The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ebihara, N.
Right arrow Articles by Murakami, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ebihara, N.
Right arrow Articles by Murakami, A.
The Journal of Immunology, 2007, 178: 3288-3292.
Copyright © 2007 by The American Association of Immunologists, Inc.

Involvement of C-C Chemokine Ligand 2-CCR2 Interaction in Monocyte-Lineage Cell Recruitment of Normal Human Corneal Stroma1

Nobuyuki Ebihara*, Satoru Yamagami2,{dagger}, Seiichi Yokoo{dagger}, Shiro Amano{dagger} and Akira Murakami*

* Department of Ophthalmology, Juntendo University School of Medicine, Tokyo, Japan; and {dagger} Department of Corneal Tissue Regeneration, University of Tokyo Graduate School of Medicine, Tokyo, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Bone marrow-derived cells (BMCs) reside in the anterior stroma of the central and paracentral cornea, as well as all stromal layers of the peripheral cornea, in normal human eyes. We investigated the factors regulating the constitutive distribution of BMCs in normal human corneal stroma. Cultured human corneal keratocytes expressed several chemokines (growth-related oncogene/CXCL1–3, IL-8/CXCL8, and MCP-1/CCL2) in the Ab array study. CCR2 and CCR7 mRNAs were detected in BMCs by multiplex RT-PCR. Keratocytes/corneal epithelial cells and BMCs selected from normal human donor corneas by using magnetic beads expressed MCP-1/CCL2 and CCR2 protein, respectively. BMCs isolated from human corneal stroma showed a chemotactic response to MCP-1/CCL2 in the Boyden chamber assay. The chemotactic effect of keratocyte supernatant was inhibited by blockade of MCP-1/CCL2. This is the first work on constitutive expression of CCR2 by BMCs from the corneal stroma and MCP-1/CCL2 by keratocytes/epithelial cells. Our findings suggest that the interaction between MCP-1/CCL2 and CCR2 determines the distribution of constitutive BMCs in normal human corneal stroma.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human leukocyte Ag DR-positive bone marrow-derived cells (BMCs)3 of the monocyte lineage, which include monocytes, macrophages, and dendritic cells, exist in the normal human corneal stroma (1). These cells are mainly distributed in the anterior stroma of the central and paracentral cornea as well as all stromal layers of the peripheral cornea and may play a role in the innate and adaptive immune responses (1). Constitutive BMCs have been reported in normal mouse corneal stroma (2, 3). In addition, BMCs transplanted from enhanced GFP transgenic mice were detected as enhanced GFP-positive cells in normal corneal stroma (4), supporting the concept that leukocytes detected in the corneal stroma are derived from the bone marrow. BMCs are presumed to migrate centripetally into the corneal stroma from vessels outside the cornea, because the normal cornea is an avascular tissue. However, the mechanism that accounts for the distribution of BMCs in the normal human corneal stroma is still unknown.

Chemokines are a group of cytokines that play an important role in leukocyte trafficking by promoting the migration of various types of leukocytes through interactions with chemokine receptors (5, 6). The chemokines are divided into four subfamilies (CC, CXC, CX3C, and C). Whereas CXC chemokines have been shown to mediate the recruitment of neutrophils and activated T lymphocytes, CC chemokines and their receptors have been demonstrated to have a critical role in regulating the recruitment of T and B lymphocytes, monocytes, and dendritic cells. The chemokine family forms a network involved in inflammation, infection, and immune disease both locally and systemically, and has a variety of physiological as well as pathological actions (7).

We hypothesized that resident keratocytes in normal human corneal stroma may express a chemokine that attracts BMCs bearing the relevant receptor from vessels outside cornea, whereas corneal epithelial cells may influence the localization of BMCs in the anterior stroma. Our results suggested that there was a selective chemokine-chemokine receptor interaction associated with the distribution of constitutive BMCs in normal human corneal stroma.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Donor human corneas and isolation of CD45-positive and CD45-negative cells by magnetic beads

This study was conducted in accordance with the Declaration of Helsinki. Corneas were obtained from the Rocky Mountain Lions’ Eye Bank at 3–5 days after the death of the donors (aged 62–70 years) and were kept in Optisol GS storage medium (Bausch & Lomb) at 4°C until use. Corneas with focal or diffuse stromal opacity or with a history of corneal disease in the eye bank report were not used. For isolation of the corneal stroma, the endothelium and Descemet’s membrane were peeled away in a sheet from the periphery to center of the inner surface of the cornea with fine forceps, according to the procedure described previously (8). Then the epithelium was carefully removed from the stroma by scraping the outer surface of the cornea and used for total RNA extraction and flow cytometry after trypsin/EDTA treatment. Before isolation of corneal stromal cells, the peripheral cornea (including the limbal region) was dissected away from the stroma to avoid possible contamination by corneal limbal epithelial cells. Next, the stroma was cut into small pieces ~1 mm in diameter, which were incubated overnight at 37°C in serum-free basal medium containing 0.02% collagenase (Sigma-Aldrich). After washing three times with PBS, a single-cell suspension was obtained by trituration with a fire-polished Pasteur pipette. CD45-positive cells were isolated by positive selection with a MACS (Miltenyi Biotec), according to the manufacturer’s instructions. For separation of CD45-positive and CD45-negative cells, the stroma from three to five corneas was processed simultaneously. The average number of CD45-positive cells per cornea was 10.5 ± 0.9 x 103 (mean ± SD), as described elsewhere (1). Average BMC rate per isolated cells from corneal stroma was 91 ± 7% (mean ± SD; n = 5) in our preliminary study.

Antibodies

Mouse anti-human MCP-1/CCL2 (IgG2b; R&D Systems) mAb and mouse anti-human MCP-1/CCL2 mAb (IgG2b; Genzyme) were used for flow cytometry and for neutralization in the Boyden chamber assay, respectively. Goat anti-human CCR2 polyclonal Ab (Abcam) was used for the immunocytochemical study.

Culture of keratocytes

After selection of CD45-positive cells from donor human corneas by using a MACS, keratocytes were isolated by negative selection and cultured to subconfluence in DMEM with 15% FCS. To detect chemokines and cytokines in the culture supernatant, keratocytes were washed twice in PBS and cultured in serum-free DMEM (basal medium). Then the supernatants harvested from cultures after incubation for 24 and 48 h were used for measurement of chemokine concentration and Boyden chamber assay, respectively. THP-1, a human monocytic cell line, was cultured in RPMI 1640 medium containing 10% FCS.

Ab array technique

The keratocyte culture medium was analyzed with an Ab array, comprising a Human Angiogenesis Antibody I kit (20 angiogenetic factors; Ray Biotech) and a Human Inflammatory Antibody Array III kit (40 inflammation-related factors; Ray Biotech), according to the manufacturer’s instructions. All of the plotted proteins are listed at www.raybiotech.com/images/map_all.htm. The membranes were washed twice with TBS and incubated in blocking buffer for 30 min. Keratocytes were cultured for 48 h and washed by basal medium three times. Then basal medium only was added in the well and incubated for 24 h. One milliliter of the keratocyte culture supernatant was added to each culture plate and was incubated overnight at 4°C. After decanting, the membranes were washed a total of five times with washing buffer. Then 1 ml of a 1/250 dilution of biotin-conjugated Ab was added to each plate, and incubated overnight at 4°C with shaking. The membranes were subsequently incubated with 2 ml/well of a 1/1000 dilution of HRP-conjugated streptavidin for 1 h, incubated with the detection buffer for 5 min, and exposed to BioMax Light film (Eastman Kodak) for 1 min before processing. The signal intensities of individual spots were determined by densitometry (Gel-Pro analyzer software; Media Cybernetics), and the positive control signals on each membrane were used to normalize the intensity of the individual spots being compared on different membranes. For each spot, the net optical intensity was determined by using the Ray-Bio Antibody Array Analysis Tool (Ray Biotech). FCS-free medium was employed as a negative control.

Preparation of RNA and RT-PCR

Total RNA was isolated from CD45-positive and CD45-negative cells in the corneal epithelium and stroma using Isogen reagent (Nippon Gene), according to the manufacturer’s instructions. Water was used as the negative control. First-strand cDNA was synthesized from 1 µg of total RNA with a Reverse Transcription System (Promega). The PCR mixture comprised 1% cDNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 20 pmol of each oligonucleotide, and 2.5 U of Amp Taq Gold (PerkinElmer) in a 50-µl reaction volume. After incubation at 95°C for 9 min, amplification was performed at 94°C for 30 s and then at 60°C for 30 s in an I-Cycler (Bio-Rad). Samples were separated on 2% agarose gel, and the products were visualized by staining with ethidium bromide. The primers for MCP-1 (5' primer, TCT CGC CTC CAG CAT GAA A; 3' primer, TCC TGA ACC CAC TTC TGC TTG) yielded a 267-bp product, and the primers for GAPDH (5' primer, GGTGAAGGTCGGTGTGAACGGA; 3' primer, TGTTAGTGGGGTCTCGCTCCTG) yielded a 223- bp product. The PCR primers were selected to discriminate between cDNA and genomic DNA by using specific primers for different exons. Multiplex PCR kits (human CCR genes set-1, set-2, and CXCR gene set-1; Maxim Biotec) were used for detection of chemokine receptors, according to the manufacturer’s instructions.

Flow cytometry

To detect intracellular MCP-1/CCL2 expression in keratocytes and the corneal epithelium, cells were collected from donor corneas, fixed with 2% formaldehyde, and permeabilized with 10% saponin. Stained cells were analyzed on a FACSCalibur flow cytometer (BD Biosciences), as follows. Cells were washed with FACS buffer (PBS (pH 7.4), 0.5% BSA, 0.02% sodium azide). Then 1 x 106 cells were treated with Fc blocker (BD Biosciences) for 15 min, incubated with FITC anti-human MCP-1/CCL2 mAb for 20 min, and washed twice with FACS buffer before analysis. To detect dead cells, a PE annexin V kit (BD Biosciences) was used according to the manufacturer’s instructions.

Immunocytochemical study

CD45-positive BMCs were isolated from donor corneal stromas by MACS, washed in PBS, and then attached to glass slides with a cytospin machine. Then the cells on the slides were fixed in 100% cold acetone and processed for immunocytochemistry with FITC anti-human CCR2 mAb. Nonimmune FITC goat IgG was used as the negative control.

Boyden chamber assay

BMC migration was assayed by using a modified Boyden chamber (48 wells) technique. The supernatant of keratocytes cultured for 48 h with 1% FCS was placed in the lower wells (25 µl). Then 50 µl of a cell suspension (1 x 104 BMCs/ml in RPMI 1640 medium with 1% FCS) was added to each of the upper wells of the chamber, which were separated from the lower wells by a polycarbonate polyvinylpyrrolidone-free micropore filter (Nuclepore; Whatman). The pore size was 8 µm for the upper well filters and 5 µm for the lower well filters. After incubation of the chamber (60 min) at 37°C in a humidified atmosphere with 5% CO2, the filters were removed and the upper sides were cleaned. Then the filters were fixed in methanol and stained with methyl green. Chemotaxis was quantified by counting all the cells that migrated completely through the pores of the filter, and the extent of migration was shown as the number of migrating cells per well. To assess the role of chemokines and chemokine receptors in the migration of BMCs, we added anti-human MCP-1/CCL2-blocking Abs to the upper wells.

Statistical analysis

One-way ANOVA and Scheffe’s multiple comparison test were used to compare mean values for the three groups, whereas unpaired Student’s t test was used to compare mean values for the two groups. The level of significance was set at p < 0.05. Analyses were performed using the Stat View statistical software package (version 5; Abacus Concepts).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Chemokine production by cultured human keratocytes detected by the Ab array technique

To determine the chemokines produced by keratocytes, we analyzed 13 of chemokines in cultured human keratocytes isolated by negative selection with magnetic beads using the panleukocyte marker CD45. Based on the results of Ab array analysis with two array membranes, the appearance of representative membranes and the average net optical intensity of chemokines in the supernatant of cultured keratocytes are shown in Fig. 1. Mean optical intensity of positive spots from the culture supernatants was compared with those derived from the medium alone. Growth-related oncogene (GRO)/CXCL1–3 (the ligand of CXCR2), IL-8/CXCL8 (the ligand of CXCR1 and CXCR2), and MCP-1/CCL2 (the ligand of CCR2) proteins show high levels in the keratocyte culture medium (Fig. 1, A–E). The cultured keratocytes also produced cytokines and growth factor protein such as IL-6, tissue inhibitor of metalloproteinase (TIMP)-2, TGF-beta1, TIMP-1, angiogenin, and basic fibroblast growth factor (Fig. 1F).


Figure 1
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 1. Chemokine production by cultured human keratocytes, as detected by the Ab array technique. Supernatant of cultured keratocytes was investigated for candidate chemokines by the Ab array technique. Representative results are shown for basal medium only (A) and culture supernatant (B) with the Human Angiogenesis Antibody I kit, and for basal medium only (C) and culture supernatant (D) with the Human Inflammatory Antibody Array III kit. Pos. and Neg., Indicate the positive control and negative control, respectively. E, The average optical intensity relative to positive control spots is shown for chemokines, cytokines, and other growth factors in E and F. The vertical axis indicates the average percentage of intensity relative to the positive control spot. E, GRO/CXCL1–3, IL-8/CXCL8, and MCP-1/CCL2 chemokine proteins are present at high levels in the culture supernatant of keratocytes. F, Among the other factors, IL-6 and TIMP-2 showed high levels. Results represent the mean ± SD for three sets of each Ab array membrane.

 
Chemokine receptor gene expression by BMCs in human corneal stroma detected by multiplex PCR

CD45-positive cells in the human corneal stroma are all BMCs, as reported elsewhere (1). To find the chemokine receptors expressed by BMCs in normal human corneal stroma, multiplex PCR was performed with primers for the CC, CXC, and CX3C chemokine receptors. As shown in Fig. 2, the genes for CCR2 (the receptor for MCP-1/CCL2 and MCP-3/CCL7) and CCR7 (the receptor for secondary lymphoid-tissue chemokine (SLC)/CCL21 and EBI 1-ligand chemokine (ELC)/CCL19) were detected in CD45-positive cells isolated from human corneal stroma. In contrast, the CXCR and CX3CR genes were not detected under any PCR conditions. The CCR11 gene (included in the primer set) was previously classified as a CC chemokine receptor, but has since been excluded from the chemokine family (9).


Figure 2
View larger version (61K):
[in this window]
[in a new window]

  		FIGURE 2. Chemokine receptor gene expression detected in BMCs by multiplex RT-PCR. Chemokine receptor gene expression was examined by multiplex RT-PCR after isolation of CD45-positive cells from normal human corneal stroma. The CCR2 and CCR7 genes were detected in BMCs. The CCR11 gene (included in the primer set) was previously classified as a CCR, but has subsequently been excluded from the chemokine family. These experiments were performed twice using different samples.

 
CCR2 protein expression in BMCs detected by immunocytochemistry

The immunocytochemical study showed that BMCs from human corneal stroma were strongly stained by FITC-labeled anti-human CCR2 Ab (Fig. 3A), but not by the control IgG (Fig. 3B). Immunocytochemistry was not performed for CCR7, because the genes for its ligands (SLC/CCL21 and ELC/CCL19) were not detected by RT-PCR in human keratocytes isolated from donor corneal stroma (data not shown).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 3. CCR2 expression shown by immunocytochemistry. BMCs were isolated from donor corneal stroma by MACS and attached to glass slides with a cytospin machine. BMCs are strongly stained by FITC anti-human CCR2 mAb (A, arrows), but not by the control Ab (B).

 
MCP-1/CCL2 expression by keratocytes and corneal epithelial cells isolated from human corneas

We next investigated whether keratocytes isolated directly from donor corneas showed constitutive expression of the MCP-1/CCL2 gene and protein. We also tested whether human corneal epithelial cells could produce MCP-1/CCL2 gene and protein, because BMCs were localized to the anterior layer of the central and paracentral corneal stroma, as previously described (1). Keratocytes and corneal epithelial cells were isolated after removal of CD45-positive cells from donor corneas and were shown to express the MCP-1/CCL2 gene by RT-PCR (Fig. 4A). Intracellular expression of MCP-1/CCL2 in keratocytes and corneal epithelial cells was evaluated by flow cytometry, because immunocytochemistry and immunohistochemistry did not show any staining for MCP-1/CCL2. Flow cytometric analysis of cells permeabilized with saponin showed a positive reaction to anti-human MCP-1/CCL2 mAb in both keratocytes and corneal epithelial cells isolated from donor corneas, demonstrating that there is at least intracellular expression of MCP-1/CCL2 by these cells (Fig. 4B). These findings suggested that MCP-1/CCL2 and CCR2 may possibly be the chemokine and chemokine receptor involved in regulating the distribution of BMCs in human corneal stroma.


Figure 4
View larger version (35K):
[in this window]
[in a new window]

  		FIGURE 4. MCP-1/CCL2 gene and protein expression by keratocytes and corneal epithelial cells from donor corneas. Keratocytes and corneal epithelial cells were directly isolated from the stroma and epithelium of donor corneas after depletion of CD45-positive cells. These cells were then used for detection of MCP-1/CCL2 by RT-PCR and flow cytometric analysis. Water was the negative control. A, The MCP-1/CCL2 gene is detected in corneal epithelial cells and keratocyte (30 cycles). Intracellular MCP-1/CCL2 expression was investigated by flow cytometric analysis after saponification of the cells. B, Flow cytometric analysis demonstrates a positive reaction to FITC-labeled anti-human MCP-1/CCL2 mAb, but not control IgG, in the keratocytes. A similar positive reaction is obtained in corneal epithelial cells with FITC-labeled anti-human MCP-1/CCL2 mAb, but not control IgG. These experiments were performed twice on different samples with similar results.

 
Boyden chamber assay

To test whether CCR2 ligands, MCP-1/CCL2, MCP-2/CCL8, and MCP-3/CCL7 are candidate chemokines for chemotaxis assay, we measured the concentrations of these chemokines in the culture supernatant of human keratocytes. Cultured keratocytes produced 1240 ± 490 pg/ml (mean ± SD; n = 4) MCP-1/CCL2 protein measured by using ELISA kits (R&D Systems), whereas concentrations of MCP-2/CCL8 and MCP-3/CCL7 were undetectable level. Therefore, the Boyden chamber assay was performed to test whether CCR2 and its ligand MCP-1/CCL2 had a role in the migration of BMCs. When human rMCP-1/CCL2 was added to RPMI 1640 medium in the lower wells of the chamber, it showed chemotactic activity for a human monocytic cell line (THP-1) and BMCs, whereas the medium alone did not (Fig. 5A). Supernatant from keratocytes cultured with 1% FCS showed significantly higher chemotactic activity for BMCs than control medium (RPMI 1640 with 1% FCS) (Fig. 5B). When blocking Ab to MCP-1/CCL2 was added to the supernatant of cultured keratocytes in the lower wells, MCP-1/CCL2 mAb, but not control IgG, significantly inhibited the migration of BMCs. These findings demonstrated that keratocytes produce a chemotactic factor for BMCs in the corneal stroma and that the interaction between MCP-1/CCL2 and CCR2 on BMCs has a role in human corneal stroma.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 5. Boyden chamber assay. A, Human rMCP-1/CCL2 in RPMI 1640 medium (lower wells) shows significantly higher chemotactic activity for a human monocytic cell line (THP-1) and for BMCs from corneal stroma than RPMI 1640 alone. B, Supernatant of cultured keratocytes was added to the lower wells. Culture supernatant shows significantly higher chemotactic activity for BMCs than RPMI 1640. MCP-1/CCL2 Ab, but not control IgG, significantly inhibits the migration of BMCs. *, p < 0.01.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Based on our hypothesis that a certain chemokine and its receptor may determine the constitutive distribution of BMCs in the normal human corneal stroma, we searched for chemokines and chemokine receptors by the Ab array and multiplex RT-PCR methods. The Ab array is a method based on enzyme-linked immunoassay that enables us to simultaneously analyze various proteins at minute levels. We detected six chemokines in the culture medium of corneal keratocyte by using this system, among which GRO/CXCR1–3, IL-8/CXCR8, and MCP-1/CCL2 showed high levels. Multiplex RT-PCR demonstrated that CCR2, the receptor for MCP-1/CCL2 and CCR7, and the common receptors for SLC/CCL21 and ELC/CCL19 were candidate chemokine receptors in stromal BMCs. Both the MCP-1/CCL2 gene and protein were detected in keratocytes and BMCs, whereas the CCR2 gene and protein were detected in BMCs derived from normal donor corneas. BMCs bearing CCR2 in the human corneal stroma showed a chemotactic response to rMCP-1/CCL2. The chemotactic effect of the supernatant of cultured keratocytes was inhibited by MCP-1/CCL2-blocking Abs. The exact mechanism underlying the distribution of BMC in the central and paracentral anterior stroma of the human cornea is still unknown (1). The fact that not only cultured human corneal epithelium (10, 11), but also donor corneal epithelium (as shown in this study) constitutively expresses the MCP-1/CCL2 gene and protein may contribute to explaining the localization of BMC in the anterior corneal stroma. All of these findings may help to explain the constitutive localization of BMCs to the anterior stroma of the central and paracentral regions vs all stromal layers at the periphery of avascular normal human corneas.

MCP-1/CCL2 (also known as monocyte chemotactic and activating factor) was originally identified as a key molecule for the chemotaxis and activation of macrophages (12, 13). MCP-1/CCL2 was found to be potently angiogenic when implanted into rabbit corneas, and it is the strongest ligand for CCR2 (14). CCR2 is a cognate receptor of MCP-1 that is expressed on monocytes, activated and memory T lymphocytes, and macrophages (15). Human corneal keratocytes exposed to appropriate stimulants express a high level of MCP-1/CCL2 (16, 17). Moreover, a study of human corneal endothelial cells as well as cultured human corneal endothelial cells also concluded that MCP-1/CCL2 was produced when cells were stimulated (18, 19). These findings suggested that CCR2-expressing cells can migrate into all layers of the cornea under inflammatory conditions, whereas MCP-1/CCL2 regulates the constitutive distribution of BMCs, as well as accumulation of leukocytes under inflammatory conditions. Clinically, functional interaction of MCP-1/CCL2 in corneal cells and CCR2-expressing BMCs and memory T cells in cornea may have a central role in a variety of corneal inflammatory diseases, such as herpetic stromal keratitis, interstitial keratitis, diffuse lamellar keratitis after laser in situ keratomileusis, and subepithelial infiltrates after epidemic keratoconjunctivitis. Moreover, MCP-1/CCL2-CCR2 interaction may also be associated with immune reaction involving allorecognition and allorejection in corneal transplantation.

The distribution of BMCs in normal tissues should not be random due to specific factors that allow the recruitment of marrow cells to each tissue. This process may involve various adhesion molecules, including selections, integrins, and their corresponding vascular ligands, as well as the large family of chemokines and their receptors (20). In addition to MCP-1/CCL2-CCR2 as a critical determinant of the BMC distribution in the corneal stroma, we identified liver and activation-regulated chemokine/MIP-3{alpha}/CCL20-CCR6 as a possible key factor explaining the constitutive existence of myeloid DC in normal human corneal epithelium (S. Yamagami, unpublished observation). These findings suggest that specific chemokines accurately control the distribution of constitutive BMCs with different phenotypes in each part of cornea. However, the reason that MCP-1/CCL2 expressed in the corneal epithelium does not attract CCR2-positive cells into the epithelial layer is unclear. Immunological processes, adhesion molecules, or vascular ligands may restrict leukocyte influx into the anterior segment of the eye before local leukocyte trafficking via chemokine-chemokine receptor interactions. Alternatively, cells of the monocyte lineage bearing CCR2 may change their phenotypes in the ocular microenvironment before migrating into the corneal epithelium, because monocytes can differentiate into immature DCs after appropriate cytokine stimulation (21).

Correlations between chemokine production and corneal pathology have been reported in various experimental models. liver and activation-regulated chemokine/CCL20 and its receptor CCR6 is a possible functional chemokine receptor pair in murine herpetic stromal keratitis (22). RANTES/MIP-1beta and their receptor CCR5 is a chemokine receptor combination involved in DC recruitment in inflamed mouse corneal epithelium (23). In a mouse corneal transplantation model, CC chemokines (such as RANTES/CCL5, MIP-1{alpha}, and MCP-1/CCL2) may be associated with the effector phase of corneal allograft rejection (24) and with the recruitment of innate immune cells in the early period after high-risk corneal transplantation (25). Moreover, blockade of proinflammatory cytokines suppresses chemokine expression and promotes corneal allograft survival (26). These findings suggest that chemokine expression may be associated with a variety of ocular inflammatory conditions. Apart from the data obtained in murine inflammation models, our findings provide the first clues to explain the regulation of the constitutive distribution of cells by chemokine receptor interactions in the normal human cornea.

In summary, MCP-1/CCL2 in keratocytes and CCR2 in BMCs were detected as a candidate chemokine-chemokine receptor combination by the protein array assay, multiplex RT-PCR, and RT-PCR. Keratocytes and corneal epithelial cells from normal donor corneas express MCP-1/CCL2. Supernatant of cultured keratocytes has a chemoattractant effect on CCR2-expressing BMCs isolated from normal human corneal stroma. This chemotaxis could be suppressed by blockade of MCP-1/CCL2 in a Boyden chamber assay. Our findings are the first evidence of the constitutive expression of CCR2 by BMCs in the corneal stroma and the expression of MCP-1/CCL2 by normal keratocytes/epithelial cells, suggesting that the interaction between MCP-1/CCL2 and CCR2 may determine the constitutive distribution of BMCs in normal human corneal stroma.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, and Science. Back

2 Address correspondence and reprint requests to Dr. Satoru Yamagami, Department of Corneal Tissue Regeneration, Tokyo University Graduate School of Medicine, Hongo 7-3-1, Bunkyo-ku, Tokyo, Japan 113-8655. E-mail address: syamagami-tky{at}umin.ac.jp Back

3 Abbreviations used in this paper: BMC, bone marrow-derived cell; ELC, EBI 1-ligand chemokine; GRO, growth-related oncogene; SLC, secondary lymphoid-tissue chemokine; TIMP, tissue inhibitor of metalloproteinase. Back

Received for publication February 7, 2006. Accepted for publication December 21, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Yamagami, S., N. Ebihara, T. Usui, S. Yokoo, S. Amano. 2006. Bone marrow-derived cells in normal human corneal stroma. Arch. Ophthalmol. 124: 62-69. [Abstract/Free Full Text]
  2. Hamrah, P., Y. Liu, Q. Zhang, M. R. Dana. 2003. The corneal stroma is endowed with a significant number of resident dendritic cells. Invest. Ophthalmol. Visual Sci. 44: 581-589. [Abstract/Free Full Text]
  3. Brissette-Storkus, C. S., S. M. Reynolds, A. J. Lepisto, R. L. Hendricks. 2002. Identification of a novel macrophage population in the normal mouse corneal stroma. Invest. Ophthalmol. Visual Sci. 43: 2264-2271. [Abstract/Free Full Text]
  4. Nakamura, T., F. Ishikawa, K. H. Sonoda, T. Hisatomi, H. Qiao, J. Yamada, M. Fukata, T. Ishibashi, M. Harada, S. Kinoshita. 2005. Characterization and distribution of bone marrow-derived cells in mouse cornea. Invest. Ophthalmol. Visual Sci. 46: 497-503. [Abstract/Free Full Text]
  5. Springer, T. A.. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76: 301-304. [Medline]
  6. Luster, A. D.. 1998. Chemokines: chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338: 436-445. [Free Full Text]
  7. Ward, S. G., K. Bacon, J. Westwick. 1998. Chemokines and T lymphocytes: more than an attraction. Immunity 9: 1-11. [Medline]
  8. Sakai, R., T. Kinouchi, S. Kawamoto, M. R. Dana, T. Hamamoto, T. Tsuru, K. Okubo, S. Yamagami. 2002. Construction of human corneal endothelial cDNA library and identification of novel active genes. Invest. Ophthalmol. Visual Sci. 43: 1749-1756. [Abstract/Free Full Text]
  9. Murphy, P. M.. 2002. International Union of Pharmacology. XXX. Update on chemokine receptor nomenclature. Pharmacol. Rev. 54: 227-229. [Abstract/Free Full Text]
  10. Spandau, U. H., A. Toksoy, S. Verhaart, R. Gillitzer, F. E. Kruse. 2003. High expression of chemokines Gro-{alpha} (CXCL-1), IL-8 (CXCL-8), and MCP-1 (CCL-2) in inflamed human corneas in vivo. Arch. Ophthalmol. 121: 825-831. [Abstract/Free Full Text]
  11. Bian, Z. M., V. M. Elner, N. W. Lukacs, R. M. Strieter, S. L. Kunkel, S. G. Elner. 1998. Glycated human serum albumin induces IL-8 and MCP-1 gene expression in human corneal keratocytes. Curr. Eye Res. 17: 65-72. [Medline]
  12. Matsushima, K., C. G. Larrsen, G. C. DuBois, J. J. Oppenheim. 1989. Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J. Exp. Med. 169: 1485-1490. [Abstract/Free Full Text]
  13. Charo, I. F., S. J. Myers, A. Herman, C. Franci, A. J. Connolly, S. R. Coughlin. 1994. Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl-terminal tails. Proc. Natl. Acad. Sci. USA 91: 2752-2756. [Abstract/Free Full Text]
  14. Goede, V., L. Brogelli, M. Ziche, H. G. Augustin. 1999. Induction of inflammatory angiogenesis by monocyte chemoattractant protein-1. Int. J. Cancer 82: 765-770. [Medline]
  15. Luther, S. A., J. G. Cyster. 2001. Chemokines as regulators of T cell differentiation. Nat. Immunol. 2: 102-107. [Medline]
  16. Kumagai, N., K. Fukuda, Y. Fujitsu, Y. Lu, N. Chikamoto, T. Nishida. 2005. Lipopolysaccharide-induced expression of intercellular adhesion molecule-1 and chemokines in cultured human corneal fibroblasts. Invest. Ophthalmol. Visual Sci. 46: 114-120. [Abstract/Free Full Text]
  17. Hong, J. W., J. J. Liu, J. S. Lee, R. R. Mohan, R. R. Mohan, D. J. Woods, Y. G. He, S. E. Wilson. 2001. Proinflammatory chemokine induction in keratocytes and inflammatory cell infiltration into the cornea. Invest. Ophthalmol. Visual Sci. 42: 2795-2803. [Abstract/Free Full Text]
  18. Yamagami, H., S. Yamagami, T. Inoki, S. Amano, K. Miyata. 2003. The effects of proinflammatory cytokines on cytokine-chemokine gene expression profiles in the human corneal endothelium. Invest. Ophthalmol. Visual Sci. 44: 514-520. [Abstract/Free Full Text]
  19. Yamagami, S., S. Yokoo, T. Mimura, S. Amano. 2004. Effects of TGF-beta2 on immune response-related gene expression profiles in the human corneal endothelium. Invest. Ophthalmol. Visual Sci. 45: 515-521. [Abstract/Free Full Text]
  20. Weber, C.. 2003. Novel mechanistic concepts for the control of leukocyte transmigration: specialization of integrins, chemokines, and junctional molecules. J. Mol. Med. 81: 4-19. [Medline]
  21. Vandenabeele, S., L. Wu. 1999. Dendritic cell origins: puzzles and paradoxes. Immunol. Cell Biol. 77: 411-419. [Medline]
  22. Shirane, J., T. Nakayama, D. Nagakubo, D. Izawa, K. Hieshima, Y. Shimomura, O. Yoshie. 2004. Corneal epithelial cells and stromal keratocytes efficiently produce CC chemokine-ligand 20 (CCL20) and attract cells expressing its receptor CCR6 in mouse herpetic stromal keratitis. Curr. Eye Res. 28: 297-306. [Medline]
  23. Yamagami, S., P. Hamrah, K. Miyamoto, D. Miyazaki, I. Dekaris, T. Dawson, B. Lu, C. Gerard, M. R. Dana. 2005. The CCR5 chemokine receptor mediates recruitment of MHC-class II-positive Langerhans cells in the mouse corneal epithelium. Invest. Ophthalmol. Visual Sci. 46: 1201-1207. [Abstract/Free Full Text]
  24. Yamagami, S., D. Miyazaki, S. Ono, M. R. Dana. 1999. Differential chemokine gene expression after corneal transplantation. Invest. Ophthalmol. Visual Sci. 40: 2892-2897. [Abstract/Free Full Text]
  25. Yamagami, S., P. Hamrah, Q. Zhang, Y. Liu, S. Huq, M. R. Dana. 2005. Early ocular chemokine gene expression and leukocyte infiltration after high-risk corneal transplantation. Mol. Vis. 11: 632-640. [Medline]
  26. Qian, Y., I. Dekaris, S. Yamagami, M. R. Dana. 2000. Topical soluble tumor necrosis factor {alpha} receptor type I suppresses ocular chemokine gene expression and rejection of allogeneic corneal transplants. Arch. Ophthalmol. 118: 1666-1671. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ebihara, N.
Right arrow Articles by Murakami, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ebihara, N.
Right arrow Articles by Murakami, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS