The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, L.
Right arrow Articles by Craft, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, L.
Right arrow Articles by Craft, J.
The Journal of Immunology, 2007, 178: 2730-2736.
Copyright © 2007 by The American Association of Immunologists, Inc.

Epigenetic and Transcriptional Programs Lead to Default IFN-{gamma} Production by {gamma}{delta} T Cells1

Liang Chen2,3,*, Weifeng He2,4,*, Sean T. Kim2,{dagger}, Jian Tao*, Yunfei Gao5,*, Hongbo Chi{dagger}, Andrew M. Intlekofer{ddagger}, Bohdan Harvey*, Steven L. Reiner{ddagger}, Zhinan Yin6,*, Richard A. Flavell{dagger} and Joe Craft*,{dagger}

* Section of Rheumatology, Department of Medicine and {dagger} Section of Immunobiology, Yale School of Medicine, New Haven, Connecticut, 06520; and {ddagger} University of Pennsylvania School of Medicine, Philadelphia, PA 19104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
{gamma}{delta} T cells have unique features and functions compared with {alpha}beta T cells and have been proposed to bridge the innate and adaptive immune responses. Our earlier studies demonstrated that splenic {gamma}{delta} T cells predominantly produce IFN-{gamma} upon activation in vitro, which is partially due to the expression of the Th1-specific transcription factor T-bet. In this study we have explored the epigenetic and transcriptional programs that underlie default IFN-{gamma} production by {gamma}{delta} T cells. We show that the kinetics of IFN-{gamma} transcription is faster in {gamma}{delta} T cells compared with CD4+ and CD8+ T cells and that {gamma}{delta} T cells produce significantly greater amounts of IFN-{gamma} in a proliferation-independent manner when compared with other T cell subsets. By analyzing the methylation pattern of intron 1 of the ifn-{gamma} locus, we demonstrate that this region in naive {gamma}{delta} T cells is hypomethylated relative to the same element in naive CD4+ and CD8+ T cells. Furthermore, naive {gamma}{delta} T cells constitutively express eomesodermin (Eomes), a transcription factor important for IFN-{gamma} production in CD8+ T cells, and Eomes expression levels are enhanced upon activation. Retroviral transduction of activated {gamma}{delta} T cells from both wild-type and T-bet-deficient mice with a dominant negative form of Eomes significantly reduced IFN-{gamma} production, indicating a critical role for this transcription factor in mediating IFN-{gamma} production by {gamma}{delta} T cells in a T-bet-independent manner. Our results demonstrate that both epigenetic and transcriptional programs contribute to the early vigorous IFN-{gamma} production by {gamma}{delta} T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Manifested by their distinct functions and cytokine profiles, CD4+ {alpha}beta T cells can be differentiated into Th1 and Th2 subsets (1, 2, 3). Th1 cells secrete IFN-{gamma}, TNF-{alpha}, and IL-2 and mediate delayed type hypersensitivity as well as macrophage activation, whereas Th2 cells produce IL-4, IL-5, and IL-13, provide help to B cells, and are critical in allergic responses (4, 5, 6). In the past decade, significant progress has been made in understanding the molecular mechanisms underlying the process of CD4+ T cell differentiation and, as such, several transcription factors have been identified that contribute to lineage commitment. T-bet, a Th1-specific transcription factor, is essential for Th1 development (7). In contrast, Th2 differentiation is driven by the Th2-specific transcription factor GATA-3 (8, 9). In addition, c-Maf and NFAT are also involved in Th2 development (10, 11). More recently, it has been demonstrated that a novel T-box protein, eomesodermin (Eomes),7 controls the expression of IFN-{gamma} in CD8+ T cells (12).

Epigenetic regulation of cytokine genes also appears critical in Th development (13). We and others have shown that epigenetic changes such as histone hyperacetylation and DNA demethylation occur at cytokine loci in a lineage-specific manner (14, 15, 16). DNA demethylation, in particular, has been shown to coincide with areas of open chromatin. Consistent with these models, the treatment of T cells with the methylation inhibitor azacytidine results in a derepressed expression of IL-4 in Th1 cells (17). Likewise, a deficiency of DNA methyltransferase 1 (Dnmt1) or methyl-CpG-binding proteins alters the methylation profile of cytokine loci, disrupting the silenced state and allowing accessibility for ectopic expression (18, 19).

{gamma}{delta} T cells have unique features and functions in comparison to {alpha}beta T cells (20, 21, 22). They can exhibit Th1/Th2-like phenotypes both in vivo and in vitro (23, 24). Our earlier studies have shown that splenic {gamma}{delta} T cells are predisposed for type 1 cytokine secretion, even in the presence of IL-4 (25). Depletion of T-bet in these cells resulted in a 50% reduction in IFN-{gamma} production, and overexpression of GATA-3 failed to suppress the secretion of IFN-{gamma} (26). Nevertheless, it is not known whether other transcription factors or chromatin remodeling mechanisms contribute to IFN-{gamma} production in these cells. Given the critical role of IFN-{gamma} synthesis by {gamma}{delta} T cells in protective immune responses against certain pathogens and tumors (27, 28), it is of paramount importance to fully understand the molecular mechanisms that control their production of this cytokine.

In this study, we examined the epigenetic state of the IFN-{gamma} locus and further characterized the transcriptional mechanisms underpinning preferential IFN-{gamma} production in {gamma}{delta} T cells. Based on its DNA methylation profile, the IFN-{gamma} locus exists in a more accessible state in naive {gamma}{delta} compared with CD4+ or CD8+ T cells, which correlates with the ability of the former cells to produce IFN-{gamma} in a more rapid, cell division-independent manner. Furthermore, we show that Eomes is constitutively expressed in naive {gamma}{delta} T cells and contributes to IFN-{gamma} production in a T-bet-independent manner. These findings reveal an epigenetic basis for the biased and enhanced IFN-{gamma} production in {gamma}{delta} T cells and provide a molecular mechanism for a dual requirement of T-bet and Eomes in this lineage.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

C57BL/6J (B6) mice were purchased from the National Cancer Institute. B6 T-bet-deficient (T-bet–/–) mice were kindly provided by Dr. L. Glimcher, Harvard School of Public Health (Boston, MA), via Dr. L. Cohn, Yale School of Medicine (New Haven, CT) (7). All animals were maintained under specific pathogen-free conditions and used at 6–8 wk of age.

Reagents

Recombinant murine IL-2, IL-4, and IL-12 were purchased from R&D Systems. Anti-mouse mAbs used for phenotypic and cytokine analyses were all purchased from BD Biosciences.

Cell preparation and activation

Naive (CD62LhighCD44low) populations of CD4+, CD8+, and {gamma}{delta} T cells were sorted from splenocytes by flow cytometry. Sorted cells (2 x 105 cells/well) were cultured with plate-coated anti-CD3 (10 µg/ml) and anti-CD28 (1 µg/ml) in the presence of neutral (IL-2), Th1 (IL-12 and anti-IL-4), or Th2 (IL-4 and anti-IFN-{gamma}) priming conditions as previously described (25). At different time points, cells were collected for the analysis of gene transcription by quantitative real-time PCR (Q-PCR) as described below. Supernatants were used for the detection of IFN-{gamma} protein by ELISA.

Intracellular cytokine staining

After 4 days of culture, cells were restimulated with anti-CD3 and anti-CD28 for 6 h, with brefeldin A added for the last 3 h. Cells were fixed in 2% formaldehyde in PBS, permeabilized with 0.5% saponin, and stained with fluorescently labeled Abs against cytokines as previously described (25).

Methylation analysis

Naive populations of CD4+, CD8+, and {gamma}{delta} T cells were sorted from splenocytes, and genomic DNA from these cells was harvested by overnight proteinase K digestion in lysis buffer (50 mM Tris, 5 mM EDTA, 0.2% SDS, and 200 mM NaCl), phenol-chloroform extraction, and isopropanol precipitation as described previously (15). For bisulfite analysis, T cell DNA was treated with the CpGenome DNA modification kit according to the manufacturer’s protocol (Chemicon International). Amplicons were cloned into the TOPO TA pCR2.1 vector. Twenty to twenty-four clones were sequenced to determine the methylation pattern for each site. Primers used to amplify bisulfite-modified genomic DNA were as follows: intron 1, IFN-{gamma} (forward), 5'-GGTATAGTTATTGAAAGTTTAGAAAGTTTG-3'; intron 1, IFN-{gamma} (reverse), 5'-CAAAATTACTCCTCAAAATAAAACA ACTTC-3'.

Cell labeling

Cells were labeled with CFSE as described previously (29). Briefly, cells were washed twice with PBS and suspended in 200 µl of PBS, followed by the addition of 2 µM CFSE and 10 min of incubation at 37°C. The reaction was stopped by adding 3 ml of FBS. Cells were then washed twice with RPMI 1640 medium supplemented with 10% FBS and used for experiments as described.

Retroviral transduction

Retroviral constructs of dominant negative (DN) Eomes and empty vector were described previously (12). Retroviral transduction was performed exactly as described (26). Naive {gamma}{delta} T cells were sorted from the splenocytes of wild-type B6 or T-bet–/– mice and cultured with anti-CD3 and anti-CD28 under the culture conditions outlined previously (26). After 24 h, cells were infected with viral supernatants collected from the transfected Phoenix packaging cell line supplemented under the same cytokine conditions as on day 1. Cells were cultured with fresh medium with IL-2 on day 3 and restimulated on day 5 for intracellular cytokine staining. To analyze the effect of DN-Eomes on the methylation pattern of {gamma}{delta} T cells, DN-Eomes-transfected GFP+ and control GFP+ {gamma}{delta} T cells were sorted by flow cytometry, and sorted cells were used for DNA methylation analysis as described above.

Real-time Q-PCR

Total RNA was extracted using Qiagen RNeasy mini columns (Qiagen) following the manufacturer’s instructions and reverse transcribed using oligo(dT)18 (Invitrogen Life Technologies). Cycling conditions were 5 min at 95° followed by 40 repeated cycles of 95° for 15 s and 60° for 1 min. Two sets of primers were used for different experiments. For results described in Fig. 1, the primers and probes for IFN-{gamma} were the same those as used previously (29). beta-Actin was used as an internal control with the sense primer AGAGGGAAATCGTGCGTGAC, the antisense primer GCCACAGGATTCCATACCCAAGAAGG, and the probe 5'-FAM-CACTGCCGCATCCTCTTCCTCCC-TAMRA. For results presented in Fig. 4, the following primer and probe sets were used for sequence-specific detection (all written 5' to 3'): hypoxanthine phosphoribosyltransferase (HPRT) forward, CTCCTCAGACCGCTTTTTGC; HPRT reverse, TAACCTGGTTCATCATCGCTAATC; HPRT probe, VIC-CCGTCATGCCGACCCGCAG-TAMRA; Eomes forward, TGAATGAACCTTCCAAGACTCAGA; Eomes reverse, GGCTTGAGGCAAAGTGTTGACA; Eomes probe, 6FAM-AGAAGTTTTGAACGCCGTACCGACCTCCA-TAMRA; IFN-{gamma} forward, CATTGAAAGCCTAGAAAGTCTGAATAAC; IFN-{gamma} reverse, TGGCTCTGCAGGATTTTCATG; and IFN-{gamma} probe, 6FAM-TCACCATCCTTTTGCCAGTTCCTCCAG-TAMRA.


Figure 1
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 1. {gamma}{delta} T cells transcribe IFN-{gamma} mRNA with faster kinetics than CD4+ and CD8+ T cells. A, Naive (CD62LhighCD44low) populations of CD4+, CD8+, and {gamma}{delta} T cells were sorted from splenocytes and activated with anti-CD3 and anti-CD28 in the presence of IL-2. Cells were collected at different time points postactivation for RNA preparation and quantitative PCR analysis. Relative IFN-{gamma} mRNA levels were normalized to beta-actin, and the value at the 3-h time point was arbitrarily designated as 1. One example of three different experiments is shown. B, The level of IFN-{gamma} in the cell culture supernatants was measured by ELISA. Results are representative of three experiments.

 

Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 4. {gamma}{delta} T cells express elevated levels of both T-bet and Eomes upon activation in comparison to CD8+ T cells. Naive {gamma}{delta} and CD8+ T cells (CD62LhighCD44low) were sorted from splenocytes of wild-type B6 mice and activated as described in Fig. 1. At different time points cells were collected for RNA and cDNA preparation. mRNA levels were analyzed by Q-PCR. Values represent mean ± SEM of triplicate determinations normalized to HPRT. Levels of the test gene are expressed relative to HPRT, with the experimental value for a naive (CD44low) CD8+ T cell sample set to 1.

 
A presynthesized TaqMan gene expression assay (Applied Biosystems) was used to amplify T-bet (Tbx21). Levels of test gene are expressed relative to HPRT, with the experimental value for a naive (CD44low) CD8+ T cell sample set to 1.

Statistics

Statistical significance was evaluated by two-tailed, unpaired Student’s t test or nonparametric analysis if SD values were significantly different between the two compared groups using software InStat 2.03 for Macintosh (GraphPad Software). Throughout the text, figures, and figure legends the following terminology is used to denote statistical significance: *, p < 0.01; **, p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
{gamma}{delta} T cells transcribe IFN-{gamma} mRNA with faster kinetics than CD4+ and CD8+ T cells

We have previously observed that mouse splenic {gamma}{delta} T cells tend to produce IFN-{gamma} upon activation, even in the presence of IL-4 or a high GATA-3 expression (25, 26). To compare the kinetics of IFN-{gamma} gene transcription among CD4+, CD8+, and {gamma}{delta} T cells, Q-PCR was performed. Naive populations of these cells (CD62LhighCD44low) were sorted from B6 wild-type mice and cultured under neutral conditions (anti-CD3, anti-CD28, and IL-2). Cells were harvested at 0, 3, 6, 9, 24, and 48 h, and RNA was extracted and Q-PCR performed to compare the levels of IFN-{gamma} transcripts. {gamma}{delta} T cells transcribed IFN-{gamma} mRNA more rapidly and in higher abundance than CD4+ cells at all time points tested (Fig. 1A). Although there was little difference in the amount and kinetics of transcription between {gamma}{delta} and CD8+ T cells before 24 h, at 48 h IFN-{gamma} transcription in {gamma}{delta} T cells began to increase faster than in CD8+ cells, resulting in an ~2-fold increase at this time point. The level of IFN-{gamma} gene transcription at later time points (72 and 96 h) decreased dramatically to the basal level for both lineages of T cells (data not shown). Interestingly, the level of IFN-{gamma} production had a very similar pattern as gene transcription for both cells, with significantly higher levels of protein produced by {gamma}{delta} T cells at each time point (Fig. 1B). Our results indicate quicker kinetics of both IFN-{gamma} gene transcription and protein production in {gamma}{delta} T cells compared with CD8+ T cells.

IFN-{gamma} production in {gamma}{delta} T cells is cell division independent

Production of IFN-{gamma} in CD4+ T cells is cell division dependent, with increases in cytokine synthesis observed during successive cell cycles (17). Given the rapid kinetics of IFN-{gamma} gene transcription in {gamma}{delta} T cells, we wanted to determine whether the production of IFN-{gamma} in these cells was dependent on proliferation. To this end, naive (CD62LhighCD44low) populations of {gamma}{delta}, CD4+, and CD8+ T cells were sorted from splenocytes, labeled with CFSE, stimulated with anti-CD3 and anti-CD28 for 48 h under Th1 and Th2 conditions as previously described (25, 29), and harvested for intracellular cytokine staining. Analysis of the undivided cell peak under Th1 priming conditions revealed almost no IFN-{gamma}-producing CD4+ T cells (<0.1%) and only ~1.5% of CD8+ T cells secreting IFN-{gamma} (Fig. 2A). Surprisingly, half of the {gamma}{delta} T cells from the undivided peak were IFN-{gamma} positive (Fig. 2; 8.2 of 16.3% undivided {gamma}{delta} T cells), suggesting that initial IFN-{gamma} production in {gamma}{delta} T cells is governed by a cell cycle-independent mechanism. Consistent with our previous findings, ~13% of {gamma}{delta} T cells produced IFN-{gamma} under Th2 conditions, whereas IFN-{gamma}-positive CD4+ and CD8+ T cells were not detected (Fig. 2A; a summary of three independent experiments is shown in Fig. 2B). Our results not only recapitulated those from prior reports but also implicated an inherent, cell division-independent program for accelerated IFN-{gamma} synthesis in {gamma}{delta} T cells originating from TCR stimulation alone, even in the presence of Th2 cytokines.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 2. Cell division-independent IFN-{gamma} production in {gamma}{delta} T cells. Naive populations (CD62LhighCD44low) of {gamma}{delta}, CD4+, and CD8+ T cells were sorted from splenocytes by flow cytometry and then CFSE labeled and cultured under Th1 and Th2 conditions. After 2 days, intracellular cytokine staining was performed. A, Intracellular cytokine staining for IFN-{gamma}. Numbers in the upper right corners are percentages of IFN-{gamma}-positive cells in the undivided peak. Percentages of total IFN-{gamma}-positive cells are shown in the lower left corners. B, The percentage of IFN-{gamma} producing cells from the undivided peak (mean ± SD) from three separate experiments is shown.

 
The IFN-{gamma} locus in {gamma}{delta} T cells has increased accessibility

Given the rapid, proliferation-independent secretion of IFN-{gamma} in {gamma}{delta} T cells, we hypothesized that an epigenetic mechanism contributes to this phenomenon. Therefore, we next determined the DNA methylation status of intron 1 of the ifn-{gamma} locus, an element previously shown to coincide with a DNase hypersensitive site and to exhibit hypomethylation in NK cells (30). Bisulfite analysis showed that this entire region in both naive CD4+ and CD8+ T cells is almost completely methylated, exhibiting 90–100% methylation at nearly every CpG motif (Fig. 3). However, the same area in naive {gamma}{delta} T cells possesses a lower basal level of methylation, with only 58–72% of the CpG dinucleotides methylated (Fig. 3). These data indicate that the first intron of IFN-{gamma} exists in a more accessible state in naive {gamma}{delta} T cells compared with CD4+ and CD8+ cells and that this increased accessibility likely allows acute up-regulation of IFN-{gamma}.


Figure 3
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 3. Intron 1 region of the IFN-{gamma} locus is hypomethylated in naive {gamma}{delta} T cells. Naive (CD62LhighCD44low) populations of CD4+, CD8+ and {gamma}{delta} T cells were sorted by flow cytometry and used for the preparation of genomic DNA, which was then bisulfite modified. The intron 1 region of the ifn-{gamma} locus was PCR amplified, cloned, and sequenced. The CpG methylation pattern was determined by calculating the percentage of methylated CpG vs total CpG for each site at positions 40, 62, 69, 80, 120, 168, 195, 338, 383, and 462 relative to the first nucleotide of the intron I region.

 
Eomes is constitutively expressed in {gamma}{delta} T cells and further up-regulated upon activation

Eomes, a second newly identified T-box transcription factor expressed in T cells, is important for IFN-{gamma} production and effector function of CD8+ T cells (12). Because T-bet deficiency only resulted in a 50% reduction in IFN-{gamma} production in {gamma}{delta} T cells (26), we hypothesized that other transcription factors might contribute to IFN-{gamma} secretion in those T cells. We first asked whether Eomes was expressed in {gamma}{delta} T cells and, if so, how the kinetics of Eomes expression compared with that of CD8+ cells. A low but detectable level of Eomes was expressed in naive {gamma}{delta} T cells as well as in naive CD8+ T cells (Fig. 4, far right panel). The Eomes mRNA level in {gamma}{delta} T cells increased at 3 h after activation and reached a peak at 6 h, after which levels of expression waned (Fig. 4, far right panel). This pattern of expression was different from the expression pattern of T-bet in {gamma}{delta} T cells. In these cells, T-bet mRNA was quickly up-regulated, reaching peak levels at 3 h and then gradually declining (Fig. 4, middle panel). However, the level of IFN-{gamma} mRNA in {gamma}{delta} T cells gradually increased, reaching maximal expression at 48 h postactivation (Fig. 4, far left panel). CD8+ T cells, in contrast, had delayed expression of IFN-{gamma}, with lower levels compared with {gamma}{delta} T cells as shown in Fig. 1. These results indicate a potential role of both T-bet and Eomes in controlling IFN-{gamma} production in {gamma}{delta} T cells.

Eomes is a functional transcription factor for IFN-{gamma} production in {gamma}{delta} T cells

Based on the partial reduction in IFN-{gamma} production in T-bet–/– {gamma}{delta} T cells, we next asked whether Eomes acts as another functional transcription factor controlling IFN-{gamma} secretion. A DN form of Eomes was introduced into activated {gamma}{delta} T cells by retroviral transduction, and these cells were assayed for IFN-{gamma} production by intracellular cytokine staining. The transduction of wild-type T cells with DN-Eomes resulted in a small reduction in the percentage of IFN-{gamma}-positive cells, from 94% (27% compared with 28.6%) to 81% (36 vs 44.5%) of infected GFP-positive cells (Fig. 5A, top panels). The mean fluorescence intensity of IFN-{gamma}-positive cells was also reduced in DN-Eomes-transduced cells compared with control-transduced cells (Table 1). Consistent with our previous findings, T-bet deficiency resulted in IFN-{gamma} production that was 50% of control vector-infected cells (34% compared with 68%) (Fig. 5A, lower left panel). However, when DN-Eomes was introduced into T-bet–/– cells, the percentage of IFN-{gamma}-positive cells was further reduced to 33% of GFP-positive cells (19 vs 58%) (Fig. 5A, lower right panel). Similar results were obtained in other two different experiments. Thus, Eomes contributed to IFN-{gamma} production in {gamma}{delta} T cells in a T-bet-independent fashion (Fig. 5B).


Figure 5
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 5. Eomes is a functional transcription factor in {gamma}{delta} T cells. {gamma}{delta} T cells were sorted from wild-type or T-bet–/– mice and activated with anti-CD3 and anti-CD28 in the presence of IL-12 and anti-IL-4. After 24 h, cells were then infected with control or dominant negative Eomes retrovirus-GFP as described in Materials and Methods. Cells were cultured in the presence of IL-2 for additional 3 days. Cultured cells were then restimulated with anti-CD3 and anti-CD28 for 6 h and used for intracellular cytokine staining. A, An example of representative intracellular cytokine staining is shown. The number shown in the upper right quadrant is the percentage of cells in different quadrants. B, The percentage of IFN-{gamma} producing GFP-positive cells is shown. Data represents mean ± SD of three experiments. C, In a parallel experiment, DN-Eomes-transduced and control empty virus-transduced GFP-positive cells were used for the DNA methylation analysis of the intron I region of the ifn-{gamma} gene as described in Fig. 3. Data is representative of three independent experiments.

 

View this table:
[in this window]
[in a new window]

 
Table I. The mean florescence intensity of IFN-{gamma}-producing cells from retrovirally transduced cellsa

 
DN-Eomes transduction does not change the DNA methylation pattern in activated {gamma}{delta} T cells. To further explore the effect of Eomes on DNA methylation in {gamma}{delta} T cells, naive cells were activated and transduced with DN-Eomes or control GFP. At day 5 of culture, GFP+ cells were sorted and DNA methylation patterns were analyzed. Expression of DN-Eomes did not change the DNA methylation pattern (Fig. 5C).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Our previous studies have established that splenic {gamma}{delta} T cells exhibit a strong bias toward IFN-{gamma} production upon activation and that the mechanisms that control IFN-{gamma} synthesis in {gamma}{delta} T cells are different from those in CD4+ T cells (25, 26). We extend these observations in the current work, demonstrating that the IFN-{gamma} gene is more accessible in naive {gamma}{delta} T cells compared with CD4+ and CD8+ T cells and that activated {gamma}{delta} T cells more quickly produce IFN-{gamma} in a proliferation-independent fashion. Moreover, we define for the first time an important role of Eomes, a CD8+ T cell-specific transcription factor, in regulating IFN-{gamma} production in {gamma}{delta} T cells. Our work thus demonstrates that both epigenetic and transcriptional mechanisms contribute to default production of IFN-{gamma} in {gamma}{delta} T cells.

IFN-{gamma} is a key cytokine in the innate and adaptive immune responses that helps protect against infections by intracellular pathogens as well as from tumor development. Although several innate cells or innate-like lymphocytes such as NK, NK T, and {gamma}{delta} T cells have been proposed to be the critical sources of IFN-{gamma} in protective immunity, our previous studies have highlighted an essential role of {gamma}{delta} T cells in providing an early source of IFN-{gamma} in tumor immunosurveillance as well as in immune responses against viral challenge (27, 28). Therefore, it is essential to fully understand the molecular mechanisms that control IFN-{gamma} production in {gamma}{delta} T cells. To date, very little attention has been paid to the role of epigenetics and transcriptional programs in {gamma}{delta} T cells. Nevertheless, our earlier studies have shown that the mechanisms that regulate cytokine production in CD4+ {alpha}beta T cells do not fully overlap with those used in {gamma}{delta} T cells (25, 26). In contrast to CD4+ T cells, IL-12 is a dominant controlling cytokine compared with IL-4, and GATA-3 fails to counterbalance IFN-{gamma} production in {gamma}{delta} T cells (25, 26). A similar dichotomy is apparent from other lineages. T-bet is an essential transcription factor for CD4+ T cells but its absence has little effect in CD8+ T cells (31), whereas c-Maf is a key transcription factor for IL-4 gene expression in Th2 cells but not for mast cells (10, 32).

An essential finding in this report is that the epigenetic program that regulates IFN-{gamma} gene transcription in naive {gamma}{delta} T cells is different from that in naive CD4+ and CD8+ T cells. {gamma}{delta} T cells quickly express IFN-{gamma} mRNA and protein upon activation (Figs. 1 and 2, respectively), which was not dependent upon proliferation. Consistent with this finding, intron 1 of the ifn-{gamma} locus was hypomethylated in naive {gamma}{delta} T cells in comparison to that in CD4+ and CD8+ T cells (Fig. 3). These results indicate that the ifn-{gamma} locus in {gamma}{delta} T cells exists in a more accessible state compared with naive CD4+ and CD8+ T cells. Indeed, intron 1 of the ifn-{gamma} locus has been identified as an epigenetically regulated site conferring Th1-specific enhancer activity on the IFN-{gamma} promoter (33, 34). This site is resistant to DNase I in naive CD4+ T cells but becomes more sensitive to this enzyme in differentiated Th1 cells (33, 34). DNA cytosine methylation at CpG dinucleotides is one of the mechanisms that maintain gene silencing in mammals (13). The repressed state of the ifn-{gamma} locus in naive CD4+ T cells has been shown to be associated with the methylation of CpG motifs. In contrast, upon activation and cell division CD4+ T cells undergo remodeling of the ifn-{gamma} locus, acquiring an "open" configuration manifested by demethylation of CpG motifs and hypersensitivity to DNase I (35). Our results are in agreement with a recent report that the ifn-{gamma} locus in naive NK cells is also in a constitutively accessible state and that NK cells produce IFN-{gamma} in a cell proliferation-independent manner (30). Histone acetylation is another chromatin remodeling mechanism that is important for gene expression and has been shown to play an important role in helper T cell differentiation (14). However, due to our technical inability to purify sufficient numbers of naive {gamma}{delta} T cells for chromatin immunoprecipitation assay, it is unknown at present whether histones are hyperacetylated at the ifn-g locus in naive {gamma}{delta} T cells.

The second important finding in our study was the definition of an important role for Eomes in controlling IFN-{gamma} production in {gamma}{delta} T cells. Eomes is a newly identified specific transcription factor specific that regulates IFN-{gamma} production and effector function in CD8+ T cells (12). Similar to findings in CD8+ T cells, a low level of Eomes mRNA was detected in naive {gamma}{delta} T cells, but its expression level was significantly elevated upon activation (Fig. 4). Moreover, the expression of DN-Eomes caused reduced IFN-{gamma} production by activated {gamma}{delta} T cells from both wild-type and T-bet–/– mice, indicating that the effect of Eomes in {gamma}{delta} T cells is independent of T-bet (Fig. 5). T-bet is a Th1-specific transcription factor and is essential for CD4+ Th1 development (31). Interestingly, T-bet is required only for Ag-specific, but not polyclonal stimuli-mediated, IFN-{gamma} production in CD8+ T cells (36). In contrast, Eomes is expressed almost exclusively in CD8+ T cells and is undetectable in CD4+ T cells (12). Our early studies demonstrating that T-bet deficiency resulted in a reduction of IFN-{gamma}-producing cells by only 50% (26) suggested that other transcription factors were involved. Our current finding that Eomes contributes to T-bet-independent IFN-{gamma} production in {gamma}{delta} T cells has thus filled this knowledge gap. It should be noted that DN-Eomes suppresses both T-bet and Eomes, and one might expect a better effect of DN-Eomes in wild-type CD8+ T cells than in T-bet–/– mice. However, we showed that DN-Eomes had a more pronounced effect in the absence of T-bet (Fig. 5, A and B). Several possibilities might explain these results. First, DN-Eomes failed to suppress the activity of T-bet completely in {gamma}{delta} T cells, and the remaining T-bet contributes to {gamma}{delta} T cell IFN-{gamma} production. Second, there may be an unidentified transcription factor involved in the control of IFN-{gamma} production in {gamma}{delta} T cells. Thus, even if DN-Eomes suppresses both T-bet and Eomes, this undefined factor may contribute to IFN-{gamma} production. It is also unclear whether the basal level of Eomes expression in naive {gamma}{delta} and CD8+ T cells contributes to early IFN-{gamma} gene transcription and default IFN-{gamma} production in these two lineages of cells. It is technically challenging at this stage to study the impact of Eomes in naive {gamma}{delta} T cells due to the lethality of Eomes deficiency at the stage of embryogenesis (37). Thus, our results suggest a possible role of Eomes in the program of IFN-{gamma} production in {gamma}{delta} T cells.

What is the relationship between these two programs? To explore the effect of DN-Eomes on DNA methylation in the intron I region of IFN-{gamma}, DN-Eomes-positive cells were sorted and the DNA methylation pattern was analyzed (Fig. 5C). Interestingly, the expression of DN-Eomes did not alter the DNA methylation pattern in activated {gamma}{delta} T cells. There are several explanations for these results. First, Eomes has no effect on DNA methylation. It is not feasible to test this possibility in naive {gamma}{delta} T cells due to the embryonic lethality of Eomes deficiency. Second, DNA methylation in retrovirally transduced activated {gamma}{delta} T cells may not reflect the real DNA methylation pattern in naive {gamma}{delta} T cells, although a non-Eomes virus control was performed. Further work will be needed to clarify the Eomes activity and DNA methylation pattern in naive {gamma}{delta} T cells by using small interfering RNA or other techniques.

In summary, our study demonstrates that biased and rapid IFN-{gamma} production in {gamma}{delta} T cells is due to both epigenetic and transcriptional programs that regulate its expression. It will be interesting to see whether these programs function differently in other subsets of splenic {gamma}{delta} T cells (for example, V{gamma}1 vs V{gamma}4) as well as {gamma}{delta} T cells isolated from other organs, such as the skin or intestine. Given the more widely recognized functions of {gamma}{delta} T cells in early protective immune responses, our study further highlights a sophisticated program for default IFN-{gamma} production in this lineage of T cells.


    Acknowledgments
 
We thank Dr. Lauren Cohn (Section of Pulmonary and Critical Care, Yale School of Medicine) and Laurie Glimcher (Howard School of Medicine) for provision of C57BL/6 T-bet–/– mice. We thank Dr. Fotios Koumpouras for critical review of the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by an Arthritis Foundation Investigator Award, National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant K01 AR 02188, National Institutes of Health Grants R01AI56219 (to Z.Y.), AR40072, and 44076, and support from the Arthritis Foundation (to J.C.). Back

2 L.C. and W.H. contributed equally to this work. Back

3 Current address: Department of Medical Oncology, Dana-Farber Cancer Institute, Boston MA 02115. Back

4 Current address: State Key Laboratory of Trauma, Burns, and Combined Injury, Southwest Hospital, Third Military Medical University, Chongqing 40038, Peoples Republic of China. Back

5 Current address: Department of Immunology, University of Toronto, Canada. Back

6 Address correspondence and reprint requests to Dr. Zhinan Yin, Section of Rheumatology, Yale School of Medicine, Box 208031, The Anlyan Center, Room 517, 300 Cedar Street, New Haven, CT 06520. E-mail address: zhinan.yin{at}yale.edu Back

7 Abbreviations used in this paper: Eomes, eomesodermin; DN, dominant negative; HPRT, hypoxanthine phosphoribosyltransferase; Q-PCR, quantitative PCR. Back

Received for publication April 11, 2006. Accepted for publication December 7, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383: 787-793. [Medline]
  2. Glimcher, L. H., K. M. Murphy. 2000. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14: 1693-1711. [Free Full Text]
  3. O’Garra, A.. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8: 275-283. [Medline]
  4. Murphy, K. M.. 1998. T lymphocyte differentiation in the periphery. Curr. Opin. Immunol. 10: 226-232. [Medline]
  5. Seder, R. A., W. E. Paul, M. M. Davis, B. Fazekas de St. Groth. 1992. The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. J. Exp. Med. 176: 1091-1098. [Abstract/Free Full Text]
  6. Seder, R. A., R. Gazzinelli, A. Sher, W. E. Paul. 1993. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon {gamma} production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90: 10188-10192. [Abstract/Free Full Text]
  7. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100: 655-669. [Medline]
  8. Zheng, W., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89: 587-596. [Medline]
  9. Zhang, D. H., L. Cohn, P. Ray, K. Bottomly, A. Ray. 1997. Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific expression of the interleukin-5 gene. J. Biol. Chem. 272: 21597-21603. [Abstract/Free Full Text]
  10. Ho, I. C., D. Lo, L. H. Glimcher. 1998. c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation by both interleukin 4-dependent and -independent mechanisms. J. Exp. Med. 188: 1859-1866. [Abstract/Free Full Text]
  11. Hodge, M. R., H. J. Chun, J. Rengarajan, A. Alt, R. Lieberson, L. H. Glimcher. 1996. NF-AT-Driven interleukin-4 transcription potentiated by NIP45. Science 274: 1903-1905. [Abstract/Free Full Text]
  12. Pearce, E. L., A. C. Mullen, G. A. Martins, C. M. Krawczyk, A. S. Hutchins, V. P. Zediak, M. Banica, C. B. DiCioccio, D. A. Gross, C. A. Mao, et al 2003. Control of effector CD8+ T cell function by the transcription factor Eomesodermin. Science 302: 1041-1043. [Abstract/Free Full Text]
  13. Ansel, K. M., D. U. Lee, A. Rao. 2003. An epigenetic view of helper T cell differentiation. Nat. Immunol. 4: 616-623. [Medline]
  14. Fields, P. E., S. T. Kim, R. A. Flavell. 2002. Cutting edge: changes in histone acetylation at the IL-4 and IFN-ã loci accompany Th1/Th2 differentiation. J. Immunol. 169: 647-650. [Abstract/Free Full Text]
  15. Fields, P. E., G. R. Lee, S. T. Kim, V. V. Bartsevich, R. A. Flavell. 2004. Th2-specific chromatin remodeling and enhancer activity in the Th2 cytokine locus control region. Immunity 21: 865-876. [Medline]
  16. Avni, O., D. Lee, F. Macian, S. J. Szabo, L. H. Glimcher, A. Rao. 2002. TH cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat. Immunol. 3: 643-651. [Medline]
  17. Bird, J. J., D. R. Brown, A. C. Mullen, N. H. Moskowitz, M. A. Mahowald, J. R. Sider, T. F. Gajewski, C. R. Wang, S. L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9: 229-237. [Medline]
  18. Hutchins, A. S., A. C. Mullen, H. W. Lee, K. J. Sykes, F. A. High, B. D. Hendrich, A. P. Bird, S. L. Reiner. 2002. Gene silencing quantitatively controls the function of a developmental trans-activator. Mol. Cell 10: 81-91. [Medline]
  19. Makar, K. W., M. Perez-Melgosa, M. Shnyreva, W. M. Weaver, D. R. Fitzpatrick, C. B. Wilson. 2003. Active recruitment of DNA methyltransferases regulates interleukin 4 in thymocytes and T cells. Nat. Immunol. 4: 1183-1190. [Medline]
  20. Hayday, A. C.. 2000. {gamma}{delta} cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18: 975-1026. [Medline]
  21. Jameson, J., D. Witherden, W. L. Havran. 2003. T-cell effector mechanisms: {gamma}{delta} and CD1d-restricted subsets. Curr. Opin. Immunol. 15: 349-353. [Medline]
  22. Born, W., C. Cady, J. Jones-Carson, A. Mukasa, M. Lahn, R. O’Brien. 1999. Immunoregulatory functions of {gamma}{delta} T cells. Adv. Immunol. 71: 77-144. [Medline]
  23. Wen, L., D. F. Barber, W. Pao, F. S. Wong, M. J. Owen, A. Hayday. 1998. Primary {gamma} {delta} cell clones can be defined phenotypically and functionally as Th1/Th2 cells and illustrate the association of CD4 with Th2 differentiation. J. Immunol. 160: 1965-1974. [Abstract/Free Full Text]
  24. Ferrick, D. A., M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, H. Lepper. 1995. Differential production of interferon-{gamma} and interleukin-4 in response to Th1- and Th2-stimulating pathogens by {gamma}{delta} T cells in vivo. Nature 373: 255-257. [Medline]
  25. Yin, Z., D. H. Zhang, T. Welte, G. Bahtiyar, S. Jung, L. Liu, X. Y. Fu, A. Ray, J. Craft. 2000. Dominance of IL-12 over IL-4 in {gamma} {delta} T cell differentiation leads to default production of IFN-{gamma}: failure to down-regulate IL-12 receptor beta 2-chain expression. J. Immunol. 164: 3056-3064. [Abstract/Free Full Text]
  26. Yin, Z., C. Chen, S. J. Szabo, L. H. Glimcher, A. Ray, J. Craft. 2002. T-Bet expression and failure of GATA-3 cross-regulation lead to default production of IFN-{gamma} by {gamma}{delta} T cells. J. Immunol. 168: 1566-1571. [Abstract/Free Full Text]
  27. Gao, Y., W. Yang, M. Pan, E. Scully, M. Girardi, L. H. Augenlicht, J. Craft, Z. Yin. 2003. {gamma}{delta} T cells provide an early source of interferon {gamma} in tumor immunity. J. Exp. Med. 198: 433-442. [Abstract/Free Full Text]
  28. Wang, T., E. Scully, Z. Yin, J. H. Kim, S. Wang, J. Yan, M. Mamula, J. F. Anderson, J. Craft, E. Fikrig. 2003. IFN-{gamma}-producing {gamma}{delta} T cells help control murine West Nile virus infection. J. Immunol. 171: 2524-2531. [Abstract/Free Full Text]
  29. Gao, Y., J. Tao, M. O. Li, D. Zhang, H. Chi, O. Henegariu, S. M. Kaech, R. J. Davis, R. A. Flavell, Z. Yin. 2005. JNK1 is essential for CD8+ T cell-mediated tumor immune surveillance. J. Immunol. 175: 5783-5789. [Abstract/Free Full Text]
  30. Tato, C. M., G. A. Martins, F. A. High, C. B. DiCioccio, S. L. Reiner, C. A. Hunter. 2004. Cutting edge: innate production of IFN-{gamma} by NK cells is independent of epigenetic modification of the IFN-{gamma} promoter. J. Immunol. 173: 1514-1517. [Abstract/Free Full Text]
  31. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, G. C. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100: 655-669. [Medline]
  32. Sherman, M. A., T. Y. Nachman, M. A. Brown. 1999. Cutting edge: IL-4 production by mast cells does not require c-maf. J. Immunol. 163: 1733-1736. [Abstract/Free Full Text]
  33. Agarwal, S., A. Rao. 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9: 765-775. [Medline]
  34. Mullen, A. C., A. S. Hutchins, F. A. High, H. W. Lee, K. J. Sykes, L. A. Chodosh, S. L. Reiner. 2002. Hlx is induced by and genetically interacts with T-bet to promote heritable T(H)1 gene induction. Nat. Immunol. 3: 652-658. [Medline]
  35. Wilson, C. B., K. W. Makar, M. Shnyreva, D. R. Fitzpatrick. 2005. DNA methylation and the expanding epigenetics of T cell lineage commitment. Semin. Immunol. 17: 105-119. [Medline]
  36. Sullivan, B. M., A. Juedes, S. J. Szabo, M. von Herrath, L. H. Glimcher. 2003. Antigen-driven effector CD8 T cell function regulated by T-bet. Proc. Natl. Acad. Sci. USA 100: 15818-15823. [Abstract/Free Full Text]
  37. Russ, A. P., S. Wattler, W. H. Colledge, S. A. Aparicio, M. B. Carlton, J. J. Pearce, S. C. Barton, M. A. Surani, K. Ryan, M. C. Nehls, et al 2000. Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature 404: 95-99. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Bandyopadhyay, M. Long, H. Z. Qui, A. T. Hagymasi, A. M. Slaiby, M. A. Mihalyo, H. L. Aguila, R. S. Mittler, A. T. Vella, and A. J. Adler
Self-Antigen Prevents CD8 T Cell Effector Differentiation by CD134 and CD137 Dual Costimulation
J. Immunol., December 1, 2008; 181(11): 7728 - 7737.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Tsuji-Takayama, M. Suzuki, M. Yamamoto, A. Harashima, A. Okochi, T. Otani, T. Inoue, A. Sugimoto, T. Toraya, M. Takeuchi, et al.
The Production of IL-10 by Human Regulatory T Cells Is Enhanced by IL-2 through a STAT5-Responsive Intronic Enhancer in the IL-10 Locus
J. Immunol., September 15, 2008; 181(6): 3897 - 3905.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, L.
Right arrow Articles by Craft, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, L.
Right arrow Articles by Craft, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS