toward Th2 polarity (47, 48). Thus, the stimulation of naive OVA-specific D011.10 T cells in the presence of Ag-pulsed splenic DC resulted in a Th1 response. Th addition of an anti-ICAM-1 Ab to block LFA1-ICAM-1 interactions resulted in a Th2 response instead (47). Similarly, the stimulation of naive human T cells with anti-CD3/CD28, a stimulus that normally elicits strong IL-4 production, resulted in a Th1-polarized, IFN-{gamma}-dominated response when stimulation occurred in the presence of ICAM-1-Fc (48). In our study we found that the absence of ICAM-1 on B7-DC XAb-activated DC resulted in a robust Th2-polarized recall response and no induction of IFN-{gamma}. In contrast, when SLAM-deficient DC were used as polarity modulators we found that a higher number of DC were required to obtain the response induced by wild-type DC, implying that the expression of the costimulatory adhesion molecule SLAM is not required but facilitates phenotype reversion, which is in concordance with previous findings (49). These results indicate that intercellular adhesion and costimulation play important roles in mediating signals that program the nature of the effector response by sensitized T cells upon restimulation with an Ag.

The cytokine milieu present at the time of T cell priming can play a crucial role in determining Th1 vs Th2 lineage commitment (40, 41). Despite strong evidence supporting IFN-{gamma} and IL-12 as the primary cytokines promoting Th1 responses, neither of these cytokines is sufficient to induce a stable Th1 response. We evaluated the roles of IL-12 and IFN-{gamma} by using mice that are deficient in IL-12, IFN-{gamma} and the IFN-{gamma} receptor. IFN-{gamma}-deficient DC activated with B7-DC XAb were still capable of suppressing IL-4 but were not capable of inducing IFN-{gamma}. Moreover, IFN-{gamma}-receptor T cells failed to secrete IFN-{gamma} upon stimulation with wild type B7-DC XAb-activated DC, indicating the importance of signaling through the IFN-{gamma} receptor on T cells in the induction of phenotype reversal. IL-12 deficient dendritic cells failed to suppress the Th2 response or induced a Th1 response. STAT4-deficient DC activated with B7-DC XAb were capable of modulating T cell polarity, indicating that IL-12 is not acting on the DC themselves. Taken together, the requirement for MHC:TCR interaction and the expression of ICAM-1, IFN-{gamma}, and IL-12 by the B7-DC XAb-activated DC demonstrates the complex array of signals communicated between DC and sensitized T cells to determine the nature of the effector mechanisms to be mobilized in the course of the recall response.

One unresolved question is the nature of the differences between DC activated with B7-DC XAb and DC activated with TLR or TNFR family agonists. To date, all of our findings are consistent with the view that stimulation of DC with B7-DC XAb is quantitatively stronger that stimulation with TLR or TNFR agonists. We have estimated that B7-DC XAb is 104 to 105 times more efficient on a molar basis than the TLR7 and TLR 9 agonists Gardiquimod and CpG-ODN, respectively. Although clear differences in the ability of these stimuli to up-regulate MHC Ag-presenting molecules and induce CD80 and CD86 expression are evident, there is no indication that changes in the expression of these particular differentially expressed molecules are critical for the induction of phenotype reversal. Similarly, we find that the activation of DC with CpG-ODN or Gardiquimod up-regulate ICAM-1, IL-12, and IFN-{gamma} expression to levels comparable to the levels observed following activation with B7-DC XAb (S. Radhakrishnan and L. Pease, unpublished observations). Consequently, expression of these immune modulatory molecules alone cannot explain the enhanced efficiency of B7-DC XAb-activated DC relative to DC activated with TLR agonists.

A key conclusion from this study is that DC continue to interact with T cells even after the T cells have been sensitized and can redirect the effector mechanisms used by memory responses depending on the nature of the stimuli encountered by the DC. Most studies have focused on CD8+ T cells because of the relative ease of isolating Ag-specific cells from that lineage. However, the reprogramming of a Th1-polarized, hemagglutinin specific, CD4+ transgenic T cell response from a Th1 phenotype to a Th2 phenotype was achieved by strong TCR stimulation either by activation with an anti-CD3 Ab or by using high concentrations of agonist peptides (42). In this report we have clearly demonstrated by using purified polyclonal CD4+ T cells and even cloned T cell lines that recall responses can be reprogrammed. This model system can be used to address some of the important unresolved issues relating to the nature of memory cells.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants CA96859, CA104996, and HL077296 (to L.R.P.) and DK64194 (to W.A.F.). Back

2 Address correspondence and reprint requests to Dr. Larry R. Pease, Department of Immunology, Mayo Clinic College of Medicine, Mayo Clinic, 200 First Street Southwest, Rochester, MN 55905. E-mail address: pease.larry{at}mayo.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; CPG-ODN, CPG-containing oligodeoxynucleotide; int, intermediate; pI:C, polyinosinic:polycytidylic acid; SLAM, signaling lymphocytic activation module; XAb, cross-linking Ab. Back

Received for publication September 22, 2006. Accepted for publication January 2, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Akira, S., S. Uematsu, O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783-801. [Medline]
  2. Iwasaki, A., R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5: 987-995. [Medline]
  3. Mondino, A., A. Khoruts, M. K. Jenkins. 1996. The anatomy of T-cell activation and tolerance. Proc. Natl. Acad. Sci. USA 93: 2245-2252. [Abstract/Free Full Text]
  4. Jenkins, M. K., A. Khoruts, E. Ingulli, D. L. Mueller, S. J. McSorley, R. L. Reinhardt, A. Itano, K. A. Pape. 2001. In vivo activation of antigen-specific CD4 T cells. Annu. Rev. Immunol. 19: 23-45. [Medline]
  5. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, R. L. Coffman. 1986. Two types of murine helper T cell clone, I: definition according to profiles of lymphokines activities and secreted proteins. J. Immunol. 136: 2348-2357. [Abstract]
  6. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383: 787-793. [Medline]
  7. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokines-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12: 635-673. [Medline]
  8. Romagnani, S.. 1991. Type 1 T helper and type 2 T helper cells: functions, regulation and role in protection and disease. Int. J. Clin. Lab. Res. 21: 152-158. [Medline]
  9. Zanussi, S., E. Vaccher, C. Caffau, C. Pratesi, C. Crepaldi, M. T. Bortolin, R. Tedeschi, D. Politi, L. Barzan, U. Tirelli, P. De Paoli. 2003. Interferon-{gamma} secretion and perforin expression are impaired in CD8+ T lymphocytes from patients with undifferentiated carcinoma of nasopharyngeal type. Cancer Immunol. Immunother. 52: 28-32. [Medline]
  10. Ozenci, V., A. M. Miller, A. Palmborg, L. Egevad, G. A. Jaremko, K. M. Kalkner, P. Pisa. 2005. Presence and specificity of tumor associated lymphocytes from ascites fluid in prostate cancer. Prostate 65: 20-26. [Medline]
  11. McCarter, M., J. Clarke, D. Richter, C. Wilson. 2005. Melanoma skews dendritic cells to facilitate a T helper 2 profile. Surgery 138: 321-328. [Medline]
  12. Szabo, S. J., B. M. Sullivan, S. L. Peng, L. H. Glimcher. 2003. Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21: 713-758. [Medline]
  13. Constant, S. L., K. Bottomly. 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15: 297-322. [Medline]
  14. Moser, M., K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. : 199-205.
  15. Tighe, H., K. Takabayashi, D. Schwartz, G. Van Nest, S. Tuck, J. J. Eiden, A. Kagey-Sobotka, P. S. Creticos, L. M. Lichtenstein, H. L. Spiegelberg, E. Raz. 2000. Conjugation of immunostimulatory DNA to the short ragweek allergen amb a 1 enhances its immunogenicity and reduces its allergenicity. J. Allergy Clin. Immunol. 106: 124-134. [Medline]
  16. Manetti, R., F. Annunziato, L. Tomasevic, V. Gianno, P. Parronchi, S. Romagnani, E. Maggi. 1995. Polyinosinic acid: polycytidylic acid promotes T helper type 1-specific immune responses by stimulating macrophage production of interferon-{alpha} and interleukin-12. Eur. J. Immunol. 25: 2656-2660. [Medline]
  17. Parronchi, P., F. Brugnolo, F. Annunziato, C. Manuelli, S. Sampognaro, C. Mavilia, S. Romagnani, E. Maggi. 1999. Phosphorothioate oligodeoxynucleotides promote the in vitro development of human allergen-specific CD4+ T cells into Th1 effectors. J. Immunol. 163: 5946-5953. [Abstract/Free Full Text]
  18. Annunziato, F., L. Cosmi, R. Manetti, F. Brugnolo, P. Parronchi, E. magi, K. Nagata, S. Romagnani. 2001. Reversal of human allergen-specific CRTH2+ T(H) 2 cells by IL-12 or the PS-DSP30 oligodeoxynucleotide. J. Allergy Clin. Immunol. 108: 815-821. [Medline]
  19. Brugnolo, F., S. Sampognaro, F. Liotta, L. Cosmi, F. Annunziato, C. Manuelli, P. Campi, E. Maggi, S. Romagnani, P. Parronchi. 2003. The novel synthetic immune response modifier R-848 (Resiquimod) shifts human allergen-specific CD4+ TH2 lymphocytes into IFN-{gamma}-producing cells. J. Allergy Clin. Immunol. 111: 380-388. [Medline]
  20. Latchman, Y., C. R. Wood, T. Chernova, D. Chaudhary, M. Borde, I. Chernova, Y. Iwai, A. J. Long, J. A. Brown, R. Nunes, et al 2001. PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat. Immunol. 2: 261-268. [Medline]
  21. Tseng, S. Y., M. Otsuji, K. Gorski, X. Huang, J. E. Slansky, S. I. Pai, A. Shalabi, T. Shin, D. M. Pardoll, H. Tsuchiya. 2001. B7-DC, a new dendritic cell molecule with potent costimulatory properties for T cells. J. Exp. Med. 193: 839-846. [Abstract/Free Full Text]
  22. Radhakrishnan, S., L. T. Nguyen, B. Ciric, D. R. Ure, B. Zhou, K. Tamada, H. Dong, S. Y. Tseng, T. Shin, D. M. Pardoll, et al 2003. Naturally occurring human IgM antibody that binds B7-DC and potentiates T cell stimulation by dendritic cells. J. Immunol. 170: 1830-1838. [Abstract/Free Full Text]
  23. Nguyen, L. T., S. Radhakrishnan, B. Ciric, K. Tamada, T. Shin, D. M. Pardoll, L. Chen, M. Rodriguez, L. R. Pease. 2002. Cross-linking the B7 family molecule B7-DC directly activates immune functions of dendritic cells. J. Exp. Med. 196: 1393-1398. [Abstract/Free Full Text]
  24. Radhakrishnan, S., E. Celis, L. R. Pease. 2005. B7-DC cross-linking restores antigen uptake and augments antigen-presenting cell function by matured dendritic cells. Proc. Natl. Acad. Sci. USA 102: 11438-11443. [Abstract/Free Full Text]
  25. Blocki, F. A., S. Radhakrishnan, V. P. Van Keulen, K. L. Heckman, B. Ciric, C. L. Howe, M. Rodriguez, E. Kwon, L. R. Pease. 2006. Induction of a gene expression program in dendritic cells with a cross-linking IgM antibody to the co-stimulatory molecule B7-DC. FASEB J. 20: 2408-2410. [Abstract/Free Full Text]
  26. Borriello, F., M. P. Sethna, S. D. Boyd, A. N. Schweitzer, E. A. Tivol, D. Jacoby, T. B. Strom, E. M. Simpson, G. J. Freeman, A. H. Sharpe. 1997. B7-1 and B7-2 have overlapping, critical roles in immunoglobulin class switching and germinal center formation. Immunity 6: 303-313. [Medline]
  27. Xu, H., J. A. Gonzalo, Y. St. Pierre, I. R. Williams, T. S. Kupper, R. S. Cotran, T. A. Springer, J. C. Gutierrez-Ramos. 1994. Leukocytosis and resistance to septic shock in intercellular adhesion molecule 1-deficient mice. J. Exp. Med. 180: 95-109. [Abstract/Free Full Text]
  28. Mattner, F., J. Magram, J. Ferrante, P. Launois, K. Di Padova, R. Behin, M. K. Gately, J. A. Louis, G. Alber. 1996. Genetically resistant mice lacking interleukin-12 are susceptible to infection with Leishmania major and mount a polarized Th2 cell response. Eur. J. Immunol. 26: 1553-1559. [Medline]
  29. Wang, N., A. Satoskar, W. Faubion, D. Howie, S. Okamoto, S. Feske, C. Gullo, K. Clarke, M. Rodriguez Sosa, A. H. Sharpe, C. Terhorst. 2004. The cell surface receptor SLAM controls T cell and macrophage functions. J. Exp. Med. 199: 1255-1264. [Abstract/Free Full Text]
  30. Graham, D. B., M. P. Bell, M. M. McCausland, C. J. Huntoon, J. van Deursen, W. A. Faubion, S. Crotty, D. J. McKean. 2006. Ly9 (CD229)-deficient mice exhibit T cell defects yet do not share several phenotypic characteristics associated with SLAM- and SAP-deficient mice. J. Immunol. 176: 291-300. [Abstract/Free Full Text]
  31. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382: 174-177. [Medline]
  32. Kaplan, M. H., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 4: 313-319. [Medline]
  33. Wang, Z. E., S. L. Reiner, S. Zheng, D. K. Dalton, R. M. Locksley. 1994. CD4+ effector cells default to the Th2 pathway in interferon {gamma}-deficient mice infected with Leishmania major. J. Exp. Med. 179: 1367-1371. [Abstract/Free Full Text]
  34. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. M. Zinkernagel, M. Aguet. 1993. Immune response in mice that lack the interferon-{gamma} receptor. Science 259: 1742-1745. [Abstract/Free Full Text]
  35. McKean, D. J., A. Nilson, B. N. Beck, J. Giri, S. B. Mizel, B. S. Handwerger. 1985. The role of IL-1 in the antigen-specific activation of murine class II-restricted T lymphocyte clones. J. Immunol. 135: 3205-3216. [Abstract]
  36. Radhakrishnan, S., K. Iijima, T. Kobayashi, M. Rodriguez, H. Kita, L. R. Pease. 2004. Blockade of allergic airway inflammation following systemic treatment with a B7-dendritic cell (PD-L2) cross-linking human antibody. J. Immunol. 173: 1360-1365. [Abstract/Free Full Text]
  37. Radhakrishnan, S., K. Iijima, T. Kobayashi, H. Kita, L. R. Pease. 2005. Dendritic cells activated by cross-liking B7-DC (PD-L2) block inflammatory airway disease. J. Allergy Clin. Immunol. 116: 668-674. [Medline]
  38. Ouyang, W., S. H. Ranganath, K. Weindel, D. Bhattacharya, T. L. Murphy, W. C. Sha, K. M. Murphy. 1998. Inhibition of Th1 development mediated by GAGA-3 through an IL-4-independent mechanism. Immunity 9: 745-755. [Medline]
  39. Mullen, A. C., A. S. Hutchins, F. A. High, H. W. Lee, K. J. Sykes, L. A. Chodosh, S. L. Reiner. 2002. Hlx is induced by and genetically interacts with T-bet to promote heritable TH1 gene induction. Nat. Immunol. 3: 652-658. [Medline]
  40. Murphy, K. M., S. L. Reiner. 2002. The lineage decisions of helper T cells. Nat. Rev. Immunol. 2: 933-944. [Medline]
  41. Mowen, K. A., L. H. Glimcher. 2004. Signaling pathways in Th2 development. Immunol. Rev. 202: 203-222. [Medline]
  42. Ahmadzadeh, M., D. L. Farber. 2002. Functional plasticity of an antigen-specific memory CD4 T cell population. Proc. Natl. Acad. Sci. USA 99: 11802-11807. [Abstract/Free Full Text]
  43. Fields, P. E., S. T. Kim, R. A. Flavell. 2002. Cutting edge: changes in histone acetylation at the IL-4 and IFN-{gamma} loci accompany Th1/Th2 differentiation. J. Immunol. 169: 647-650. [Abstract/Free Full Text]
  44. Freeman, G. J., F. Borriello, R. J. Hodes, H. Reiser, K. S. Hathcock, G. Laszlo, A. J. McKnight, J. Kim, L. Du, D. B. Lombard, et al 1993. Uncovering of functional alternative CTLA-4 counter-receptor in B7-deficient mice. Science 262: 907-909. [Abstract/Free Full Text]
  45. Green, J. M., P. J. Noel, A. I. Sperling, T. L. Walunas, G. S. Gray, J. A. Bluestone, C. B. Thompson. 1994. Absence of B7-dependent responses in CD28-deficient mice. Immunity 1: 501-508. [Medline]
  46. Schweitzer, A. N., F. Borriello, R. C. Wong, A. K. Abbas, A. H. Sharpe. 1997. Role of costimulators in T cell differentiation: studies using antigen-presenting cells lacking expression of CD80 or CD86. J. Immunol. 158: 2713-2722. [Abstract]
  47. Salomon, B., J. A. Bluestone. 1998. LFA-1 interaction with ICAM-1 and ICAM-2 regulates Th2 cytokine production. J. Immunol. 161: 5138-5142. [Abstract/Free Full Text]
  48. Smits, H. H., E. C. de Jong, J. H. N. Schuitemaker, T. B. H. Geijtenbeek, J. van Kooyk, M. L. Kapsenberg, E. A. Wierenga. 2002. Intercellular adhesion molecule-1/LFA-1 ligation favors human Th1 development. J. Immunol. 168: 1710-1716. [Abstract/Free Full Text]
  49. Castro, A. G., T. M. Hauser, B. G. Cocks, J. Abrams, S. Zurawski, T. Churakova, F. Zonin, D. Robinson, S. G. Tangye, G. Aversa, et al 1999. Molecular and functional characterization of mouse signaling lymphocytic activation molecule (SLAM): differential expression and responsiveness in Th1 and Th2 cells. J. Immunol. 163: 5860-5870. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Radhakrishnan, R. Cabrera, E. L. Schenk, P. Nava-Parada, M. P. Bell, V. P. Van Keulen, R. J. Marler, S. J. Felts, and L. R. Pease
Reprogrammed FoxP3+ T Regulatory Cells Become IL-17+ Antigen-Specific Autoimmune Effectors In Vitro and In Vivo
J. Immunol., September 1, 2008; 181(5): 3137 - 3147.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. Spiekerkoetter, C. M. Alvira, Y.-M. Kim, A. Bruneau, K. L. Pricola, L. Wang, N. Ambartsumian, and M. Rabinovitch
Reactivation of {gamma}HV68 induces neointimal lesions in pulmonary arteries of S100A4/Mts1-overexpressing mice in association with degradation of elastin
Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L276 - L289.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map