|
|
||||||||

,


,
,¶
,
* Transplantation Biology Program,
Department of Surgery,
Department of Immunology,
Department of Biochemistry and Molecular Biology, and
¶ Department of Pediatrics, Mayo Clinic College of Medicine, Rochester, MN 55905
| Abstract |
|---|
|
|
|---|
diversity <1% that of wild-type mice and quasimonoclonal (QM) mice with oligoclonal B cells and TCR V
diversity 7% that of wild-type mice. Despite having a TCR repertoire contracted >99% and defective lymphoid organogenesis, JH/ mice rejected H-Y-incompatible skin grafts as rapidly as wild-type mice. JH/ mice exhibited T cell priming by peptide and delayed-type hypersensitivity, although these responses were less than normal owing either to TCR repertoire contraction or defective lymphoid organogenesis. QM mice with TCR diversity contracted >90%, and normal lymphoid organs rejected H-Y incompatible skin grafts as rapidly as wild type mice and exhibited normal T cell priming and normal delayed-type hypersensitivity reactions. QM mice also resisted Pneumocystis murina like wild-type mice. Thus, cell-mediated immunity can function normally despite contractions of TCR diversity >90% and possibly >99%. | Introduction |
|---|
|
|
|---|
However, the concept that TCR diversity determines the competence of cell-mediated immunity does not explain every aspect of immune physiology. Although the TCR repertoire contracts profoundly with age (14) and elderly individuals can suffer disseminated viral infections and heightened susceptibility to tumors, most elderly individuals experience neither of these ailments (compared with those who have AIDS). Still more dramatic is the observation that those who undergo cardiac transplantation in infancy and have a profound contraction of the TCR repertoire owing to "total" thymectomy and mature T cell depletion suffer no excess of opportunistic infections or tumors (15).
We asked whether and to what extent defects in TCR diversity impair cell-mediated immunity. Toward this end, we exploited mice that, owing to defects in the assembly of Ig genes (16, 17), have profoundly contracted TCR repertoires. Our results indicate that extreme contractions of TCR repertoire do not impair cell-mediated immunity and host defense. These unexpected results have profound implications for transplantation and in the treatment of immune deficiencies.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were purchased from The Jackson Laboratory. B cell-deficient strains of mice used included JH/ mice, obtained by gene-targeted deletion of the JH segments (17), and quasimonoclonal (QM)3 mice, generated by gene-targeted replacement of the endogenous JH elements with a VDJ rearranged region from a 4-hydroxy-3-nitrophenylacetate-specific hybridoma (16). The JH/ mice lack mature B cells and Ig (17). QM mice have 80% of B cells that are 4-hydroxy-3-nitrophenylacetate specific (16). Monoclonal B cell-T cell mice have monoclonal B and T cell compartments; the T cells express an 
DO 11.10 transgenic cell receptor restricted to MHC class IIb (11). JH/ and QM mice were bred and all mice were housed in a specific pathogen-free facility at the Mayo Clinic. All mice were between 6 and 18 wk of age, and all experiments were conducted in accordance with protocols approved by the Mayo Clinic Institutional Animal Care and Use Committee.
Determination of TCR V
diversity
Isolation of RNA. Spleens harvested from mice were placed in RPMI 1640 and pushed through a 70-µm cell strainer. Leukocytes were isolated by Ficoll-Paque (Amersham Biosciences) gradient. Total RNA was obtained with an RNeasy kit (Qiagen) per the manufacturers instructions.
Generation of diversity standards. Diversity standards were prepared by generating oligonucleotide mixtures of known diversity, as previously described (18). For example, to generate an oligonucleotide sequence with diversity of 106, 18-mer oligonucleotides were synthesized with 10 sites of random assignment generating 410 or 1,040,526 different oligomers. Similarly, we created oligomer mixtures with 1, 103 and 109 variants. Oligonucleotides were biotin-labeled and hybridized to the gene chips as explained below.
Generation of lymphocyte receptor-specific cRNA.
First strand cDNA was obtained by reverse transcription with a mouse TCR C
reverse primer, T7 plus C
(5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTTGGGTGGAGTCACATTTCTC-3'). Second strand synthesis and preparation of biotin-labeled cRNA was conducted according to Affymetrix standard protocols.
Application of cRNA to the gene chip. Equal amounts of cRNA from different samples and diversity standards were hybridized to U133B gene chips (Affymetrix). Gene chips were processed at the Microarray Core Facility, Mayo Clinic, Rochester, MN.
Data analysis. Raw data corresponding to oligo location and hybridization intensity were obtained. The number of oligo locations with intensity above background (i.e., number of hits) was summed. A standard curve was generated by hybridizing samples with known numbers of different oligomers. Diversity of the test samples was estimated by comparison with the standard curve.
CDR3 size spectratyping of TCR V
(19)
PCR primers.
Primers were synthesized by Mayo Molecular Biology Core Facility. Two C
primers were designed to be homologous to the 3' end of the constant region of the
-TCR for the initial RT-PCR and a second nested constant region primer near the 5' end of the constant region was end labeled with WellRED D4 fluorescent dye for detection on a CEQ 8000 DNA fragment analyzer (Beckman Coulter). Twenty-four V
specific primers were synthesized to distinguish individual V
genes (20).
cDNA production.
cDNA was produced using a C
constant region primer in a RT-PCR amplification. The reverse transcriptase reaction was performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) by incubating heat-denatured RNA template and the constant region primer (Nest I) at 37°C for 40 min and 42°C for 20 min followed by a heat-deactivating incubation at 100°C for 5 min. The final reaction concentrations contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.25 mM MgCl2, and 0.25 mM dNTP in a final volume of 5 µl per reaction.
cDNA amplification.
Following cDNA synthesis, provision for a subsequent "hot-start" PCR was made by adding an AmpliWax PCR Gem 100 tablet (PerkinElmer) to each tube before incubation in the cycler at 100° for 5 min. This incubation inactivates the Moloney murine leukemia virus reverse transcriptase and melts the wax tablet. After removing the tubes from the cycler, the wax layer was allowed to set for 1 min and an upper PCR mix was added. This layer consisted of 5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 pmol of a specific V
variable region primer, and 0.5 U of Taq polymerase (Promega) in a final volume of 20 µl. PCR cycling parameters were one cycle of denaturation at 94° for 5 min, annealing at 56° for 30 s, and extension at 72° for 1 min followed by 29 cycles with denaturation at 94° for 40 s and the same annealing and extension parameters. A final extension was conducted at 7° for 5 min.
Second nested PCR for labeling.
A second nested PCR was performed to label the products from the first amplification reaction. One microliter of the first PCR was used as template for the second reaction. The same specific V
variable region primers were used and a nested constant region primer (GAGGGTAGCCTTTTGTTTGT) with a fluorescent tag, WellRED D4 (Proligo), for detection on a Beckman CEQ 8000 DNA fragment analyzer for all reaction products. This reaction consisted of 5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 pmol of a specific V
variable region primer, and 0.6 U of Taq polymerase in a final volume of 25 µl. PCR cycling parameters were one cycle of denaturation at 94° for 2 min, annealing at 56° for 30 s, and extension at 72° for 1 min followed by 29 cycles with denaturation at 94° for 40 s and the same annealing and extension parameters. A final extension was conducted at 72° for 5 min. Data acquisition and peak detection were handled by the manufacturers supplied software for the CEQ 8000 (Beckman Coulter).
TCR V
gene sequencing.
Total RNA was isolated from splenocytes of C57BL/6, QM, and JH/ mice with an RNeasy mini kit (Qiagen). cDNA was obtained by reverse transcription with a ThermoScript RT-PCR system (Invitrogen Life Technologies). Amplification of V
sequences were done using 10 pmol of the V
8.1 specific (forward) primer (CATTACT CATATGTCGCTGAC), 10 pmol of the C
(reverse) primer (GAGAC CTTGGGTGGAGTCAC), and 1.25 U of PfuTurbo DNA polymerase (Stratagene) in 50 µl. PCR conditions were 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min followed by a final extension at 72°C for 7 min. The presence of a PCR product was detected by visualizing the appropriate size bands on 1.5% agarose following gel electrophoresis. The PCR products were cloned using TOPO TA cloning (Invitrogen Life Technologies). Sequencing was performed at the Mayo Clinic Molecular Biology Core Facility using an M13 (forward and reverse) primer. Analysis of the sequences was done with Sequencher software (Gene Codes Inc.), and the sequences were aligned using the software provided by the international information system of ImMunoGeneTics, IMGT (M.-P. Lefranc, Montpellier, France; http://imgt.cines.fr) (21, 22).
The following is a list of the specific V
variable primers used and their sequences (5' to 3') with the IMGT nomenclature according to Bosc and Lefranc (21) in parentheses: V
1 (IMGT V
5), CTGAATGCCCAGACAGCTCCAAGC; V
2 (IMGT V
1), CAAAGAGGTCAAATCTCTTCCCGGTG; V
3 (IMGT V
26), GTTCTTCAGCAAATAGACATCACTG; V
4 (IMGT V
2), CTTATGGACAATCAGACTGCCTCA; V
5.1 (IMGT V
12-2), CATTATGATAAAATGGAGAGAGAT; V
5.2 (IMGT V
12-1), AAGGTGGAGAGAGACAAAGGATTC; V
5.3 (IMGT V
12-3), AGAAAGGAAACCTGCCTGGTT; V
6 (IMGT V
19), TCAATAACTGAAAACGATCTT; V
7 (IMGT V
29), TACGATGTTGATAGTACCAGCG; V
8.1 (IMGT V
13-3), CATTACTCATATGTCGCTGAC; V
8.2 (IMGT V
13-2), CATTATTCATATGGTGCTGGC; V
8.3 (IMGT V
13-1), TGCTGGCAACCTTCGAATAGGA; V
9 (IMGT V
17), ATGATAAGATTTTGAACAGGGA; V
10 (IMGT V
4), GCAATCCATTGTAAACGAAACAG; V
11 (IMGT V
16), CAAGCTCCTATAGATGATTCAGGG; V
12 (IMGT V
15), AAGTCTCTTATGGAAGATGGTGG; V
13 (IMGT V
14), TCCTCTATAACAGTTGCCCTCG; V
14 (IMGT V
31), TGTTGGCCAGGTAGAGTCGGTGCAA; V
15 (IMGT V
20), GCACTTTCTACTGTGAACTCAGC; V
16 (IMGT V
3), GGTAAAGTCATGGAGAAGTCTAAAC; V
17 (IMGT V
1), AGAGATTCTCAGCTAAGTGTTCCTCG; V
18 (IMGT V
30), CAGCCGGCCAAACCTAACATTCTC; V
19 (IMGT V
121), CTGCTAAGAAACCATGTACCA; and V
20 (IMGT V
23), TCTGCAGCCTGGGAATCAGAA.
Fluorescence activated cell sorting analysis
Splenocytes were obtained by pushing minced spleen tissue through a 0.70-µm mesh followed by hemolysis in an NH4Cl lysis buffer. The total number of splenocytes was determined using a Neubauer chamber. Cells were stained with one, two or three of the following mAbs (all the Abs were from BD Pharmingen) as described (16): FITC-conjugated rat anti-mouse CD4 (clone GK1.5), rat anti-mouse CD8
(clone Ly-2), and rat anti-mouse CD19 (clone 1D3); PE-conjugated rat anti-mouse CD8
(clone 53-6.7) and rat anti-mouse CD44 (Pgp-1, Ly-24); and biotin-conjugated rat anti-mouse CD62L (LECAM-1, Ly22) and rat anti-mouse CD3
(clone 145-2C11). PE-conjugated anti-mouse Forkhead box P3 (clone FJK-16S) was bought from eBioscience. Lymphocytes were gated on the light scatter plot by back gating onto CD4+CD3+ and CD8+CD3+ cells; numbers of the splenocytes in the subpopulations were determined by multiplying their total number by the percentage as defined by gating on the FACS plot. Data were collected on a FACScalibur (BD Biosciences) and analyzed with CellQuest software (BD Biosciences).
T cell priming to Pan DR reactive epitope (PADRE) peptide
Age-matched B6 mice were injected subcutaneously with the 140-µg PADRE peptide aK(X)VAAWTLKAAa, where "a" is alanine and X is cyclohexylalanine (23) in PBS. Three weeks later, CD4+ Th cells were purified from draining lymph node and spleens and cultured with dendritic cells isolated according to Kodaira et al. (24) and matured by incubation with LPS (from Escherichia coli 0111:B4; Sigma-Aldrich) at 5 µg/ml overnight in the presence of PADRE (35 µg/ml) for 5 days. Data represent the mean counts per minute of three wells ± SE in one representative experiment.
Delayed-type hypersensitivity assay
Mice were primed by the injection of 100 µg of OVA subcutaneously and challenged by intradermal injection of 20 µg of OVA in the footpad 6 days after priming. Nonprimed mice controls were included. Effective swelling was indicated by the difference in thickness measured with a caliper between Ag-injected footpad and a PBS-injected footpad. Responses were recorded at 24, 36, and 60 h.
T cell proliferation assay
Isolated CD4+ T cells from age-matched (B6, QM, and JH/) ware cultured in a 96-well plate coated with anti-CD3 (clone H57-597) (in three different concentrations: 0.2, 1, and 10 µg/ml) in the presence of anti-CD28 at 10 µg/ml for 48 h. Alternatively, T cells were cultured with Con A (BD Biosciences) (in three different concentrations (ConA to medium):
1/20, 1/10, and 1/5) in the presence of anti-CD28 at 10 µg/ml for 48 h. Proliferation was measured by [3H]thymidine incorporation. Data represent the mean counts per minute of three wells ± SE in one representative experiment.
Skin grafts
Skin grafts were performed according to a modified technique of Billingham et al. (25). Briefly, full thickness tail skin (0.5 x 0.5 cm) was grafted onto the lateral flank. Grafts were observed daily after removal of the bandage at day 8. Grafts were considered rejected when 90% or more of the graft lacked any viable signs (hair, pigment, and scale pattern). All mice were grafted between 6 and 18 wk after birth. Re-transplants were performed 1620 wk after the primary graft was shed.
Pneumocystis murina infection and assessment of organismal burden
P. murina was isolated from the lungs of heavily infected, SCID mice as previously described (26). The infected lungs were aseptically minced and disaggregated in a Stomacher laboratory blender. Pneumocystis organisms were isolated by differential centrifugation, washing, and filtration through micropore filters containing 10-µm pores as previously reported (27). The organisms were resuspended in freezing medium (RPMI 1640 with glutamine containing 10% FCS and 7.5% DMSO), aliquoted, and frozen in liquid nitrogen. All mice were infected with the same frozen stock of Pneumocystis.
As described by Shellito et al. (28), inoculation was performed by inserting a 22-gauge feeding tube into the trachea of anesthetized animal, visualizing its position through the 5-mm long incision of the skin, and injecting 75 µl of Pneumocystis suspension (containing 107 organisms) followed by 300 µl of air. Control animals were injected with 75 µl of saline followed by 300 µl of air. Two weeks after the infection the mice were sacrificed and the lungs were removed and frozen until analysis for Pneumocystis burden by quantitative RT-PCR was conducted.
Quantitative RT-PCR to enumerate Pneumocystis was performed using the Bio-Rad iCycler System, SYBR Green detection software, and primers targeting the Pneumocystis large mitochondrial subunit (29). Lung DNA was isolated by phenol-chloroform extraction and ethanol precipitation and finally resuspended in Tris-EDTA buffer. Amplifications of unknown samples were compared with plasmid standards containing mouse Pneumocystis-specific mitochondrial DNA. All samples were run in triplicate.
Statistical analysis
Statistical analysis for comparison of the TCR V
diversity of groups was performed using natural log transformation of the data and subsequent one-way ANOVA. The comparison of the groups was performed by an unpaired, two-sided Students t test on the natural log transformed data. Group comparisons of the numbers of T cells in the splenocyte subpopulations were performed using the Students t test after testing the global difference with a one-way ANOVA. Comparison of skin graft survivals was performed by a log-rank test. A value of p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Competence of the T cell compartment, particularly cell-mediated immunity, is thought to depend upon the number and diversity of T cells available to respond to antigenic challenge (13). T cell diversity would seem to assure that one or more clones of T cells will bear a TCR capable of recognizing a peptide(s) from a microorganism, a toxin, or a minor histocompatibility Ag associated with self-MHCs, thus allowing the activation of rare Ag-specific T cells (30, 31, 32). To test this concept, we studied the structure of the T cell compartment and cell-mediated immunity in mice with defects in Ig assembly.
We asked whether mice with B cell defects have normal numbers of T cells. The numbers of CD3+, CD4+, or CD8+ T cells in the spleen of QM mice were not significantly changed compared with those of wild-type mice (p > 0.05), indicating that QM mice with oligoclonal B cells maintain normal numbers of T cells in the adult spleen (Fig. 1). In contrast, numbers of CD3+ or CD4+ but not CD8+ T cells were significantly decreased in JH/ mice (p < 0.05). This finding is in agreement with the observations of Ngo et al. (33), who showed reduced T cell numbers in the spleen of B cell deficient µMT mice.
|
diversity was measured according to Ogle et al. (18). In this assay, T cell diversity is proportional to the number of hybridization hits of TCR V
cRNA on a gene chip and quantified by comparison to a standard curve obtained with DNA oligomers of known diversity. TCR V
diversity of JH/ splenocytes was 1.1 x 103 per 10 µg of RNA, whereas TCR V
diversity of C57BL/6 splenocytes was 1.3 x 106 per 10 µg of RNA (p < 0.05). TCR V
diversity of QM splenocytes was intermediate, 8.8 x 104 per 10 µg of RNA (p < 0.05, compared with C57BL/6). In addition to the specificity of the primers, we assured that the assay detected TCR V
diversity and not B cell diversity, because sorted 1.5 x 107 B cells from C57BL/6 splenocytes containing 0.09% of CD3+ cells yielded a mean diversity of only 136 corresponding to 0.023% of the diversity obtained from equal number of splenocytes containing 20% of CD3 positive cells. Because QM mice are B cell and Ig proficient, our results indicate that T cell diversity in the spleen is not a function of B cell number and/or of serum Ig concentration (12) but may rather depend on the diversity of Ig in the serum and/or on the surface of B cells. T cell function in mice with contracted TCR diversity
We next tested whether T cells from mice with a contracted T cell repertoire exhibit normal functions at a cellular level. As Fig. 2 shows, T cells from JH/ and QM mice proliferated in response to anti-CD3 (Fig. 2A) or Con A (Fig. 2B), as did T cells from C57BL/6 mice. Next, we asked whether T cells in JH/ and QM mice could be primed in vivo. To this end, mice were injected with 140 µg of the PADRE peptide and 14 days later CD4+ T cells purified from the spleen were cocultured with mature dendritic cells in the presence of 35 µg/ml PADRE peptide. Fig. 3 shows that QM T cells mount robust proliferation and JH/ T cells have detectable albeit reduced proliferation (26% of QM or 27% of C57BL/6 values) to the PADRE peptide. The results indicate that 90% contraction of the TCR repertoire (in QM mice) does not impair priming of T cells and that 99% contraction, as in JH/ mice, does not preclude T cell priming.
|
|
Aberrant T cell response in JH/ mice could be due to the contraction of TCR diversity or to defective lymphoid organogenesis. We questioned whether T cells from JH/ mice respond normally to mitogens but fail to undergo priming because of defective lymphoid organogenesis. Golovkina et al. (34) showed that lack of B cells in JH/ mice causes defective peripheral lymphoid organogenesis with an absence of Peyer patches and a follicular dendritic cell network. Consistent with this possibility, Fig. 4 shows that although JH/ lymph nodes lack a follicular dendritic cell network, QM mice have a normal one, suggesting that abnormal lymph nodes rather than contracted T cell diversity in JH/ mice could contribute to defective T cell priming.
|
We next asked to which extent contraction of the T cell repertoire per se impairs cell-mediated immunity. To avoid the confounding influence of impaired lymphoid organogenesis, we addressed the question using QM mice that show nearly normal lymph nodes. First, we compared the rate of rejection of skin allografts by QM and C57BL/6 mice. The outcome of skin grafts is thought to be independent of Ab responses directed against the graft (35, 36, 37) and, hence, this test could be conducted in mice with oligoclonal B cells. The kinetics of rejection of allografts is modified in animals with defective lymphoid organogenesis (38) or T cell signaling (39) and, therefore, the assay would help exclude these problems. Table I shows that MHC-disparate skin grafts were rejected with similar kinetics by QM and wild-type recipients. This result suggests that the QM mice have functional lymph nodes and that their T cells have the capacity to function like T cells from wild-type mice.
|
|
|
|
As a further test of cell-mediated immunity, we asked whether host defense was challenged by TCR repertoire contractions. To test the impact of contracted TCR repertoire on host defense, we infected QM or C57BL/6 mice with P. murina and measured the organism burden in the lungs 2 wk later. Pneumocystis is an intracellular pathogen, the elimination of which depends on T cells; T cell-deficient mice fail to clear the agent, ultimately causing pneumonia and the death of the host (40). Fig. 7 shows that the level of Pneumocystis in the lungs of QM or C57BL/6 mice 2 wk postinfection was similar. Thus, contraction of the TCR repertoire did not compromise host defense.
|
Those with impaired cell-mediated immunity caused by AIDS or DiGeorge syndrome have both TCR diversity contractions and gaps and/or oligoclonal expansions (41). Whether these changes impair immunity is unknown. To address that question, we evaluated the TCR V
repertoire in mice with severely contracted diversity by spectratyping and sequencing.
TCR
-chain CDR3 lengths for each V
gene spectratype were generated for each of the V
genes using RNA derived from splenocytes obtained from three JH/ and three C57BL/6 mice according to Pannetier et al. (19). This analysis showed that the majority of the 24 V
genes were associated with spectratypes exhibiting Gaussian distributions. There were a limited number of exceptions as described in Fig. 8, where single peaks were over-represented against a background of normally distributed CDR3 lengths. Thus, the contracted repertoire in JH/ mice did not alter the distribution of CDR3 lengths, indicating that contraction was balanced in contrast to what is observed in immunodeficiencies such as AIDS (42, 43).
|
13-3 (IGMT designation for V
8.1) in splenocytes obtained from C57BL/6 (Table III), QM (Table IV), or JH/ mice (Table V). Tables III, IV, and V show fewer repeat sequences in QM or JH/ splenocytes compared with those of wild-type mice. Of 46 C57BL/6 sequences bearing V
13-3, 29 had different CDR3 regions, the lengths of which averaged 11.5 codons. Of 45 QM sequences bearing V
13-3, 43 had different CDR3 regions, the lengths of which averaged 11.5 codons. Of 67 JH/ sequences bearing V
13-3, 54 had different CDR3 regions, the lengths of which averaged 11.9 codons. The CDR3 lengths of sequences containing the TCR V
13-3 obtained from mice of all strains showed a Gaussian distribution, as one might expect if differences in repertoire diversity were balanced. In further support of an equilibrated contraction without oligoclonal expansions, Table VI shows that the V
sequences obtained from all of the mice used diverse J
segments. These results demonstrated that B cell-deficient mice have balanced contraction of TCR diversity and suggest that it is the gaps and oligoclonal expansions and not the repertoire contraction in itself that cause disease in immunodeficiencies such as AIDS and DiGeorge.
|
|
|
|
The normal kinetics of skin graft rejection in mice with profound contraction of the TCR repertoire suggested that the T cell compartment had "compensated" in some way. We hypothesized that such compensation might occur if T cells had proliferated to maintain the dimensions of the T cell compartment and, as a result, acquired "memory-like" functions (44, 45). To explore this possibility, we enumerated "memory-like" T cells in unmanipulated QM, JH/, or C57BL/6 mice based on phenotype (46, 47, 48, 49). Fig. 9 shows that QM mice had 3-fold and JH/ 2-fold more "memory-like" CD4+ T cells (CD4+/CD44high/CD62L) than C57BL/6 mice (p < 0.05) but similar numbers of "memory-like" CD8+ T cells. These results suggest that the T cell compartment compensates for the contraction of TCR diversity by homeostatic proliferation.
|
| Discussion |
|---|
|
|
|---|
The finding that individuals with dramatically contracted diversity of the T cell repertoire (but normal numbers of T cells) can have relatively normal cell-mediated immunity is not without precedent. We (15) have found that human subjects who undergo cardiac transplantation in infancy have profound contraction of the TCR repertoire, with diversity of V
being as low as 104 (compared with 106 in age matched controls), but do not suffer a heightened risk of disseminated viral infections or of infections with opportunistic organisms or tumors compared with other transplant recipients. In the course of cardiac transplantation (or nontransplant cardiac surgery) early in life, the thymus is removed and the recipient is treated with Thymoglobulin or anti-CD3 to deplete mature T cells. In addition, those patients subjected to thymectomy for nonimmune disease and those who are elderly (14, 15) do not suffer from the opportunistic infections seen in subjects with DiGeorge syndrome or AIDS, conditions associated with defects in TCR diversity (53). Clearly, a narrow but otherwise unperturbed repertoire of T cells can provide enough host defense for an ostensibly normal life. Adaptation of the T cell compartment following lymphopenia may in part be contributed by the adoption of "memory-like properties" (49). We would postulate that subjects with DiGeorge syndrome or AIDS have impaired host defense not because of narrowing of the repertoire of T cells but rather because of nonbalanced lacunae in the TCR repertoire or defects in T cell function that preclude adaptation to the depletion of T cells.
The work reported here takes advantage of mice in which contractions of the T cell repertoire are secondary to B cell deficiency, lack of B cells, or B cell oligoclonality. To exclude the possibility that our tests of T cell function reflected directly the properties of the B cell compartment, we measured T cell functions that are thought to be independent of B cells or Ig the rejection of skin transplants (35, 36). Our results showing that QM mice reject MHC-incompatible skin as quickly as wild-type mice indicate that the T cells and the lymphoid tissue in these mice are functionally normal, although, because of the high frequency of alloreactive T cells (
3% in C57BL/6 mice) (54), these responses indicate little about the impact of repertoire contractions. In contrast, responses to conventional peptide Ags such as minor histocompatibility Ags or OVA, which are thought to depend on responses by relatively rare T cells expressing an Ag-specific TCR (30, 31, 32), were normal in QM mice. These results indicated that that a balanced TCR repertoire contraction of at least 90% does not impair cell-mediated immunity.
Our results showing that severe contractions of the TCR repertoire do not cause increased Pneumocystis load in the lungs of QM compared with wild-type mice are consistent with maintained host defense. Because the QM mice have very reduced B cell diversity, a case could be made for the lack of specific Abs in the outcome of infection. However, B cell and Ab deficiency is thought to cause increased susceptibility to infections by these organisms rather than relative resistance. In an exemplary study, Marcotte et al. (55) reported an outbreak of Pneumocystis carinii in µMT mice that have very few B cells owing to a gene-targeted deletion of the membrane exon of IgM (56). The authors interpreted these results to indicate that B cells and Abs are important to the clearance of P. carinii. Because QM mice can produce Abs against a variety of pathogens (57) and did produce Pneumocystis-specific Abs (results not shown), our studies were not limited by deficient humoral responses.
Our studies raise the possibility that normal host defense might be restored in some conditions by promoting the "homeostatic" proliferation of certain clones even if that adaptation does not reconstitute repertoire diversity. The T cells resulting from homeostatic proliferation exhibit the phenotype and some functions of bona fide memory T cells (58, 59) and might account for the robust cellular immune responses and host defense in QM mice and in subjects thymectomized in infancy (15).
It is not necessary to invoke memory as the only mechanism of compensation. In favor of changes other than memory is the finding that the memory T cells resulting from homeostatic proliferation may not survive as long as bona fide memory T cells generated following specific Ag stimulation (58) and, thus, be most important when the generation of the latter is compromised (58). Memory-like T cells may thus work best in infancy before Ag-specific memory T cells have a chance to develop (58) and in conditions of B cell deficiency that may cause defective Ag-specific T cell memory formation. The normal functioning of the T cell compartment in humans and mice with contracted T cell repertoires might also reflect the cross-reactivity of TCR or a lesser dependence on peptide specificity than is commonly thought. Because memory T cells are functionally more cross-reactive, one may not be able distinguish the two. Regardless of what mechanism is eventually proved, our findings may inspire the design of therapies aiming at the reconstitution of cellular immunity.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants AI48602 and HL79067. ![]()
2 Address correspondence and reprint requests to Dr. Marilia Cascalho, Mayo Clinic, 200 First Street Southwest, Medical Sciences 2-75, Rochester, MN 55905. E-mail address: cascalho.marilia{at}mayo.edu ![]()
3 Abbreviations used in this paper: QM, quasimonoclonal; IGMT, ImMunoGeneTics information system; PADRE, Pan DR reactive epitope. ![]()
Received for publication July 31, 2006. Accepted for publication December 13, 2006.
| References |
|---|
|
|
|---|
transcripts in central nervous system of mice susceptible and resistant to Theilers virus-induced demyelination. J. Neuroimmunol. 47: 95-100. [Medline]
variable (TRBV), diversity (TRBD) and joining (TRBJ) genes. Exp. Clin. Immunogenet. 17: 216-228. [Medline]
repertoire among HIV-1 infected individuals before and after antiretroviral therapy. J. Clin. Immunol. 25: 116-126. [Medline]