HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, M. Articles by Dziarski, R. Search for Related Content PubMed PubMed Citation Articles by Wang, M. Articles by Dziarski, R.

Human Peptidoglycan Recognition Proteins Require Zinc to Kill Both Gram-Positive and Gram-Negative Bacteria and Are Synergistic with Antibacterial Peptides¹

Indiana University School of Medicine, Northwest Campus, Gary, IN 46408

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mammals have four peptidoglycan recognition proteins (PGRPs or PGLYRPs), which are secreted innate immunity pattern recognition molecules with effector functions. In this study, we demonstrate that human PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 have Zn²⁺-dependent bactericidal activity against both Gram-positive and Gram-negative bacteria at physiologic Zn²⁺ concentrations found in serum, sweat, saliva, and other body fluids. The requirement for Zn²⁺ can only be partially replaced by Ca²⁺ for killing of Gram-positive bacteria but not for killing of Gram-negative bacteria. The bactericidal activity of PGLYRPs is salt insensitive and requires N-glycosylation of PGLYRPs. The LD₉₉ of PGLYRPs for Gram-positive and Gram-negative bacteria is 0.3–1.7 µM, and killing of bacteria by PGLYRPs, in contrast to killing by antibacterial peptides, does not involve permeabilization of cytoplasmic membrane. PGLYRPs and antibacterial peptides (phospholipase A₂, - and -defensins, and bactericidal permeability-increasing protein), at subbactericidal concentrations, synergistically kill Gram-positive and Gram-negative bacteria. These results demonstrate that PGLYRPs are a novel class of recognition and effector molecules with broad Zn²⁺-dependent bactericidal activity against both Gram-positive and Gram-negative bacteria that are synergistic with antibacterial peptides.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Peptidoglycan recognition proteins (PGRPs)³ are innate immunity molecules present in insects, mollusks, echinoderms, and vertebrates but not in nematodes and plants (1, 2, 3). PGRPs have at least one PGRP domain, which is homologous to bacteriophage and bacterial type 2 amidases (1, 2, 3). Insects have up to 19 PGRPs, classified into short (S) and long (L) forms (3). The short forms are present in the hemolymph, cuticle, and fat body cells and sometimes in epidermal cells in the gut and hemocytes, whereas the long forms are mainly expressed in hemocytes (3). The expression of insect PGRPs is often up-regulated by exposure to bacteria. Insect PGRPs activate Toll or Imd signal transduction pathways or induce proteolytic cascades that generate antimicrobial products, induce phagocytosis, and protect insects against infections (3). Some insect PGRPs are enzymes that hydrolyze peptidoglycan, a bacterial cell wall component (3).

Mammals have four PGRPs, which were initially named PGRP-S, PGRP-L, and PGRP-I and PGRP-I (for "short", "long", or "intermediate" transcripts, respectively), by analogy to insect PGRPs (3, 4). Subsequently, the Human Genome Organization Gene Nomenclature Committee changed their names to peptidoglycan recognition proteins 1, 2, 3, and 4 (PGLYRP-1, PGLYRP-2, PGLYRP-3, and PGLYRP-4), respectively, and this terminology is used here.

Mammalian PGLYRP-2 is an N-acetylmuramoyl-L-alanine amidase that hydrolyzes bacterial peptidoglycan (5, 6). PGLYRP-2 is secreted from liver into blood and is also induced by bacteria in epithelial cells (7, 8, 9). The remaining three mammalian PGLYRPs are bactericidal or bacteriostatic proteins that are secreted as disulfide-linked homo- and heterodimers (10). Mammalian PGLYRP-1, PGLYRP-3, and PGLYRP-4 are a new class of bactericidal proteins that have a different structure, mechanism of action, and expression than currently known mammalian antimicrobial peptides (10, 11). PGLYRPs are much larger than all currently known vertebrate antibacterial peptides: they are disulfide-linked glycosylated 44- to 115-kDa dimers, in contrast to vertebrate antimicrobial peptides, which are typically 3–15 kDa (10, 11). PGLYRPs kill bacteria likely by interacting with cell wall peptidoglycan, whereas antibacterial peptides kill bacteria by permeabilizing their membranes (10). PGLYRPs require divalent cations and N-glycosylation for their bactericidal activity, and antibacterial peptides usually do not (10, 11).

PGLYRP-1 is expressed primarily in PMN granules (12, 13, 14, 15), and PGLYRP-3 and PGLYRP-4 are expressed in the skin, eyes, salivary glands, throat, tongue, esophagus, stomach, and intestine (10). In addition to PGLYRPs, these tissues also express many antimicrobial peptides and proteins, such as defensins (16, 17), phospholipase A₂ (18, 19, 20, 21, 22), dermicidin (23), cathelicidin (24), RNases (25), psoriasin (26), calprotectin (27, 28, 29), bactericidal permeability-increasing protein (22), and lysozyme (22). Secretions of these tissues also contain several divalent cations, such as Ca²⁺, Mg²⁺, Zn²⁺, Fe²⁺, Cu²⁺, Se²⁺, Ni²⁺, and Mn²⁺ (30), which influence the activity of antimicrobial proteins. Because our previous results indicated that bactericidal activity of human PGLYRPs for Gram-positive bacteria is Ca²⁺ dependent (10) and because other divalent cations present in body secretions and tissue fluids influence the activity of other antimicrobial proteins (16, 17, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40), in this study, we tested the hypothesis that other divalent cations may also play an important role in bactericidal activity of human PGLYRPs. Moreover, because PGLYRPs are secreted into body fluids that also contain many antibacterial peptides with different bactericidal mechanisms from PGLYRPs (10), we also tested the hypothesis that PGLYRPs may kill bacteria synergistically with these peptides. We discovered that PGLYRPs have higher bactericidal activity against Gram-positive bacteria and become highly bactericidal for Gram-negative bacteria in the presence Zn²⁺ and also that PGLYRPs kill bacteria synergistically together with membrane-damaging antibacterial peptides.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Materials

Human PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 were expressed in S2 cells and purified as previously described (10), except that instead of Ca²⁺, 40 µM Zn²⁺ (for testing on Gram-negative bacteria) or 2 mM Ca²⁺, 40 µM Zn²⁺, and 10 µM Cu²⁺ (for testing on Gram-positive bacteria) were used in protein purification buffers, and 10 µM Zn²⁺ (for Gram-negative bacteria) or 2 mM Ca²⁺, 10 µM Zn²⁺, and 10 µM Cu²⁺ (for Gram-positive bacteria) were used in the final dialysis buffer. Wherever indicated, other combinations of divalent cations were also used in some experiments in the purification and dialysis buffers as described in Results. For Zn²⁺ removal, proteins were incubated with 100 µM EGTA (10). De-N-glycosylation was performed as described previously (10).

Human group IIA phospholipase A₂ (PLA₂) (41) was amplified from the Image clone ID 152802 (obtained from Open Biosystems) by PCR using forward (GCAGATCTAATTTGGTGAATTTCCACAGAATG) and reverse (ATGAATTCGCAACGAGGGGTGCTCCCTCTG) primers and subcloned into the BglII and EcoRI sites of the pMT/BiP/V5-His expression vector (Invitrogen Life Technologies). To generate human PLA₂-PGLYRP-1 fusion protein, the PGLYRP-1 coding region (10) was amplified by PCR using forward (GTGAATTCGCTCAGGAGACAGAAGACCCGG) and reverse (CATCTAGAGGGGGAGCGGTAGTGTGGCCAAT) primers and was inserted 3' of the PLA₂ into the EcoRI and XbaI sites. Human Fc IgG1 fragment was amplified from the clone ID 5480266 (obtained from American Type Culture Collection) by PCR using forward (CGAGATCTGAGCCCAAATCTTGTGACAAAACTC) and reverse (ATACCGGTTATTTCCATGCTGGGTGCCTGGG) primers (codons 239–506) and subcloned into the BglII and AgeI sites of the pMT/BiP/V5-His expression vector. To generate human PGLYRP-1-Fc fusion protein, the Fc coding region was amplified as above using forward (CGTCTAGAGAGCCCAAATCTTGTGACAAAACTC) primer and the same reverse primer and was inserted 3' of the PGLYRP-1 (10) into the XbaI and AgeI sites. All constructs were confirmed by restriction digestion and by sequencing. The proteins were expressed and purified from S2 cell supernatants as described above for PGLYRPs. Each of these purified proteins (10 µg/lane) yielded one band on Coomassie brilliant blue-stained gel of comparable purity to PGLYRPs (10).

Human -defensin (human neutrophil protein-1 (HNP-1)) was obtained form Bachem Bioscience, human neutrophil bactericidal permeability-increasing protein (BPI) was from Athens Research and Technology, and recombinant human -defensin-3 (HBD-3) was from Cell Sciences. Magainin (Ala^8,13,18-magainin II amide), lysostaphin (recombinant), and all other reagents were from Sigma-Aldrich, unless otherwise indicated.

Bacteria

The following bacteria were used: Bacillus subtilis ATCC 6633, Enterococcus faecalis ATCC 19433, Escherichia coli K12 (used in most experiments), E. coli O18:K1:H7:Bort (42), Lactobacillus acidophilus ATCC 4356, Listeria monocytogenes ATCC 19115, Micrococcus luteus ATCC 4698, Proteus vulgaris ATCC 13315, Pseudomonas aeruginosa ATCC 27853, Salmonella enterica ATCC 6539, Shigella sonnei ATCC 25931, Staphylococcus aureus Rb (10), and Streptococcus pyogenes ATCC 49399.

Antibacterial assays

Bactericidal and bacteriostatic activity of human PGLYRPs and antibacterial peptides was assayed on logarithmically growing bacteria at 0.4–1.2 x 10⁶/ml as previously described (10) with recombinant human Fc IgG1 fragment as a control protein or PGLYRPs or other test proteins at the concentrations indicated in Results. The standard medium was 5 mM Tris (pH 7.6), with 150 mM NaCl, 5 µM ZnSO₄, 5% glycerol, and 1% Luria-Bertani (LB) for Gram-negative bacteria, or the same medium plus 1 mM CaCl₂ and 5 µM CuSO₄ and either 1% LB or 1% BHI for Gram-positive bacteria (10), unless otherwise indicated (i.e., in some experiments combinations of various divalent cations listed in Table I were used, as indicated in Results). The numbers of bacteria were determined by colony counts on LB or BHI agar plates (10). In some experiments, as indicated in Results, 0.525 M sucrose was included in the assay and dilution medium, and bacteria were overlaid in 0.7% agar onto 1.5% agar LB plates, both containing 0.5 M sucrose (10). All other controls were performed as described previously (10). Bactericidal activity is defined as an at least 2 log₁₀ decrease in the number of inoculated bacteria in 6 h; bacteriostatic activity is defined as an inhibition of growth of bacteria or a decrease in the number of inoculated bacteria of <2 log₁₀ in 6 h. The results are means of three (mostly) or two experiments; the average SEs were 18% of the mean (ranged from 6 to 28%) and are not shown because the error bars were mostly smaller than the size of the symbols in the figures. The significance of differences was calculated using the Student’s t test, and all differences in bacterial numbers > 1 log₁₀ were statistically significant at p < 0.05 (and most often at p < 0.01).

Membrane permeabilization was studied as previously described (10) using membrane-nonpermeable DNA-binding fluorescent dye SYTOX-Green (2 µM; Molecular Probes) and 3.5 x 10⁶/ml E. coli in the same medium as for the bactericidal assays without or with 0.525 M sucrose at 37°C. For these experiments, bactericidal assays were performed as above with 3.5 x 10⁶/ml E. coli.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Bactericidal activity of PGLYRPs against Gram-positive bacteria is enhanced by Zn²⁺

We previously demonstrated that human PGLYRPs were strongly bactericidal for some pathogenic Gram-positive bacteria (S. aureus and L. monocytogenes) and nonpathogenic transient Gram-positive bacteria (B. subtilis, Bacillus cereus, Bacillus licheniformis, and L. acidophilus) (10). This bactericidal activity required the presence of Ca²⁺, which could not be replaced by Mg²⁺ (10). However, under these conditions, these PGLYRPs were only bacteriostatic (but not bactericidal) for other pathogenic (S. pyogenes) or normal flora (Staphylococcus epidermidis, M. luteus, E. faecalis, and Streptococcus agalactiae) Gram-positive bacteria and for all Gram-negative bacteria (E. coli, P. vulgaris, and Enterobacter cloacae) (10). However, these PGLYRPs were losing bactericidal activity upon storage at 4°C in our buffer with Ca²⁺, suggesting that the ion or pH conditions of this buffer were not optimal for the stability and activity of these proteins. Because PGLYRPs are secreted (PGLYRP-1 into PMN's granules, PGLYRP-2 into the serum, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 into sweat, and PGLYRP-4 also into saliva) (10), we reasoned that they should be more stable (and maybe more active) under the conditions that closely mimic these body fluids. To test this hypothesis, we determined the bactericidal activity of PGLYRPs that were purified and assayed in the presence of six divalent cations that are found in sweat and saliva in at least micromole concentrations (Table I) (30).

PGLYRP-4, purified and tested in the presence of six divalent cations (Table I), had higher bactericidal activity for S. aureus than PGLYRP-4 purified and tested as before (10) in the presence of Ca²⁺ only (Fig. 1A). To determine which of these cations were required for this higher bactericidal activity, we tested bactericidal activity of PGLYRP-4 purified and assayed in the presence of individual cations or various combinations of these cations. Equally high bactericidal activity of PGLYRP-4 for S. aureus was observed in the presence of three cations (Ca²⁺, Zn²⁺, and Cu²⁺) and almost as high in the presence of Zn²⁺ only (Fig. 1A). These results demonstrate that Zn²⁺ is the single most essential cation needed for bactericidal activity of PGLYRP-4 with optimal effect at 5 µM, which is the approximate concentration of Zn²⁺ found in body secretions, such as sweat and saliva (Table I), where PGLYRP-4 is found. PGLYRP-4 at lower concentrations of Zn²⁺ was less active (data not shown). Zn²⁺ is probably required for the stability or proper conformation of PGLYRP proteins because it had to be present during the entire purification of PGLYRPs and bactericidal assays. The high bactericidal activity of PGLYRPs purified in the absence of Zn²⁺ could not be restored by simply adding Zn²⁺ to the protein purified without Zn²⁺ or to the bactericidal assay (data not shown).

View larger version (15K): [in this window] [in a new window]   FIGURE 1. Bactericidal activity of PGLYRPs for S. aureus and S. pyogenes is enhanced by Zn2+. S. aureus or S. pyogenes was incubated with 50–100 µg/ml (S. aureus) or 100–150 µg/ml (S. pyogenes) of the indicated PGLYRPs purified and assayed in the presence of the indicated six ions (Ca2+, Mg2+, Zn2+, Fe2+, Cu2+, and Mn2+) individually or in combination (as indicated on the figure) at the concentrations shown in Table I or Fc IgG fragment as a control. The numbers of bacteria were determined by colony counts. The results are means of two to three experiments.

In our previous study, PGLYRPs purified and tested in the presence of Ca²⁺ (without Zn²⁺) were bactericidal for some pathogenic Gram-positive bacteria (S. aureus and L. monocytogenes) and for nonpathogenic transient Gram-positive bacteria (Bacillus sp. and L. acidophilus), but only bacteriostatic for other pathogenic (S. pyogenes) or normal flora Gram-positive bacteria (10). Because PGLYRPs purified and assayed in the presence of Zn²⁺ were more active against S. aureus, we next tested whether these PGLYRPs were also more active against other Gram-positive bacteria. Indeed, all four PGLYRPs (PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP3:4) purified and assayed in the presence of Zn²⁺ instead of Ca²⁺ also had higher bactericidal activity against L. monocytogens, B. subtilis, and L. acidophilus (data not shown) and were bactericidal for S. pyogenes at 100–150 µg/ml (Fig. 1E). At 100–150 µg/ml, they were still only bacteriostatic for normal flora Gram-positive bacteria (M. luteus and E. faecalis), and at 300 µg/ml, they were bactericidal for M. luteus but not for E. faecalis (data not shown).

PGLYRP-1 was most stable at pH 4.5, but its bactericidal activity could not be assayed at such a low pH because pH < 6 decreased the viability of S. aureus and other bacteria by itself. PGLYRP-1 had higher bactericidal activity for S. aureus at pH 6.4 than at neutral or alkaline pH (data not shown). These results are consistent with the location of PGLYRP-1 in PMN's granules (13, 14, 15), which are usually acidic or become acidic following phagocytosis. PGLYRP-3, PGLYRP-4, and PGLYRP3:4 were most stable and most bactericidal for S. aureus and other bacteria at pH 7.6 (data not shown), which falls within the range of pH found in the intestine, saliva, and sweat (30).

Because NaCl inhibits bactericidal activity of many mammalian antibacterial peptides (e.g., defensins) (16, 17), we next tested whether bactericidal activity of PGLYRPs was also salt sensitive. However, bactericidal activity of PGLYRPs for S. aureus and other bacteria was not inhibited by NaCl and was optimal at 100–150 mM NaCl (data not shown), which falls within the range of NaCl concentrations found in the intestine, saliva, sweat, and other body fluids (30).

PGLYRPs are bactericidal for Gram-negative bacteria in the presence of Zn²⁺

In our previous study, human PGLYRPs purified and tested in the presence of Ca²⁺ (without Zn²⁺) were only bacteriostatic but not bactericidal for Gram-negative bacteria (10). Therefore, we next tested whether PGLYRPs purified and assayed in the presence of Zn²⁺ and/or other cations present in body secretions had higher activity against Gram-negative bacteria. PGLYRP-1, PGLYRP-3, and PGLYRP3:4 purified and tested in the presence of Zn²⁺ were highly bactericidal for E. coli (reduced the numbers of bacteria by >5 logs in less than an hour), whereas at the same concentration, PGLYRP-4 was less active and required 6 h to reduce the numbers of bacteria by 3 logs (Fig. 2). PGLYRPs were less bactericidal for E. coli in the presence of Zn²⁺, Ca²⁺, and Cu²⁺ or Zn²⁺ and Ca²⁺ and were not bactericidal and only bacteriostatic for E. coli (Fig. 2) and other Gram-negative bacteria (data not shown) in the absence of Zn²⁺. Ca²⁺ had an inhibitory effect on the bactericidal activity of PGLYRPs for Gram-negative bacteria, as all PGLYRPs purified and assayed in the presence of both Ca²⁺ and Zn²⁺ were less bactericidal than PGLYRPs purified and assayed in the presence of Zn²⁺ alone (Fig. 2).

View larger version (22K): [in this window] [in a new window]   FIGURE 2. PGLYRPs are bactericidal for E. coli in the presence of Zn2+. E. coli was incubated with 100–150 µg/ml of the indicated PGLYRPs purified and assayed in the presence of the indicated ions (Ca2+, Zn2+, and Cu2+) individually or in combination at the concentrations shown in Table I or Fc IgG fragment as a control. The numbers of bacteria were determined by colony counts. The results are means of two to three experiments.

View larger version (14K): [in this window] [in a new window]   FIGURE 3. PGLYRPs are bactericidal for several Gram-negative bacteria. The indicated bacteria were incubated with 100–150 µg/ml of the indicated PGLYRPs or Fc IgG fragment as a control purified and assayed in the presence of 5 µM Zn2+. The numbers of bacteria were determined by colony counts. The results are means of two to three experiments.

View larger version (14K): [in this window] [in a new window]   FIGURE 4. PGLYRPs are bactericidal (kill 99% of bacteria) at 45 µg/ml (0.4–1.0 µM) for S. aureus and at 30–200 µg/ml (0.3–1.7 µM) for E. coli. Bacteria were incubated for 4–6 h with increasing concentrations of the indicated PGLYRPs or PLA2 purified and assayed in the presence of Ca2+, Zn2+, and Cu2+ (S. aureus) or Zn2+ only (E. coli). The numbers of bacteria were determined by colony counts. The results are means of two to three experiments.

View larger version (20K): [in this window] [in a new window]   FIGURE 5. Bactericidal activity of PGLYRPs for E. coli requires Zn2+ and N-glycosylation. E. coli was incubated with the indicated PGLYRPs (100–150 µg/ml PGLYRP-1, PGLYRP-3, or PGLYRP-3:4 or 300 µg/ml PGLYRP-4) or Fc IgG fragment as control (all purified in the presence of Zn2+) treated or untreated as indicated with EGTA or N-glycosidase. The numbers of bacteria were determined by colony counts. The results are means of two experiments.

Bactericidal effect of PGLYRPs on Gram-negative bacteria does not involve permeabilization of cell membrane

We have previously shown that PGLYRPs, in contrast to antibacterial peptides, do not permeabilize membranes in Gram-positive bacteria and kill them by targeting their cell wall (10, 11). Therefore, we next tested whether PGLYRPs kill Gram-negative bacteria by permeabilizing their cell membranes or by targeting their cell walls. We compared the effects of PGLYRPs on Gram-negative bacteria to the effects of membrane-permeabilizing antibacterial peptide (magainin) and an inhibitor of peptidoglycan biosynthesis (ampicillin). We measured membrane permeabilization in real time using a membrane-nonpermeable dye (SYTOX-green, which fluoresces upon binding to DNA, after entering cells with damaged membranes) and compared it with bacterial killing measured by colony counts. Vertebrate antibacterial peptides (e.g., magainin, PLA₂, and defensins) kill bacteria by traversing bacterial cell wall and permeabilizing bacterial cytoplasmic membrane (16, 17). Therefore, the kinetics of membrane permeabilization by antibacterial peptides correlates with the kinetics of bacterial killing and such an expected result was obtained in magainin-treated E. coli (Fig. 6). Similar results were obtained in the medium with 0.5 M sucrose, which protects bacteria from killing by antibiotics that inhibit cell wall synthesis (because bacteria can resynthesize their cell wall), but not from killing by membrane permeabilization, as confirmed by our results with magainin-treated E. coli (Fig. 6).

View larger version (27K): [in this window] [in a new window]   FIGURE 6. Bactericidal activity of PGLYRPs for E. coli does not involve permeabilization of cytoplasmic membrane. Membrane permeabilization and killing of E. coli incubated with magainin (200 µg/ml), ampicillin (500 µg/ml), or PGLYRPs (200 µg/ml) were measured in medium without or with 0.5 M sucrose. The results are means of two to three experiments.

PGLYRPs rapidly killed E. coli (within 1 h, as measured by colony counts) but did not permeabilize their cytoplasmic membranes for the entire 6-h observation period (Fig. 6). Killing of E. coli by PGLYRPs was not prevented by 0.5 M sucrose (Fig. 6). These results contrast the ability of hyperosmotic medium with sucrose to prevent killing of Gram-positive bacteria by PGLYRPs, or by peptidoglycan-lytic enzymes, or by penicillin (Fig. 5 in Ref. 10) and killing of E. coli by ampicillin (Fig. 6). These results indicate that the effect of PGLYRPs on Gram-negative bacteria becomes irreversible in <1 h, i.e., from this point on the bacteria are unable to grow (hence, no formation of colonies when bacteria are plated).

These results demonstrate that, in contrast to antibacterial peptides, PGLYRPs do not kill Gram-negative bacteria by permeabilizing their cytoplasmic membranes. These results also indicate that PGLYRPs do not kill bacteria by lysing their call wall because cell-wall lytic enzymes cause early permeabilization of cytoplasmic membrane due to hypotonic shock and osmotic lysis, which (together with the killing) is preventable in hyperosmotic medium with sucrose (10). By contrast, killing of Gram-negative bacteria by PGLYRPs is not prevented in 0.5 M sucrose (Fig. 6), which resembles the combined synergistic effect of peptidoglycan-lytic enzymes and PGLYRPs on Gram-positive bacteria, whose killing under these conditions is also not prevented by sucrose (10).

Synergistic killing of Gram-positive and Gram-negative bacteria by PGLYRPs and antibacterial peptides

Several host defenses usually work together to eliminate bacteria and they are often synergistic. PGLYRP-1 is present in PMNs’ granules (13, 14, 15), and PGLYRP-3 and PGLYRP-4 are present on the skin, mucous membranes, and in body secretions (10) together with antibacterial peptides, such as PLA₂, defensins, and BPI (16, 17, 18, 19, 20, 21, 22). If two antibacterial agents have different bactericidal mechanisms, they are likely to kill bacteria synergistically. Because antibacterial peptides kill bacteria by permeabilizing their membranes (16, 17, 18, 19, 20, 21, 22) and PGLYRPs by targeting bacterial cell walls (10, 11), here we tested the hypothesis that PGLYRPs may kill bacteria synergistically with antibacterial peptides.

When S. aureus or L. monocytogenes was incubated with subbactericidal concentrations of PGLYRP-1, PGLYRP-3, or PGLYRP-4 and PLA₂ or -defensin (HNP-1), the killing of these bacteria was enhanced 300–100,000 times, compared with the killing by each compound alone, thus demonstrating a strong synergistic killing of Gram-positive bacteria (Fig. 7, p < 0.001; and Fig. 9, p < 0.01). Similarly, incubation of E. coli with subbactericidal concentrations of PGLYRP-1 or PGLYRP-3 and PLA₂, -defensin (HBD-3), or BPI resulted in 1,000–20,000 times enhancement of bacterial killing compared with the killing by each compound alone, thus also demonstrating a strong synergistic killing of Gram-negative bacteria (Fig. 8, p < 0.001; and Fig. 9, p < 0.01).

View larger version (17K): [in this window] [in a new window]   FIGURE 7. Synergistic killing of Gram-positive bacteria by PGLYRPs and antibacterial peptides. S. aureus or L. monocytogenes was incubated with subbactericidal concentrations of PLA2 (10 µg/ml), HNP-1 (25 µg/ml), and PGLYRPs (25 µg/ml) alone or in combination (as indicated), and the numbers of bacteria were determined by colony counts. The results are means of two to three experiments.

View larger version (12K): [in this window] [in a new window]   FIGURE 9. Synergistic killing of S. aureus or E. coli by PLA2 plus PGLYRP-1 but not by PLA2-PGLYRP-1 fusion protein. S. aureus or E. coli was incubated with subbactericidal concentrations of PLA2 (12.5 µg/ml) or PGLYRP-1 (12.5 µg/ml) alone or with both PLA2 and PGLYRP-1 (12.5 µg/ml each) or with the PLA2-PGLYRP-1 fusion protein (25 µg/ml), and the numbers of bacteria were determined by colony counts. The results are means of two experiments.

View larger version (17K): [in this window] [in a new window]   FIGURE 8. Synergistic killing of E. coli by PGLYRPs and antibacterial peptides. E. coli was incubated with subbactericidal concentrations of PLA2 (12.5 µg/ml), HBD-3 (8 µg/ml), BPI (15 µg/ml), and PGLYRPs (12.5 µg/ml) alone or in combination (as indicated), and the numbers of bacteria were determined by colony counts. The results are means of two to three experiments.

To further test whether synergistic effect of PGLYRPs and antibacterial peptides was due to their action on different parts of the bacterial cell, we constructed a PLA₂-PGLYRP-1 fusion protein and compared its bactericidal activity to the activity of PGLYRP-1 or PLA₂ alone or a mixture of PGLYRP-1 and PLA₂. If PGLYRP-1 and PLA₂ indeed act on different parts of the bacterial cell (cell wall and cytoplasmic membrane), the fusion protein would not be expected to have a synergistic effect in contrast to the two proteins not fused and added together because the fusion protein could only act on one target (cell wall or cytoplasmic membrane). However, if both proteins have the same target (e.g., cell membrane), the fusion protein could still show enhanced activity similar to the two unfused proteins. Our results showed that the PLA₂-PGLYRP-1 fusion protein did not have the enhanced bactericidal activity of the unfused PGLYRP-1 and PLA₂ added together for S. aureus and E. coli (Fig. 9). As additional controls, we tested PGLYRP-1-Fc fusion protein alone, which had the same bactericidal activity as PGLYRP-1, and PLA₂-Fc fusion protein alone, which had the same bactericidal activity as PLA₂ (data not shown), demonstrating that fusing PGLYRP-1 or PLA₂ with another protein or increasing the size of PGLYRP-1 or PLA₂ does not inhibit their bactericidal activities. These results further confirm that PGLYRPs and PLA₂ target different parts of bacterial cell.

In conclusion, our results demonstrate strong synergistic killing of bacteria by PGLYRPs and PLA₂, defensins, BPI, or a peptidoglycan-lytic enzyme, and further confirm that PGLYRPs and these antibacterial peptides kill bacteria by different mechanisms.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
We have demonstrated here that bactericidal activity of human PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 for both Gram-positive and Gram-negative bacteria requires Zn²⁺. For killing of Gram-negative bacteria, Zn²⁺ cannot be replaced by other cations, but for killing of Gram-positive bacteria Zn²⁺, can be partially replaced by Ca²⁺. This Zn²⁺ dependence explains why in our previous experiments PGLYRPs purified in the presence of Ca²⁺ (without Zn²⁺) were not bactericidal for Gram-negative bacteria and were only bactericidal for some Gram-positive bacteria (10).

Physiologic concentrations Zn²⁺ (2–5 µM) were sufficient for full bactericidal activity of human PGLYRPs. Zn²⁺ is present in sweat at 17 µM, in saliva at 2 µM, and in plasma at 15 µM (30). Zn²⁺ is an essential component of many proteins, such as enzymes and transcription factors, and is required for their structure and function (31). The concentration of extracellular and intracellular Zn²⁺ is tightly regulated by Zn²⁺ transporters and Zn²⁺-binding proteins (31, 32, 33). Proper function of host immunity requires Zn²⁺ because Zn²⁺-deficient individuals have increased susceptibility to infections and Zn²⁺ supplementation restores or enhances resistance to infections and the functions of innate and acquired immunity, although the exact mechanisms involved are mostly unknown (34, 35, 36, 37, 38, 39, 40). Several peptidoglycan- or polysaccharide-lytic enzymes contain Zn²⁺ (43, 44, 45, 46), and some antimicrobial peptides require Zn²⁺ for their antimicrobial activity (47, 48, 49, 50, 51, 52). However, the role of Zn²⁺ and other divalent cations in innate immunity is complex because, in addition to its enhancing effect, Zn²⁺ can also inhibit the activity of some antimicrobial proteins, especially Ca²⁺-binding proteins psoriasin (26) and calprotectin (27, 28, 29). Although the exact mechanism of antimicrobial activity of psoriasin and calprotectin are unknown, they are thought to be antimicrobial through Zn²⁺ deprivation because they bind Zn²⁺, and Zn²⁺ supplementation reduces their antimicrobial activity (26, 27, 28, 29). However, Zn²⁺ may also inhibit antimicrobial effect of calprotectin by inducing a change in its conformation, rather than by reversing microbial Zn²⁺ deprivation (27).

Therefore, proper compartmentalization of Zn²⁺ and antimicrobial proteins may be important. For example, PGLYRP-3 and PGLYRP-4 (which require Zn²⁺ for activity) are present in sweat glands, salivary glands, and the eye (10), and calprotectin and psoriasin (whose activity is inhibited by Zn²⁺) are not (26). Moreover, although both calprotectin and PGLYRP-1 are expressed in neutrophils, calprotectin is present in the cytosol and primary and secondary granules (53), and PGLYRP-1 is present in the tertiary granules (13). Also, concentrations of Zn²⁺ that enhance or inhibit microbial killing are different: PGLYRPs require 2–5 µM Zn²⁺ for killing bacteria, whereas inhibition of antimicrobial effect of calprotectin and psoriasin requires 10–30 µM Zn²⁺, and therefore, at low physiological Zn²⁺ concentrations, all these proteins are antimicrobial. Thus, proper control of Zn²⁺ concentration is essential for efficient antimicrobial immunity. In this context, it is interesting to note that activation of innate immunity TLRs by bacteria regulates Zn²⁺ homeostasis in dendritic cells and induces net export of Zn²⁺ from the cells (54). This process is essential for the activation of dendritic and other immune cells (54), and it is tempting to speculate that it may also provide extracellular Zn²⁺ for antimicrobial peptides and PGLYRPs. This would be a feasible mechanism because intracellular Zn²⁺ concentration is 150–300 µM (33), and extracellular PGLYRPs require 2–5 µM Zn²⁺ for bactericidal activity.

The requirement for Zn²⁺ for bactericidal activity of PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 is likely through its effect on PGLYRPs and not on the bacteria (perhaps to stabilize PGLYRPs) because Zn²⁺ presence is required both during the purification of PGLYRPs and in the bactericidal assay. PGLYRP-2 and other amidase-active PGRPs (e.g., Drosophila PGRP-SC1 and PGRP-LB) have a Zn²⁺-binding site and require Zn²⁺ for their amidase activity (5, 6, 55, 56). These amidase-active PGRPs have four Zn²⁺-binding amino acids in their enzyme active site (5, 6, 55, 56). Other PGRPs, however, that do not have amidase activity (such as mammalian PGLYRP-1, PGLYRP-3, and PGLYRP-4), do not have all four Zn²⁺-binding amino acids conserved: they have Ser instead of Cys in the position corresponding to the Zn²⁺-binding Cys⁵³⁰ in human PGLYRP-2 (5, 6). Thus, it is not known where the Zn²⁺ binding site in mammalian PGLYRP-1, PGLYRP-3, and PGLYRP-4 may be. These PGLYRPs will have to be crystallized in the presence of Zn²⁺ to unequivocally determine whether they bind Zn²⁺ and where the Zn²⁺ binding site is located.

Our current and previous results demonstrate that human PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 are bactericidal proteins with broad bactericidal activity against most Gram-positive and Gram-negative bacteria, both pathogenic and nonpathogenic. Only some normal flora Gram-positive bacteria show partial resistance to bactericidal effects of these PGLYRPs, which is likely an adaptation of these bacteria needed for colonizing the skin, mucous membranes, or the intestine, where PGLYRP-3 and PGLYRP-4 are produced, as discussed previously (10, 11). PGLYRPs are bacteriostatic for these normal flora bacteria, and this bacteriostatic effect may prevent the overgrowth of normal flora bacteria on skin and mucous membranes.

Bactericidal activity of PGLYRP-1, PGLYRP-3, and PGLYRP-4 for both Gram-positive and Gram-negative bacteria is likely to be a general characteristic of these PGLYRPs in all mammals because their sequences are highly conserved, because they show similar patterns of expression, and because a bovine PGLYRP-1 ortholog has been already shown to kill both Gram-positive and Gram-negative bacteria (14, 15). Although Zn²⁺ was not used in the purification or bactericidal assay of bovine PGLYRP-1, this was a native (not recombinant) protein purified from the leukocyte granules, and it probably retained Zn²⁺ that was likely bound to it in vivo. Consistent with our results on human PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP3:4, bactericidal activity of bovine PGLYRP-1 for Gram-negative bacteria was also inhibited by Ca²⁺ (15).

We have also demonstrated that human PGLYRPs synergistically kill both Gram-positive and Gram-negative bacteria together with antibacterial peptides, such as PLA₂ and - and -defensins, when both compounds are present at subbactericidal concentrations. This synergism is likely to greatly enhance antibacterial defenses in vivo because both PGLYRPs and antibacterial peptides are found in the same locations in the body, such as PMN granules (PGLYRP-1, PLA₂, defensins, and BPI), skin (PGLYRP-3, PGLYRP-4, and defensins), eyes (PGLYRP-3, PGLYRP-4, and PLA₂), and oral cavity and intestinal tract (PGLYRP-3, PGLYRP-4, PLA₂, and defensins) (3, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22).

The mechanism of bacterial killing by PGLYRPs seems to be unique and different from other known antibacterial agents. PGLYRPs do not permeabilize cytoplasmic membranes, which is the main mechanism of killing by antibacterial peptides, such as defensins or PLA₂ (16, 17, 18, 19, 20, 21, 22). PGLYRPs also likely do not kill bacteria by hydrolyzing peptidoglycan because peptidoglycan-hydrolytic activity of PGLYRP-1, PGLYRP-3, and PGLYRP-4 could not be demonstrated (6, 10), and because treatment of bacteria with peptidoglycan-lytic enzymes results in osmotic lysis of bacteria, which causes rapid membrane permeabilization that is prevented in hyperosmotic medium (10). Such membrane permeabilization is not observed in bacteria treated with PGLYRPs (Ref. 10 and this article). If PGLYRPs kill bacteria by hydrolysis of peptidoglycan, the rate of hydrolysis would have to be very slow, still not noticeable after 6 h of exposure of bacteria to PGLYRPs. In our experiments, E. coli cell membrane was still not permeabilized after 6 h of incubation with PGLYRPs (Fig. 6), and if peptidoglycan was hydrolyzed, this would have resulted in osmotic lysis of bacteria and membrane permeabilization. Therefore, to kill bacteria, such a slow peptidoglycan hydrolysis would have to be coupled with essentially irreversible binding of PGLYRPs to bacterial cell wall, which would result in delayed, rather than immediate killing of bacteria. Long exposure of bacteria to bovine PGLYRP-1 did result in bacterial lysis, but it was concluded that bacterial lysis was not required and was not responsible for bacterial killing because bacteriolytic activity of bovine PGLYRP-1 was heat labile, and bactericidal activity was heat stable (15).

Measuring killing by colony counts on plates does not indicate that at the time of bacterial dilution and plating the bacteria are dead; it only indicates that at the time of plating the cidal effect is irreversible—bacteria may die hours later or may be simply unable to divide and form a colony. Many bactericidal antibiotics (-lactams, aminglycosides, etc.) have a similar effect—they irreversibly bind to their target, but bacteria actually die later, when they are unable to grow or divide. For this reason, in ampicillin-treated E. coli by 5 h of exposure, the cell membrane was beginning to be permeabilized indicating osmotic lysis of growing bacteria (Fig. 6). The kinetics of killing and membrane permeabilization of Gram-positive bacteria by penicillin and PGLYRPs were similar, and the killing of Gram-positive bacteria by both compounds was prevented in hyperosmotic medium (10). Killing of ampicillin-treated E. coli was prevented in hyperosmotic medium, as expected (Fig. 6), which reflects the ability of E. coli (similar to S. aureus in our previous experiments; Ref. 10) to resynthesize the transpeptidases irreversibly inactivated by ampicillin (after diluting and plating the bacteria in hyperosmotic medium). However, killing of E. coli by PGLYRPs was not prevented in hyperosmotic medium (Fig. 6), similar to the combined killing effect of PGLYRPs and lysostaphin on S. aureus (Fig. 5 in Ref. 10).

Peptidoglycan is a polymer of (1-4)-linked N-acetylglucosamine and N-acetylmuramic acid (MurNAc) cross-linked by short peptides containing alternating L-and D-amino acids (3). Each PGRP domain has a ligand-binding groove that binds peptidoglycan through its MurNAc-tripeptide or MurNAc-pentapeptide (56, 57, 58, 59, 60, 61, 62). Binding of mammalian PGLYRPs to peptidoglycan is likely involved in bactericidal activity of these PGLYRPs because exogenously added peptidoglycan inhibits bactericidal activity of PGLYRPs for Gram-positive bacteria (10). However, killing of Gram-negative bacteria by PGLYRPs likely involves an additional step because, in Gram-negative bacteria, peptidoglycan is not exposed on the cell surface since it is located underneath the LPS-containing outer membrane. Killing of Gram-negative bacteria likely involves initial binding of PGLYRPs to the outer membrane because killing of Gram-negative bacteria by bovine PGLYRP-1 (15) and by human PGLYRP-1, PGLYRP-3, and PGLYRP-4 (M. Wang and R. Dziarski, unpublished results) is inhibited by LPS. In Gram-positive bacteria, the initial binding of PGLYRPs to bacteria may involve lipoteichoic acid (LTA), in addition to peptidoglycan, because LTA also inhibits killing of bacteria by bovine PGLYRP-1 (15) and human PGLYRPs, although to a lesser extent than peptidoglycan (M. Wang and R. Dziarski, unpublished results). LTA and LPS bind to PGLYRPs (in addition to peptidoglycan) (10, 12, 15), but the location of LPS- and LTA-binding sites in PGLYRPs is unknown. These sites may be outside the peptidoglycan-binding groove, as suggested by the recently shown binding of ligands outside the peptidoglycan-binding groove in Drosophila PGRP-LE and PGRP-LC (62, 63). In addition, PGRPs have a hydrophobic domain on the opposite side of the molecule from the peptidoglycan-binding groove, which was previously hypothesized to interact with signal transduction molecules in insects (56). In mammalian PGLYRPs, however, this hydrophobic domain may play a role in interaction of PGLYRPs with bacteria. Analogous situation is found in bacteriophage amidases, which lyse peptidoglycan and allow bacteriophages to be released from bacteria. One portion of a bacteriophage amidase is the binding domain specific for a cell wall component often different from peptidoglycan (e.g., choline in pneumococcal cell wall teichoic acid), whereas another portion contains the peptidoglycan-lytic amidase domain (64, 65).

Moreover, binding of PGRPs to bacteria may involve multiple interactions because both human and insect PGRPs use a dual recognition strategy of binding to both MurNAc-pentapeptide and to the peptide cross-bridge (60). Such binding requires interaction of at least two PGRP domains with peptidoglycan. This dual recognition could be accomplished by PGRPs with two PGRP domains and/or by dimeric PGRPs. PGLYRP-1 has one PGRP domain, but it forms disulfide-linked dimers (10), whereas each molecule of PGLYRP-3 and PGLYRP-4 contains two PGRP domains, which are not identical. Moreover, PGLYRP-3 and PGLYRP-4 form homo- or heterodimers (10). Thus, PGLYRP-1 dimers have two identical PGRP domains, whereas PGLYRP-3 and PGLYRP-4 homodimers have two pairs of identical PGRP domains, and PGLYRP3:4 heterodimers have four different PGRP domains. Therefore, two different PGRP domains and formation of homo- and heterodimers afford PGLYRPs with considerable diversity of specificities and allow highly avid binding to bacteria through interaction with multiple bacterial components. This avid binding may be responsible for the irreversible bactericidal effect of mammalian PGLYRPs.

In conclusion, our results demonstrate that human PGLYRPs are a novel class of innate immunity pattern recognition and effector molecules with Zn²⁺-dependent broad spectrum bactericidal activity against both Gram-positive and Gram-negative bacteria. At low subbactericidal concentrations, PGLYRPs kill bacteria synergistically with antibacterial peptides, such as PLA₂ and defensins.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by U.S. Public Health Service Grants AI28797 and AI56395 from the National Institutes of Health.

² Address correspondence and reprint requests to Dr. Roman Dziarski, Indiana University School of Medicine, Northwest Campus, 3400 Broadway, Gary, IN 46408. E-mail address: rdziar{at}iun.edu

³ Abbreviations used in this paper: PGRP or PGLYRP, peptidoglycan recognition proteins; BPI, bactericidal permeability-increasing protein; HBD-3, human -defensin-3; HNP-1, human neutrophil protein-1 (-defensin); LTA, lipoteichoic acid; MurNAc, N-acetylmuramic acid; LB, Luria-Bertani; PLA₂, group IIA phospholipase A₂.

Received for publication October 11, 2006. Accepted for publication December 14, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Kang, D., G. Liu, A. Lundstrom, E. Gelius, H. Steiner. 1998. A peptidoglycan recognition protein in innate immunity conserved from insects to mammals. Proc. Natl. Acad. Sci. USA 95: 10078-10082. [Abstract/Free Full Text]
2. Werner, T., G. Liu, D. Kang, S. Ekengren, H. Steiner, D. Hultmark. 2000. A family of peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 97: 13772-13777. [Abstract/Free Full Text]
3. Dziarski, R., D. Gupta. 2006. The peptidoglycan recognition proteins (PGRPs). Genome Biol. 7: 1-13. 232.
4. Liu, C., Z. Xu, D. Gupta, R. Dziarski. 2001. Peptidoglycan recognition proteins: a novel family of four human innate immunity pattern recognition molecules. J. Biol. Chem. 276: 34686-34694. [Abstract/Free Full Text]
5. Gelius, E., C. Persson, J. Karlsson, H. Steiner. 2003. A mammalian peptidoglycan recognition protein with N-acetylmuramoyl-L-alanine amidase activity. Biochem. Biophys. Res. Commun. 306: 988-994. [Medline]
6. Wang, Z. M., X. Li, R. R. Cocklin, M. Wang, M. Wang, K. Fukase, S. Inamura, S. Kusumoto, D. Gupta, R. Dziarski. 2003. Human peptidoglycan recognition protein-L is an N-acetylmuramoyl-L-alanine amidase. J. Biol. Chem. 278: 49044-49052. [Abstract/Free Full Text]
7. Zhang, Y., L. van der Fits, J. S. Voerman, M. J. Melief, J. D. Laman, M. Wang, H. Wang, M. Wang, X. Li, C. D. Walls, et al 2005. Identification of serum N-acetylmuramoyl-L-alanine amidase as liver peptidoglycan recognition protein 2. Biochim. Biophys. Acta 1752: 34-46. [Medline]
8. Wang, H., D. Gupta, X. Li, R. Dziarski. 2005. Peptidoglycan recognition protein 2 (N-acetylmuramoyl-L-ala amidase) is induced in keratinocytes by bacteria through p38 kinase pathway. Infect. Immun. 73: 7216-7225. [Abstract/Free Full Text]
9. Li, X., S. Wang, H. Wang, D. Gupta. 2006. Differential expression of peptidoglycan recognition protein 2 in the skin and liver requires different transcription factors. J. Biol. Chem. 281: 20738-20748. [Abstract/Free Full Text]
10. Lu, X., M. Wang, J. Qi, H. Wang, X. Li, D. Gupta, R. Dziarski. 2006. Peptidoglycan recognition proteins are a new class of human bactericidal proteins. J. Biol. Chem. 281: 5895-5907. [Abstract/Free Full Text]
11. Dziarski, R., D. Gupta. 2006. Mammalian PGRPs: novel antibacterial proteins. Cell. Microbiol. 8: 1056-1069.
12. Liu, C., E. Gelius, G. Liu, H. Steiner, R. Dziarski. 2000. Mammalian peptidoglycan recognition protein binds peptidoglycan with high affinity, is expressed in neutrophils, and inhibits bacterial growth. J. Biol. Chem. 275: 24490-24499. [Abstract/Free Full Text]
13. Dziarski, R., K. A. Platt, E. Gelius, H. Steiner, D. Gupta. 2003. Defect in neutrophil killing and increased susceptibility to infection with non-pathogenic Gram-positive bacteria in peptidoglycan recognition protein-S (PGRP-S)-deficient mice. Blood. 102: 689-697. [Abstract/Free Full Text]
14. Tydell, C. C., N. Yount, D. Tran, J. Yuan, M. Selsted. 2002. Isolation, characterization, and antimicrobial properties of bovine oligosaccharide-binding protein. J. Biol. Chem. 277: 19658-19664. [Abstract/Free Full Text]
15. Tydell, C. C., J. Yuan, P. Tran, M. E. Selsted. 2006. Bovine peptidoglycan recognition protein-S: antimicrobial activity, localization, secretion, and binding properties. J. Immunol. 176: 1154-1162. [Abstract/Free Full Text]
16. Ganz, T.. 2003. Defensins: antimicrobial peptides of innate immunity. Nat. Rev. Immunol. 9: 710-720.
17. Zasloff, M.. 2002. Antimicrobial peptides of multicellular organisms. Nature 415: 389-395. [Medline]
18. Harwig, S. S. L., L. Tan, X. D. Qu, Y. Cho, P. B. Eisenhauer, R. I. Lehrer. 1995. Bactericidal properties of murine intestinal phospholipase A₂. J. Clin. Invest. 95: 603-610. [Medline]
19. Weinrauch, Y., P. Elsbach, L. M. Madsen, A. Foreman, J. Weiss. 1996. The potent anti-Staphylococcus aureus activity of a sterile rabbit inflammatory fluid is due to a 14-kD phospholipase A₂. J. Clin. Invest. 97: 250-257. [Medline]
20. Koduri, R. S., J. O. Gronroos, V. J. O. Laine, C. Le Calvez, G. Lambeau, T. J. Nevalainen, M. H. Gelb. 2002. Bactericidal properties of human and murine groups I, II, V, X, and XII secreted phospholipases A₂. J. Biol. Chem. 277: 5849-5857. [Abstract/Free Full Text]
21. Qu, X. D., R. I. Lehrer. 1998. Secretory phospholipase A₂ is the principal bactericide for staphylococci and other Gram-positive bacteria in tears. Infect. Immun. 66: 2791-2797. [Abstract/Free Full Text]
22. Dziarski, R.. 2006. Innate immunity. R. Engelberg, and V. DiRita, eds. Shaechter’s Mechanisms of Microbial Disease 6 4th Ed.66-89. Lippincott, Williams & Wilkins, Philadelphia.
23. Schittek, B., R. Hipfel, B. Sauer, J. Bauer, H. Kalbacher, S. Stevanovic, M. Schirle, K. Schroeder, N. Blin, F. Meier, et al 2001. Dermcidin: a novel human antibiotic peptide secreted by sweat glands. Nat. Immunol. 2: 1133-1137. [Medline]
24. Nizet, V., T. Ohtake, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Droschner, V. Pestonjamasp, J. Piralno, K. Huttner, R. L. Gallo. 2001. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 414: 454-457. [Medline]
25. Harder, J., J. M. Schroder. 2002. RNase 7, a novel innate immune defense antimicrobial protein of human healthy skin. J. Biol. Chem. 277: 46779-46784. [Abstract/Free Full Text]
26. Glaser, R., J. Harder, H. Lange, J. Bartels, E. Christophers, J. M. Schroder. 2005. Antimicrobial psoriasin (S100A7) protects human skin from Escherichia coli infection. Nat. Immunol. 6: 57-64. [Medline]
27. Murthy, A. R., R. I. Lehrer, S. S. Harwig, K. T. Miyasaki. 1993. In vitro candidastatic properties of the human neutrophil calprotectin complex. J. Immunol. 151: 6291-6301. [Abstract]
28. Clohessy, P. A., B. E. Golden. 1995. Calprotectin-mediated zinc chelation as a biostatic mechanism in host defence. Scand. J. Immunol. 42: 551-556. [Medline]
29. Sohnle, P. G., B. L. Hahn, V. Santhanagopalan. 1996. Inhibition of Candida albicans growth by calprotectin in the absence of direct contact with the organisms. J. Infect. Dis. 174: 1369-1372. [Medline]
30. C. Lentner, ed. In Geigy Scientific Tables Vol. 1: 1981 Ciba-Geigy, Basel.
31. Prasad, A. S.. 1995. Zinc: an overview. Nutrition 11: 93-99. [Medline]
32. Palmiter, R. D.. 2004. Protection against zinc toxicity by metallothionein and zinc transporter 1. Proc. Natl. Acad. Sci. USA 101: 4918-4923. [Abstract/Free Full Text]
33. Palmiter, R. D., S. D. Findley. 1995. Cloning and functional characterization of a mammalian zinc transporter that confers resistance to zinc. EMBO J. 14: 639-649. [Medline]
34. Shankar, A. H., A. S. Prasad. 1998. Zinc and immune function: the biological basis of altered resistance to infection. Am. J. Clin. Nutr. 68: 447S-463S. [Abstract]
35. Ibs, K. H., L. Rink. 2003. Zinc-altered immune function. J. Nutr. 133: 1452S-1456S. [Abstract/Free Full Text]
36. Erickson, K. L., E. A. Medina, N. E. Hubbard. 2000. Micronutrients and innate immunity. J. Infect. Dis. 182: S5-S10. [Medline]
37. Walker, C. F., R. E. Black. 2004. Zinc and the risk for infectious disease. Annu. Rev. Nutr. 24: 255-275. [Medline]
38. Fraker, P. J., L. E. King. 2004. Reprogramming of the immune system during zinc deficiency. Annu. Rev. Nutr. 24: 277-298. [Medline]
39. Brooks, W. A., M. Yunus, M. Santosham, M. A. Wahed, K. Nahar, S. Yeasmin, R. E. Black. 2004. Zinc for severe pneumonia in very young children: double-blind placebo-controlled trial. Lancet. 363: 1683-1688. [Medline]
40. Rostan, E. F., H. V. DeBuys, D. L. Madey, S. R. Pinnell. 2002. Evidence supporting zinc as an important antioxidant for skin. Int. J. Dermatol. 41: 606-611. [Medline]
41. Seilhamer, J. J., W. Pruzanski, P. Vadas, S. Plant, J. A. Miller, J. Kloss, L. K. Johnson. 1989. Cloning and recombinant expression of phospholipase A₂ present in rheumatic arthritic synovial fluid. J. Biol. Chem. 264: 5335-5338. [Abstract/Free Full Text]
42. Cross, A., L. Asher, M. Seguin, L. Yuan, N. Kelly, C. Hammack, J. Sadoff, P. Gemski. 1995. The importance of a lipopolysaccharide-initiated, cytokine-mediated host defense mechanism in mice against extraintestinally invasive Escherichia coli. J. Clin. Invest. 96: 676-686. [Medline]
43. Lessard, I. A., C. T. Walsh. 1999. VanX, a bacterial D-alanyl-D-alanine dipeptidase: resistance, immunity, or survival function?. Proc. Natl. Acad. Sci. USA 96: 11028-11032. [Abstract/Free Full Text]
44. Labischinski, H., P. Giesbrecht, E. Fischer, G. Barnickel, H. Bradaczek, J. M. Frere, C. Houssier, P. Charlier, O. Dideberg, J. M. Ghuysen. 1984. Study of the Zn-containing DD-carboxypeptidase of Streptomyces albus G by small-angle X-ray scattering in solution. Eur. J. Biochem. 138: 83-87. [Medline]
45. Trayer, H. R., C. E. Buckley, III. 1970. Molecular properties of lysostaphin, a bacteriolytic agent specific for Staphylococcus aureus. J. Biol. Chem. 245: 4842-4846. [Abstract/Free Full Text]
46. Blair, D. E., A. W. Schuttelkopf, J. I. MacRae, D. M. F. van Aalten. 2005. Structure and metal-dependent mechanism of peptidoglycan deacetylase, a streptococcal virulence factor. Proc. Natl. Acad. Sci. USA 102: 15429-15434. [Abstract/Free Full Text]
47. Schlievert, P., W. Johnson, R. P. Galask. 1976. Isolation of a low-molecular-weight antibacterial system from human amniotic fluid. Infect. Immun. 14: 1156-1166. [Abstract/Free Full Text]
48. LaForce, F. M., D. S. Boose. 1984. Effect of zinc and phosphate on an antibacterial peptide isolated from lung lavage. Infect. Immun. 45: 692-696. [Abstract/Free Full Text]
49. Brogden, K. A., A. J. De Lucca, J. Bland, S. Elliott. 1996. Isolation of an ovine pulmonary surfactant-associated anionic peptide bactericidal for Pasteurella haemolytica. Proc. Natl. Acad. Sci. USA 93: 412-416. [Abstract/Free Full Text]
50. Grogan, J., C. J. McKnight, R. F. Troxler, F. G. Oppenheim. 2001. Zinc and copper bind to unique sites of histatin 5. FEBS Lett. 491: 76-80. [Medline]
51. Cole, A. M., Y. H. Kim, S. Tahk, T. Hong, P. Weis, A. J. Waring, T. Ganz. 2001. Calcitermin, a novel antimicrobial peptide isolated from human airway secretions. FEBS Lett. 504: 5-10. [Medline]
52. Dashper, S. G., N. M. O’Brien-Simpson, K. J. Cross, R. A. Paolini, B. Hoffmann, D. V. Catmull, M. Malkoski, E. C. Reynolds. 2005. Divalent metal cations increase the activity of the antimicrobial peptide kappacin. Antimicrob. Agents Chemother. 49: 2322-2328. [Abstract/Free Full Text]
53. Stroncek, D. F., R. A. Shankar, K. M. Skubitz. 2005. The subcellular distribution of myeloid-related protein 8 (MRP8) and MRP14 in human neutrophils. J. Transl. Med. 3: 36[Medline]
54. Kitamura, H., H. Morikawa, H. Kamon, M. Iguchi, S. Hojyo, T. Fukada, S. Yamashita, T. Kaisho, S. Akira, M. Murakami, T. Hirano. 2006. Toll-like receptor-mediated regulation of zinc homeostasis influences dendritic cell function. Nat. Immunol. 7: 971-977. [Medline]
55. Mellroth, P., J. Karlsson, H. Steiner. 2003. A scavenger function for a Drosophila peptidoglycan recognition protein. J. Biol. Chem. 278: 7059-7064. [Abstract/Free Full Text]
56. Kim, M. S., M. Byun, B. H. Oh. 2003. Crystal structure of peptidoglycan recognition protein LB from Drosophila melanogaster. Nat. Immunol. 4: 787-793. [Medline]
57. Guan, R., A. Roychowdhury, B. Ember, S. Kumar, G.-J. Boons, R. A. Mariuzza. 2004. Structural basis for peptidoglycan binding by peptidoglycan recognition proteins. Proc. Natl. Acad. Sci. USA 101: 17168-17173. [Abstract/Free Full Text]
58. Chang, C. I., S. Pili-Floury, M. Herve, C. Parquet, Y. Chelliah, B. Lemaitre, D. Mengin-Lecreulx, J. Deisenhofer. 2004. A Drosophila pattern recognition receptor contains a peptidoglycan docking groove and unusual L,D-carboxypeptidase activity. PLoS Biol. 2: 1293-1302.
59. Kumar, S., A. Roychowdhury, B. Ember, Q. Wang, R. Guan, R. A. Mariuzza, G. J. Boons. 2005. Selective recognition of synthetic lysine and meso-diaminopimelic acid-type peptidoglycan fragments by human peptidoglycan recognition proteins I and S. J. Biol. Chem. 280: 37005-37012. [Abstract/Free Full Text]
60. Swaminathan, C. P., P. H. Brown, A. Roychowdhury, Q. Wang, R. Guan, N. Silverman, W. E. Goldman, G. J. Boons, R. A. Mariuzza. 2006. Dual strategies for peptidoglycan discrimination by peptidoglycan recognition proteins (PGRPs). Proc. Natl. Acad. Sci. USA 103: 684-689. [Abstract/Free Full Text]
61. Guan, R., P. H. Brown, C. P. Swaminathan, A. Roychowdhury, G. J. Boons, R. A. Mariuzza. 2006. Crystal structure of human peptidoglycan recognition protein I bound to a muramyl pentapeptide from Gram-positive bacteria. Protein Sci. 15: 1199-1206. [Medline]
62. Chang, C. I., Y. Chelliah, D. Borek, D. Mengin-Lecreulx, J. Deisenhofer. 2006. Structure of tracheal cytotoxin in complex with a heterodimeric pattern-recognition receptor. Science 311: 1761-1764. [Abstract/Free Full Text]
63. Lim, J. H., M. S. Kim, H. E. Kim, T. Yano, Y. Oshima, K. Aggarwal, W. E. Goldman, N. Silverman, S. Kurata, B.-H. Oh. 2006. Structural basis for preferential recognition of diaminopimelic acid-type peptidoglycan by a subset of peptidoglycan-recognition proteins. J. Biol. Chem. 281: 8286-8295. [Abstract/Free Full Text]
64. Garcia, P., A. C. Martin, R. Lopez. 1997. Bacteriophages of Streptococcus pneumoniae: a molecular approach. Microb. Drug Resist. 3: 165-176. [Medline]
65. Loeffler, J. M., D. Nelson, V. A. Fischetti. 2001. Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase. Science 294: 2170-2172. [Abstract/Free Full Text]

This article has been cited by other articles:

				P. C. F. Oyston, M. A. Fox, S. J. Richards, and G. C. Clark Novel peptide therapeutics for treatment of infections J. Med. Microbiol., August 1, 2009; 58(8): 977 - 987. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, M. Articles by Dziarski, R. Search for Related Content PubMed PubMed Citation Articles by Wang, M. Articles by Dziarski, R.