The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maneechotesuwan, K.
Right arrow Articles by Adcock, I. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maneechotesuwan, K.
Right arrow Articles by Adcock, I. M.
The Journal of Immunology, 2007, 178: 2491-2498.
Copyright © 2007 by The American Association of Immunologists, Inc.

Regulation of Th2 Cytokine Genes by p38 MAPK-Mediated Phosphorylation of GATA-31

Kittipong Maneechotesuwan2, Yao Xin, Kazuhiro Ito, Elen Jazrawi, Kang-Yun Lee, Omar S. Usmani, Peter J. Barnes3 and Ian M. Adcock

Section of Airway Disease, National Heart and Lung Institute, Imperial College, London, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
GATA-3 plays a critical role in allergic diseases by regulating the release of cytokines from Th2 lymphocytes. However, the molecular mechanisms involved in the regulation of GATA-3 in human T lymphocytes are not yet understood. Using small interfering RNA to knock down GATA-3, we have demonstrated its critical role in regulating IL-4, IL-5, and IL-13 release from a human T cell line. Specific stimulation of T lymphocytes by costimulation of CD3 and CD28 to mimic activation by APCs induces translocation of GATA-3 from the cytoplasm to the nucleus, with binding to the promoter region of Th2 cytokine genes, as determined by chromatin immunoprecipitation. GATA-3 nuclear translocation is dependent on its phosphorylation on serine residues by p38 MAPK, which facilitates interaction with the nuclear transporter protein importin-{alpha}. This provides a means whereby allergen exposure leads to the expression of Th2 cytokines, and this novel mechanism may provide new approaches to treating allergic diseases.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Allergic inflammation in asthma, rhinitis, and atopic dermatitis, as well as humoral immunity against parasites, is regulated via the release of cytokines from Th2 lymphocytes. IL-4 and IL-13 regulate the synthesis of IgE, whereas IL-5 is critical for eosinophil differentiation. In mice, these Th2 cytokines are regulated by the zinc finger transcription factor GATA-3, which is predominantly expressed in Th2 cells (1). GATA-3 determines Th2 cell differentiation and selectively activates the promoters of IL-4, IL-5, and IL-13 through chromatin remodeling (2, 3, 4, 5). The key role of GATA-3 in allergic airway inflammation has been demonstrated in mice by the reduction and release of Th2 cytokines in animals treated with dominant-negative mutants of GATA-3 and by local application of antisense oligonucleotides to GATA-3 (6, 7). Furthermore, conditional knockout of the GATA-3 gene in mice reduces expression of Th2 cytokines in vitro and in vivo (8), and similar results are seen in isolated murine CD4+ lymphocytes (9).

Enhanced nuclear expression of GATA-3 following TCR activation was first demonstrated in murine T cells (10). GATA-3 contains a classical nuclear import signal (11), and its size exceeds the m.w. limit for passive diffusion across the nuclear membrane (12). Nuclear import of proteins is an active process for proteins that contain a nonconsensus basic targeting sequence or nuclear localization sequence (NLS)4 (13). Nuclear import proteins, such as importin-{alpha} (karyopherin-{alpha}), play a critical role in transporting large proteins from the cytoplasm into the nucleus (14, 15). Importin-{alpha} has been shown to play a critical role in the nuclear import of transcription factors such as NF-AT, NF-{kappa}B, and STAT-1 in Jurkat T lymphocytes (16). A previous study has shown that deletion of a region encompassing the GATA-3 NLS region (aa 249–311) prevents nuclear localization of the overexpressed protein (11). The affinity of the importin-{alpha}-NLS interaction is a critical parameter in determining nuclear transport efficiency and may be influenced directly by phosphorylation (13, 15, 17).

We have determined the molecular mechanisms involved in nuclear translocation of GATA-3 and its regulation of Th2 cytokine genes in human T cells (HUT-78 cells and primary peripheral blood T cells), and have demonstrated a critical role for phosphorylation of GATA-3 by p38 MAPK, which is activated by TCR costimulation with anti-CD3 and anti-CD28 Abs.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Abs and reagents

The mAbs against human CD3, CD28, and importin-{alpha} were purchased from BD Biosciences. Rabbit Abs against human GATA-3 were from Santa Cruz Biotechnology; polyclonal rabbit Abs against phospho-p38 MAPK and phospho-activated transcription factor (ATF)-2 were from Cell Signaling Technology (New England Biolabs); mAbs against phosphoserine (clone 4H4) were from Affiniti Research Products; and Abs against rabbit IgG-conjugated tetramethylrhodamine isothiocyanate were from DakoCytomation. All other reagents were purchased from Sigma-Aldrich.

Cell culture and PBMC isolation

Human T cells (HUT-78), purchased from European Collection of Cell Culture, were cultured, as previously described (18). PBMC from patients with asthma were isolated by density centrifugation over Ficoll-Hypaque (density, 1.077 g/ml; Amersham Biosciences) (19). In some experiments, peripheral venous blood (150 ml) was collected, CD3+ T cells were isolated by negative selection (Miltenyi Biotec), and CCR5+ cells were further isolated by immunomagnetic beads (20). To drive peripheral blood T cells toward a Th2 phenotype, PBLs were prepared by negative selective and resuspended in RPMI 1640 containing 10% FCS. A total of 4 x 106 cells was incubated for 5 days with human rIL-4 (20 ng/ml; R&D Systems) and a neutralizing anti-IFN-{gamma} Ab (2.5 µg/ml; R&D Systems) to induce a Th2 phenotype. Control cells were incubated in medium alone for the duration of the experiment. At the end of this time, cells were stimulated with anti-CD3/CD28 (1 µg/ml each) for 1 h at 37°C to stimulate Th2 cytokine release. The patients with asthma were naive to corticosteroid therapy and treated with inhaled bronchodilators as required. All patients gave informed consent, and the study was approved by the Ethics Committee of the Royal Brompton and Harefield NHS Trust.

Knockdown of GATA-3 expression

RNA interference was used to specifically suppress expression of GATA-3 in HUT-78 cells. Four ds21–23mer RNA oligonucleotides directed against GATA-3 were synthesized by Dharmacon and used in combination (100 nM each) to suppress GATA-3 expression. Target sequences are as follows: AAGAAAGAGUGCCUCAAGUAC and AAUCCAGACCAGAAACCGAAA. Cells were transfected with small interfering RNA (siRNA) using Gene Silencer (Gene Therapy Systems), as described by the manufacturer, and GATA-3 expression was monitored by RT-quantitative PCR using SYBER Green (Invitrogen Life Technologies) after 48 h. GATA-3 primers were as follows: forward, GCCATGGGTTAGAGAGGCAG and reverse, TTGGAGACTCCTCACGCATGT.

Multiplex detection of Th1/Th2 cytokines

The levels of human Th1/Th2 cytokines and chemokines were detected in HUT-78 culture medium before and after 18-h stimulation with anti-CD3/CD28 using the Beadlyte Human 22-Plex MultiCytokine Detection System (Upstate Biotechnology), according to the manufacturer’s instructions. The sensitivity obtained for each cytokine and chemokine was 1.9 pg/ml.

Construction of an {Delta}NLS-GATA-3 mutant

p-YFP-GATA-3 was constructed by inserting the full-length GATA-3 cDNA (provided by A. Winoto (University of California, Berkeley, CA) into the EYFP-C1 vector (BD Clontech). Full-length GATA-3 was isolated by PCR using the following primers: forward, 5'-CTCAGATCTAAAGCAAATCATTCAA and reverse, 5'-TTATCTAGATTAGCTGTAACCCATGCC-3' containing a BglII site and an XbaI site and stop codon, respectively. The resulting product was purified and ligated into BglII-XbaI cut p-YGF-C1 vector (BD Clontech). An NLS-deficient GATA-3 ({Delta}NLS-YFP-GATA-3) was obtained by removal of the previously described NLS domain (aa 249–311) by excision with XcmI and PstI.

Transfection

HUT-78 cells were transfected with EGF-GATA-3 or {Delta}NLS-EGF-GATA-3 using lipofectamine, according to the manufacturer’s instructions (Invitrogen Life Technologies), before cells were serum deprived for 24 h. Cells were subsequently stimulated with anti-CD3/CD28. Cytospins were prepared and GATA-3 localization was determined by confocal microscopy, as previously described (21).

RT-PCR

Total RNA was extracted using lysis buffer (Rneasy kit; Qiagen). During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus reverse transcription (Promega). For relative quantification, RT-PCR was conducted, as previously described, using cDNA probes (22). Primers for IL-4, IL-5, and IL-13 were from Sigma-Genosys. Sequences of GADPH used were as follows (listed 5'-3'): 5'-CCACCCATGGCAAATTCCATGGC and 3'-TCTAGACGGC AGGTCAGGTCCAC.

Cell fractionation, immunoprecipitation, and Western blot analysis

Nuclear and cytoplasmic fractions were prepared, as previously described (22). Whole cell lysates were prepared in Nonidet P-40 lysis buffer (0.5% Nonidet P-40, 20 mM Tris-HCl (pH 7.5), 150 mM NaCl) in the presence of complete protease mixture inhibitor. Lysates were centrifuged at 4°C for 10 min at 12,000 rpm in an Eppendoff microfuge to remove cellular debris and immunoprecipitated with either 10 µl of Ab against GATA-3 or importin-{alpha} using A/G agarose slurry, in the presence of protease inhibitor using Catch and Release methodology (Upstate Biotechnology). Western blot analysis was performed, as described (22), using anti-GATA-3, anti-importin-{alpha}, anti-phospho-p38 MAPK, anti-phospho-ATF-2, and anti-phosphoserine Abs. Immunoreactive proteins were detected using an ECL kit (Amersham Biosciences).

Chromatin immunoprecipitation (ChIP)

ChIP was performed, as previously described (23), in HUT-78 T cells with 2 µg of anti-GATA-3 (Santa Cruz Biotechnology), or isotypic Ig G as a nonspecific control (Santa Cruz Biotechnology) overnight at 4°C. Promoter sequences were detected with PCR primers for the IL-4 promoter (–772 to +12), as follows: forward, 5'-GAAACCTCAGAATAGACCTAC-3'; reverse, 5'-GGTGAGACCCATTAATAGGTG-3'. Promoter sequences were detected with PCR primers for the IL-5 promoter, as follows: (–445 to +4): forward, 5'-TTAATCTAGCCACAGTCATAG-3'; reverse, 5'-TCATGGCTCTGAAACGTTCTG-3'. PCR was performed using a Hybaid Omnigene thermal cycler (Thermo Hybaid) with cycling parameters of 72°C for 10 min, 35 cycles at 94°C for 45 s, 52°C for 45 s, and 72°C for 45 s.

In vitro alkaline phosphatase treatment

Enzymatic dephosphorylation was performed, as described previously (24). Whole cell (100 µg) proteins from anti-CD3/CD28-treated cells were incubated with or without 30 U of calf intestinal alkaline phosphates (New England Biolabs) in reaction buffer containing 50 mM Tris-HCl, 10 mM MgCl2, 100 mM NaCl, and 1 mM DTT (pH 7.9) for 1 h, at 37°C. As a control, the enzyme was coincubated with 50 mM sodium pyrophosphate (NaPi), a phosphatase inhibitor.

Statistical analysis

Data are represented as the mean ± SEM of at least three independent experiments and were compared using a two-tailed Student’s t test. The null hypothesis was rejected at p < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
HUT-78 cells have a predominant Th2 phenotype

Using ChIP assays to examine transcription factor binding to native promoters, we showed that anti-CD3/CD28 Ab stimulation markedly enhanced GATA-3 enrichment at the IL-4 and IL-5 promoters (Fig. 1A) and that this was followed temporally by a 10- and 20-fold increase in IL-4 and IL-5 mRNA, respectively (Fig. 1B). HUT-78 cells were predominantly Th2-like in phenotype expressing IL-4, IL-5, IL-10, IL-13, and GM-CSF with no expression of IL-3, IFN-{gamma}, or TNF-{alpha}. However, these cells did also express IL-2. Stimulation of HUT-78 cells with anti-CD3/CD28 enhanced the expression of IL-4 and IL-5 (Fig. 1) and of IL-13 (1528 ± 194 vs 516 ± 52 pg/ml; p < 0.05) and GM-CSF (440 ± 64 vs 94 ± 13 pg/ml; p < 0.05), but not of IL-10 (1855 ± 382 vs 1916 ± 157 pg/ml; p = NS).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 1. The role of GATA-3 in Th2 cytokine expression demonstrated using siRNA in HUT-78 cells. A, Endogenous GATA-3 binds the native IL-4 and IL-5 promoters. ChIP assays were performed using an Ab to human GATA-3. Immunoprecipitated GATA-3 was analyzed for associated DNA by PCR with primers specific for the promoter region of IL-4 or IL-5 gene. No association with DNA was observed in complexes immunoprecipitated with an irrelevant isotype control Ab (IgG). Input DNA samples were run as controls. B, RT-PCR demonstrates IL-4 and IL-5 mRNA expression following anti-CD3/CD28 Ab costimulation of HUT-78 cells for 14 h, in comparison with the mRNA expression in response to each stimulus applied separately. GAPDH was used to control for loading. Mean stimulation values (n = 3–4) are given above mRNA lanes. C, Knockdown of GATA-3 mRNA expression compared with housekeeping gene GAPDH using siRNA (G3), with no effect of a scrambled siRNA control (Scr). Cell stimulation with anti-CD3/CD28 Abs had no effect on GATA-3 mRNA. Mean values ± SEM of four independent experiments; **, p < 0.01. D, Knockdown of GATA-3 mRNA expression inhibits IL-4 mRNA expression after stimulation with anti-CD3/CD28 Abs, whereas scrambled siRNA control had no effect. Mean ± values are shown of four independent experiments; p < 0.05. E, Knockdown of GATA-3 mRNA expression inhibits IL-13 mRNA expression after stimulation with anti-CD3/CD28 Abs, whereas scrambled siRNA control had no effect. Mean ± values are shown of four independent experiments; p < 0.05. F, Knockdown of GATA-3 mRNA expression has no inhibitory effect on IL-8 mRNA expression after stimulation with anti-CD3/CD28 Abs. Mean ± values are shown of four independent experiments.

 
GATA-3 is essential for Th2 cytokine production in human T cells

Interference RNA was used to selectively knock down GATA-3 expression in HUT-78 cells. Transfection of siRNAs resulted in marked suppression of GATA-3 mRNA expression (Fig. 1C) within 48 h, whereas control scrambled siRNAs had no effect on its expression. GATA-3 knockdown completely suppressed anti-CD3/CD28-stimulated IL-4 mRNA expression (Fig. 1D), whereas control siRNAs had no effect. These results confirm that GATA-3 is essential for Th2 cytokine production in human T cells and support recent data from GATA-3 conditional knockout studies in mice (8). Similar results were obtained with IL-13 expression (Fig. 1E), but not with IL-8 expression (Fig. 1F).

GATA-3 nuclear translocation and Th2 cytokine gene regulation

GATA-3 immunoreactivity was predominantly localized to the cytoplasm before cell stimulation, but cell activation with anti-CD3/CD28 resulted in rapid (within 30 min) GATA-3 nuclear translocation (Fig. 2A). Western blotting confirmed these results and showed that GATA-3 nuclear localization was rapid and persisted for at least 14 h (Fig. 2, B and C). These results suggest that GATA-3 nuclear localization is a critical step in the regulation of Th2 cytokine gene expression.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 2. Nuclear translocation of GATA-3 after activation of HUT-78 cells by anti-CD3/CD28 Abs. A, Localization of GATA-3 by confocal microscopy in the nucleus using an Ab specific for GATA-3 (red fluorescence with Texas Red staining) and 4',6'-diamidino-2-phenylindole (DAPI) dye for DNA (blue fluorescence) at rest (t = 0 min; upper panel) and 30 min after stimulation with anti-CD3/CD28 Abs (t = 30 min; lower panel), showing translocation to the nucleus. Cells stained with isotopic specific polyclonal IgG were negative for GATA-3 (data not shown). B, Western blots showing increased GATA-3 in the nuclear fraction of anti-CD3/CD28 Ab-stimulated HUT-78 cells. Cytosolic (Cyt) and nuclear (Nucl) fractions were separated and subjected to GATA-3 immunoblotting. C, Histone H1° and MEK-1 were used to ensure equal loading of nuclear and cytoplasmic proteins, respectively. D, Removal of the putative GATA-3 NLS sequence prevents GATA-3 nuclear import following anti-CD3/CD28 Ab stimulation. Confocal microscopy images show cells transfected with wild-type GATA-3 labeled with a fluorescent tag showing yellow/green fluorescence in the cytoplasm of a transfected cell (left panel), but nuclear translocation after stimulation with anti-CD3/CD28 Abs (middle panel). Transfection with GATA-3 in which the NLS sequence has been deleted ({Delta}NLS-GATA-3) shows no nuclear localization after cell activation (right panel), indicating the importance of the NLS sequence for nuclear translocation of GATA-3. DAPI labels DNA to delineate the nuclei (blue fluorescence).

 
Interaction of GATA-3 and importin-{alpha}

We investigated whether nuclear import of GATA-3 required an interaction with importin-{alpha}. Stimulation of HUT-78 cells caused a rapid (<10-min) interaction of GATA-3 with importin-{alpha}, which peaked at 20 min and returned to baseline by 60 min (Fig. 3, A and B). Anti-CD3/CD28 Ab markedly increased the association between GATA-3 and importin-{alpha} (Fig. 3C). Thus, rapid association with importin-{alpha} occurred before GATA-3 nuclear localization. Deletion of the GATA-3 NLS region prevented nuclear translocation of YFP-GATA-3 following anti-CD3/CD28 stimulation (Fig. 2D), providing further evidence for a role of importin-{alpha} in GATA-3 function. In contrast, GATA-3 did not interact with the non-NLS recognizing nuclear transport factor transportin-1 after cell stimulation with anti-CD3/CD28 Ab (Fig. 3D). This was not due to a lack of transportin-1 activity, because transportin-1 was seen to associate with associated factors such as heterogeneous nuclear ribonucleoprotein A1 (Fig. 3E).


Figure 3
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 3. Physical association between GATA-3 and importin-{alpha} in HUT-78 cells. A, Coimmunoprecipitation analysis demonstrating the time course of GATA-3/importin-{alpha} interaction following anti-CD3/CD28 costimulation, using anti-GATA-3 Ab to immunoprecipitate (IP) and anti-importin-{alpha} Ab to immunoblot (IB). B, Coimmunoprecipitation using anti-importin-{alpha} Ab to immunoprecipitate (IP) and anti-GATA-3 Ab to immunoblot (IB). C, Association between GATA-3 and importin-{alpha} was markedly increased after stimulation with anti-CD3/CD28 Ab (stim), but not in resting cells or with control Ab (unstim). Mean ± SEM values of three experiments are shown; p < 0.01. D, Anti-CD3/CD28-stimulated GATA-3 did not associate with the nuclear import protein transportin 1. Anti-GATA-3 immunoprecipitation and transportin 1 immunoblotting; the transportin positive control (PC) is also shown. E, Anti-CD3/CD28 stimulation did not affect the ability of transportin 1 to associate with the transportin-binding protein heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), as demonstrated by coimmunoprecipitation Western blot experiments. All above results are representative of at least three independent experiments.

 
Activation of p38 MAPK by anti-CD3/CD28 Abs

Using an Ab directed against Thr180 and Tyr182 to recognize the activated form of phosphorylated p38 MAPK, we showed that anti-CD3 Ab (Fig. 4A) and anti-CD28 Ab (Fig. 4B) independently increased p38 phosphorylation. Although the maximal induction of p38 phosphorylation was not increased by combined anti-CD3/CD28 Abs, the induction of p38 phosphorylation and activity occurred earlier (before 15 min) and was more sustainable (maximal activation still seen after 60 min) than by cross-linking of CD3 or CD28 alone (Fig. 4 and data not shown). ATF-2, a target protein downstream of p38 MAPK, was also phosphorylated by anti-CD3/CD28 Abs at 60 min, and this persisted for over 6 h (Fig. 4D). Phosphorylated ATF-2 was detected in nuclear fractions after anti-CD3/CD28 Ab stimulation, and this was inhibited by SB203580, a selective inhibitor of p38 MAPK, with inhibition at a concentration of 0.01 µM (Fig. 4E).


Figure 4
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 4. Activation of p38 MAPK by anti-CD3/CD28 Ab stimulation of HUT-78 cells. A, Anti-CD3 Ab caused a concentration (left) and time-dependent phosphorylation of p38 MAPK detected with an Ab against Thr180 and Tyr182, which detected an activated form of p38 MAPK (p38Thr/Tyr-p). B, Anti-CD28 Ab caused a concentration (left) and time-dependent phosphorylation of p38 MAPK. C, Combined anti-CD3/CD28 Ab gives a greater increase in phosphorylated p38 MAPK with an effect persisting over 60 min. D, Phosphorylation of ATF-2 (p-ATF-2), a downstream target of p38 MAPK activation, by anti-CD3/CD28 Ab stimulation with onset by 1 h and persistence for over 6 h. E, Inhibition of ATF-2 phosphorylation after anti-CD3/CD28 stimulation by SB203580. Each result is representative of at least three independent experiments.

 
Role of MAPK in GATA-3 translocation

The phosphorylation status of nuclear import substrates is required for optimal interaction with importin-{alpha} (12, 13). We investigated whether phosphorylation of GATA-3 affects its ability to interact with importin-{alpha}. Anti-CD3/CD28 Ab stimulation of HUT-78 cells induced GATA-3 serine phosphorylation (Fig. 5). In vitro treatment with calf intestinal phosphatase (CIP) to reduce phosphorylation markedly reduced GATA-3 phosphorylation (Fig. 5A), and caused the dissociation of GATA-3 from importin-{alpha}. In contrast, inhibiting CIP activity with NaPi prevented GATA-3 dissociation from importin-{alpha}. These results indicated that serine phosphorylation of GATA-3 is essential for its interaction with importin-{alpha}. In contrast, anti-CD3/CD28 stimulation had no effect on GATA-3 threonine phosphorylation or on importin-{alpha} phosphorylation status (data not shown).


Figure 5
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 5. GATA-3 phosphorylation is essential for GATA-3 nuclear import in HUT-78 cells. A, Immunoblotting analysis of anti-CD3/CD28 costimulation showing increased expression of serine phosphorylated (P-Ser) GATA-3 protein at 30 min. Whole cell extracts treated with CIP in the absence and presence of the phosphatase inhibitor NaPi (50 mM) were used as controls. B, Immunoblotting analysis of CIP-treated whole cell extracts from anti-CD3/CD28-costimulated cells revealed decreased interaction between GATA-3 and importin-{alpha}, which was reversed by NaPi. The above results are representative of at least three independent experiments.

 
Because p38 MAPK is activated by anti-CD3/CD28 Abs, we next investigated the effects of p38 MAPK on GATA-3 phosphorylation. Anti-CD3/CD28 Ab stimulation increased serine phosphorylation of GATA-3, and this was inhibited by SB203850 (1 µM) (Fig. 6A). SB203850 resulted in marked impairment of the association between GATA-3 and importin-{alpha} (Fig. 6B). Western blot analysis of fractionated protein extracts derived from HUT-78 cells showed that treatment of SB203850 caused a concentration-dependent increase in cytoplasmic expression of GATA-3 protein in parallel with decreased nuclear GATA-3 expression (Fig. 6C). This effect of SB203850 was concentration related and peaked with a 15.8-fold rise in cytoplasmic expression of GATA-3 with SB203850 (1 µM) compared with a 4.2-fold increase at 0.01 µM (Fig. 6D).


Figure 6
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 6. GATA-3 phosphorylation by p38 MAPK in HUT-78 cells. A, Western blot analysis of the effects of the selective p38 MAPK inhibitor (SB203580) on the expression of serine-phosphorylated GATA-3 protein (p-Ser) in anti-CD3/CD28-costimulated cells. SB203580 (1 µM) was preincubated for 30 min before stimulation, and proteins were extracted after a further 30 min. B, Coimmunoprecipitation of SB203580-treated cells demonstrating a reduced interaction between GATA-3 and importin-{alpha} (Imp-{alpha}) using immunoprecipitation with anti-GATA-3 Ab and immunoblotting with anti-importin-{alpha} Ab (upper blot) and immunoprecipitation with anti-importin-{alpha} Ab and immunoblotting with anti-GATA-3 Ab (lower blot). SB203580 was preincubated for 30 min before stimulation, and proteins were extracted after a further 20 min. C, Suppression of anti-CD3/CD28 Ab-mediated GATA-3 nuclear transport by SB203580, resulting in GATA-3 cytoplasmic retention. SB203580 was preincubated for 30 min before stimulation, and proteins were extracted after a further 60 min. MEK and histone H1° were used as markers for equal cytoplasmic and nuclear loading, respectively. D, Concentration response of the inhibitory effect of SB203580 on nuclear and cytoplasmic GATA-3 protein after stimulation with anti-CD3/CD28 Ab. Mean ± SEM of three to four separate experiments are shown.

 
Inhibition of the other MAPK pathways, ERK, and JNK with specific inhibitors (PD098059 and SP600125, both at 1 µM, respectively) did not affect GATA-3 phosphorylation, association with importin-{alpha}, or nuclear import (data not shown). Taken together, these data indicate that p38 MAPK-mediated phosphorylation facilitates GATA-3 nuclear import by promoting its interaction with importin-{alpha}.

GATA-3 in primary blood T lymphocytes

Peripheral blood T cells expressing GATA-3 purified from mild asthmatic subjects demonstrated both cytoplasmic (42%) and nuclear (58%) GATA-3 localization (Fig. 7A), confirming previous results (20). Stimulation with anti-CD3/CD28 caused nuclear translocation of GATA-3 at 60 min, demonstrated by both confocal microscopy (Fig. 7A) and Western blotting (Fig. 7B). This was associated with an earlier (30-min) interaction between GATA-3 and importin-{alpha} (Fig. 7C), and with GATA-3 phosphorylation (Fig. 7D), confirming the results seen in HUT-78 cells. Importantly, SB203580 (1 µM) attenuated anti-CD3/CD28-induced GATA-3 serine phosphorylation in these cells (Fig. 7D). Interestingly, when we cultured cells ex vivo, we observed a dramatic shift of GATA-3 from the cytoplasm to the nucleus whether cells were incubated in a Th2-inducing environment or not (Fig. 7E).


Figure 7
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 7. GATA-3 activation in PBMC. A, Localization of GATA-3 by confocal microscopy in the nucleus using an Ab specific for GATA-3 (red fluorescence with Texas Red staining) and DAPI dye for DNA (blue fluorescence) at rest (t = 0 min, left panel) and 30 min after stimulation with anti-CD3/CD28 Abs (t = 60 min, right panel), showing translocation to the nucleus. Cells stained with isotopic specific polyclonal IgG were negative for GATA-3 (data not shown). B, Western blots showing increased GATA-3 in the nuclear fraction of anti-CD3/CD28 Ab-stimulated PBMCs. Cytosolic and nuclear fractions were separated and subjected to GATA-3 immunoblotting. Histone H1 was used to ensure equal loading of nuclear proteins. C, Coimmunoprecipitation analysis of PBMC activated by anti-CD3/CD28 Abs, demonstrating interaction between GATA-3 and importin-{alpha} (Imp-{alpha}) at 30 min by using immunoprecipitation (IP) with an Ab to importin-{alpha} and immunoblotting (IB) with an Ab to GATA-3. D, Coimmunoprecipitation analysis of peripheral blood T cells activated by anti-CD3/CD28 Abs, demonstrating induction of serine phosphorylation of GATA-3 at 30 min and reduction by pretreatment with SB203580 (1 µM) by using immunoprecipitation (IP) with an Ab to GATA3 and immunoblotting (IB) with an Ab to phosphoserine. E, Incubation of peripheral blood T cells for 5 days induces nuclear translocation of GATA-3 under Th2-inducing and control conditions. Peripheral blood was obtained from three patients with mild asthma who were treated with inhaled bronchodilators as needed and not with inhaled corticosteroids. Typical results of three independent experiments are shown.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we present evidence that the nuclear import of GATA-3 from its normal cytoplasmic location requires the direct interaction with the nuclear transport protein importin-{alpha}, following p38 MAPK-mediated serine phosphorylation. Costimulation with anti-CD3 and anti-CD28 mAbs, which mimics the activation of T cells by APCs, results in activation of the p38 MAPK signal transduction pathways. The resulting phosphorylation of GATA-3, interaction with importin-{alpha}, and nuclear localization result in binding of GATA-3 to the promoter region of Th2 cytokine genes and increased gene expression, thereby linking stimulation of T cells by APCs to Th2 cytokine secretion and allergic inflammation. Studies were initially conducted in HUT-78 T cells, which we show to have many characteristics of Th2 cells. Results in freshly isolated peripheral blood T cells confirmed the cytoplasmic localization of GATA-3 in 40% of these cells and the subsequent nuclear localization following anti-CD3/CD28 stimulation associated with changes in GATA-3 phosphorylation and interaction with importin-{alpha}.

The expression of Th2 cytokines genes has previously been reported to be blocked by p38 MAPK inhibition (25, 26, 27, 28, 29, 30). In murine T cells, both the TCR CD3 and coreceptor CD28 need to be ligated for maximal duration of p38 MAPK activation (31), and this is confirmed in our studies. In human T cells, Th2 cytokines (IL-4, IL-5, and IL-13) are more effectively inhibited by a p38 MAPK inhibitor after anti-CD3/CD28 stimulation than the Th1 cytokine IL-2, indicating some specificity of effect and consistent with an inhibitory effect on GATA-3 (32). The location of the serine residue(s) of GATA-3 that is phosphorylated by p38 MAPK is not yet determined, but there are at least 12 potential MAPK consensus sites. The role of ERK and JNK in the regulation of Th2 cytokines is less well defined and appears to be dependent on the stimulus used to activate T cells. CD3 activation alone results in the activation of ERK pathways (33, 34). Activation of CD28 alone weakly actives ERK pathways (35), whereas engagement of CD3 and CD28 as well as phorbol esters synergistically activates JNK pathways (33, 36). Activation of CD3 and another costimulatory molecule ICOS results in activation of ERK and JNK, but not p38 MAPK, in human CD4+ cells (30). Our results show that only p38 MAPK, but not ERK or JNK, is involved in the phosphorylation of GATA-3 and its interaction with importin-{alpha}. These data confirm a previous report of direct phosphorylation of GATA-3 by p38 MAPK (in response to cAMP stimulation) in murine T cells (37).

Protein phosphorylation of nuclear import substrates plays an important role in nuclear import of proteins, particularly for the optimal interaction with importin-{alpha} (17). Given that the phosphorylated serine sites located within the N-terminal of the NLS sequence in GATA-3 are largely negative in terms of charge, this may enhance interaction with the positively charged regions of importin-{alpha} (38).

Our results suggest that p38 MAPK plays a critical role in the regulation of Th2 cytokine genes and that inhibition of p38 MAPK may have therapeutic benefit in suppressing allergic inflammation. In OVA-sensitized and exposed mice and guinea pigs, a p38 MAPK inhibitor effectively suppressed eosinophilic inflammation in the lungs (39). An aerosolized p38{alpha} MAPK antisense oligonucleotide markedly reduced pulmonary eosinophilic inflammation, airway hyperresponsiveness, and mucus hypersecretion in OVA-sensitized mice after allergen exposure (40). This was accompanied by a significant reduction in IL-4, IL-5, and IL-13 in bronchoalveolar lavage fluid, indicating a likely inhibitory effect on Th2 cells. This suggests that p38 MAPK inhibitors may be of potential benefit in the therapy of asthma and other allergic diseases (41, 42).

Data in murine cells (8) indicate that conditional deletion of GATA-3 in polarized murine Th2 cells affects IL-5 and IL-13, but not IL-4 release, and is at odds with the results presented in this study. The same group has also recently presented data (43) indicating that GATA-3 was important for IL-4 production in naive murine CD4+ T cells following anti-CD3/CD28 stimulation and that IL-4 release could be attenuated by a MAPK inhibitor. The data presented in this study indicate that in HUT-78 cells, GATA-3 is involved in IL-4 production. Further studies using selective knockdown of GATA-3 in primary human peripheral blood Th2 cells are needed to confirm whether the differences between the results reported in this study and those seen in murine cells reflect a species difference or are unique to HUT-78 cells. Interestingly, we also demonstrated that culture of peripheral blood cells for 5 days in cell culture resulted in nuclear translocation of GATA-3 independent of whether Th2-inducing conditions were used or not. This suggests that either a component of the cell culture conditions drives GATA-3 translocation or that a constituent of plasma holds GATA-3 within the cytoplasm. An investigation of this effect is beyond the scope of the current manuscript.

In summary, our data provide the first evidence for an active contribution of phosphorylated GATA-3 nuclear import in the regulation of Th2 cytokine gene expression and the critical role of p38 MAPK. Prevention of phosphorylated GATA-3 interaction with importin-{alpha}, by inhibition of p38 MAPK or via other novel strategies, may provide a new approach for the treatment of allergic diseases (44).


   Acknowledgment
 
We thank Professor Malcolm Johnson for helpful discussions.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
P.J.B., I.M.A., and K.I. have received research funding from GlaxoSmithKline and AstraZeneca.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by an unrestricted research grant from GlaxoSmithKline. K.M. was funded by the Thai government, and E.J. was supported by the Asmarley Trust. Back

2 Current address: Division of Respiratory Disease and Tuberculosis, Department of Internal Medicine, Faculty of Medicine, Mahidol University, Siriraj Hospital, Bangkok 10700, Thailand. Back

3 Address correspondence and reprint requests to Dr. Peter J. Barnes, National Heart and Lung Institute, Imperial College London, Dovehouse Street, London SW3 6LY, U.K. E-mail address: p.j.barnes{at}imperial.ac.uk Back

4 Abbreviations used in this paper: NLS, nuclear localization sequence; ATF, activated transcription factor; ChIP, chromatin immunoprecipitation; CIP, calf intestinal phosphatase; DAPI, 4',6'-diamidino-2-phenylindole; NaPi, sodium pyrophosphate; siRNA, small interfering RNA. Back

Received for publication November 9, 2005. Accepted for publication November 22, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Ray, A., L. Cohn. 1999. Th2 cells and GATA-3 in asthma: new insights into the regulation of airway inflammation. J. Clin. Invest. 104: 985-993. [Medline]
  2. Lee, G. R., P. E. Fields, R. A. Flavell. 2001. Regulation of IL-4 gene expression by distal regulatory elements and GATA-3 at the chromatin level. Immunity 14: 447-459. [Medline]
  3. Takemoto, N., K. Arai, S. Miyatake. 2002. Cutting edge: the differential involvement of the N-finger of GATA-3 in chromatin remodeling and transactivation during Th2 development. J. Immunol. 169: 4103-4107. [Abstract/Free Full Text]
  4. Schwenger, G. T., R. Fournier, C. C. Kok, V. A. Mordvinov, D. Yeoman, C. J. Sanderson. 2001. GATA-3 has dual regulatory functions in human interleukin-5 transcription. J. Biol. Chem. 276: 48502-48509. [Abstract/Free Full Text]
  5. Lavenu-Bombled, C., C. D. Trainor, I. Makeh, P. H. Romeo, I. Max-Audit. 2002. Interleukin-13 gene expression is regulated by GATA-3 in T cells: role of a critical association of a GATA and two GATG motifs. J. Biol. Chem. 277: 18313-18321. [Abstract/Free Full Text]
  6. Zhang, D. H., L. Yang, L. Cohn, L. Parkyn, R. Homer, P. Ray, A. Ray. 1999. Inhibition of allergic inflammation in a murine model of asthma by expression of a dominant-negative mutant of GATA-3. Immunity 11: 473-482. [Medline]
  7. Finotto, S., G. T. De Sanctis, H. A. Lehr, U. Herz, M. Buerke, M. Schipp, B. Bartsch, R. Atreya, E. Schmitt, P. R. Galle, et al 2001. Treatment of allergic airway inflammation and hyperresponsiveness by antisense-induced local blockade of GATA-3 expression. J. Exp. Med. 193: 1247-1260. [Abstract/Free Full Text]
  8. Zhu, J., B. Min, J. Hu-Li, C. J. Watson, A. Grinberg, Q. Wang, N. Killeen, J. F. Urban, L. Guo, W. E. Paul. 2004. Conditional deletion of GATA3 shows its essential function in TH1-TH2 responses. Nat. Immunol. 5: 1157-1165. [Medline]
  9. Yamashita, M., M. Ukai-Tadenuma, T. Miyamoto, K. Sugaya, H. Hosokawa, A. Hasegawa, M. Kimura, M. Taniguchi, J. DeGregori, T. Nakayama. 2004. Essential role of GATA3 for the maintenance of type 2 helper T (Th2) cytokine production and chromatin remodeling at the Th2 cytokine gene loci. J. Biol. Chem. 279: 26983-26990. [Abstract/Free Full Text]
  10. Yagi, R., W. Suzuki, N. Seki, M. Kohyama, T. Inoue, T. Arai, M. Kubo. 2002. The IL-4 production capability of different strains of naive CD4+ T cells controls the direction of the Th cell response. Int. Immunol. 14: 1-11. [Abstract/Free Full Text]
  11. Yang, Z., L. Gu, P. H. Romeo, D. Bories, H. Motohashi, M. Yamamoto, J. D. Engel. 1994. Human GATA-3 trans-activation, DNA-binding, and nuclear localization activities are organized into distinct structural domains. Mol. Cell. Biol. 14: 2201-2212. [Abstract/Free Full Text]
  12. Ohno, M., M. Fornerod, I. W. Mattaj. 1998. Nucleocytoplasmic transport: the last 200 nanometers. Cell 92: 327-336. [Medline]
  13. Chook, Y. M., G. Blobel. 2001. Karyopherins and nuclear import. Curr. Opin. Struct. Biol. 11: 703-715. [Medline]
  14. Conti, E., M. Uy, L. Leighton, G. Blobel, J. Kuriyan. 1998. Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin {alpha}. Cell 94: 193-204. [Medline]
  15. Goldfarb, D. S., A. H. Corbett, D. A. Mason, M. T. Harreman, S. A. Adam. 2004. Importin {alpha}: a multipurpose nuclear-transport receptor. Trends Cell Biol. 14: 505-514. [Medline]
  16. Torgerson, T. R., A. D. Colosia, J. P. Donahue, Y. Z. Lin, J. Hawiger. 1998. Regulation of NF-{kappa}B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization sequence of NF-{kappa}B p50. J. Immunol. 161: 6084-6092. [Abstract/Free Full Text]
  17. Stochaj, U., P. Silver. 1992. Nucleocytoplasmic traffic of proteins. Eur. J. Cell Biol. 59: 1-11. [Medline]
  18. Gootenberg, J. E., F. W. Ruscetti, J. W. Mier, A. Gazdar, R. C. Gallo. 1981. Human cutaneous T cell lymphoma and leukemia cell lines produce and respond to T cell growth factor. J. Exp. Med. 154: 1403-1418. [Abstract/Free Full Text]
  19. Staples, K. J., M. Bergmann, P. J. Barnes, R. Newton. 2000. Stimulus-specific inhibition of IL-5 by cAMP-elevating agents and IL-10 reveals differential mechanisms of action. Biochem. Biophys. Res. Commun. 273: 811-815. [Medline]
  20. Caramori, G., S. Lim, K. Ito, K. Tomita, T. Oates, E. Jazrawi, K. F. Chung, P. J. Barnes, I. M. Adcock. 2001. Expression of GATA family of transcription factors in T-cells, monocytes and bronchial biopsies. Eur. Respir. J. 18: 466-473. [Abstract/Free Full Text]
  21. Ito, K., S. Lim, G. Caramori, K. F. Chung, P. J. Barnes, I. M. Adcock. 2001. Cigarette smoking reduces histone deacetylase 2 expression, enhances cytokine expression and inhibits glucocorticoid actions in alveolar macrophages. FASEB J. 15: 1100-1102.
  22. Ito, K., E. Jazrawi, B. Cosio, P. J. Barnes, I. M. Adcock. 2001. p65-activated histone acetyltransferase activity is repressed by glucocorticoids: mifepristone fails to recruit HDAC2 to the p65/HAT complex. J. Biol. Chem. 276: 30208-30215. [Abstract/Free Full Text]
  23. Ito, K., P. J. Barnes, I. M. Adcock. 2000. Glucocorticoid receptor recruitment of histone deacetylase 2 inhibits IL-1beta-induced histone H4 acetylation on lysines 8 and 12. Mol. Cell. Biol. 20: 6891-6903. [Abstract/Free Full Text]
  24. England, K., M. Rumsby. 2003. Methods to study dephosphorylation of protein kinase C in vivo. Methods Mol. Biol. 233: 217-232. [Medline]
  25. Schafer, P. H., S. A. Wadsworth, L. Wang, J. J. Siekierka. 1999. p38{alpha} mitogen-activated protein kinase is activated by CD28-mediated signaling and is required for IL-4 production by human CD4+CD45RO+ T cells and Th2 effector cells. J. Immunol. 162: 7110-7119. [Abstract/Free Full Text]
  26. Mori, A., O. Kaminuma, K. Miyazawa, K. Ogawa, H. Okudaira, K. Akiyama. 1999. p38 mitogen-activated protein kinase regulates human T cell IL-5 synthesis. J. Immunol. 163: 4763-4771. [Abstract/Free Full Text]
  27. Pahl, A., M. Zhang, H. Kuss, I. Szelenyi, K. Brune. 2002. Regulation of IL-13 synthesis in human lymphocytes: implications for asthma therapy. Br. J. Pharmacol. 135: 1915-1926.
  28. Salmon, R. A., I. N. Foltz, P. R. Young, J. W. Schrader. 1997. The p38 mitogen-activated protein kinase is activated by ligation of the T or B lymphocyte antigen receptors, Fas or CD40, but suppression of kinase activity does not inhibit apoptosis induced by antigen receptors. J. Immunol. 159: 5309-5317. [Abstract]
  29. Matsuda, S., T. Moriguchi, S. Koyasu, E. Nishida. 1998. T lymphocyte activation signals for interleukin-2 production involve activation of MKK6-p38 and MKK7-SAPK/JNK signaling pathways sensitive to cyclosporin A. J. Biol. Chem. 273: 12378-12382. [Abstract/Free Full Text]
  30. Chialda, L., M. Zhang, K. Brune, A. Pahl. 2005. Inhibitors of mitogen-activated protein kinases differentially regulate costimulated T cell cytokine production and mouse airway eosinophilia. Respir. Res. 6: 36[Medline]
  31. Zhang, J., K. V. Salojin, J. X. Gao, M. J. Cameron, I. Bergerot, T. L. Delovitch. 1999. p38 mitogen-activated protein kinase mediates signal integration of TCR/CD28 costimulation in primary murine T cells. J. Immunol. 162: 3819-3829. [Abstract/Free Full Text]
  32. Koprak, S., M. J. Staruch, F. J. Dumont. 1999. A specific inhibitor of the p38 mitogen activated protein kinase affects differentially the production of various cytokines by activated human T cells: dependence on CD28 signaling and preferential inhibition of IL-10 production. Cell. Immunol. 192: 87-95. [Medline]
  33. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, Y. Ben Neriah. 1994. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77: 727-736. [Medline]
  34. Schaeffer, H. J., M. J. Weber. 1999. Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol. Cell. Biol. 19: 2435-2444. [Free Full Text]
  35. Nunes, J. A., M. Battifora, J. R. Woodgett, A. Truneh, D. Olive, D. A. Cantrell. 1996. CD28 signal transduction pathways: a comparison of B7-1 and B7-2 regulation of the MAP kinases: ERK2 and Jun kinases. Mol. Immunol. 33: 63-70. [Medline]
  36. Li, L., C. Yee, J. A. Beavo. 1999. CD3- and CD28-dependent induction of PDE7 required for T cell activation. Science 283: 848-851. [Abstract/Free Full Text]
  37. Chen, C. H., D. H. Zhang, J. M. LaPorte, A. Ray. 2000. Cyclic AMP activates p38 mitogen-activated protein kinase in Th2 cells: phosphorylation of GATA-3 and stimulation of Th2 cytokine gene expression. J. Immunol. 165: 5597-5605. [Abstract/Free Full Text]
  38. Xiao, C. Y., S. Hubner, D. A. Jans. 1997. SV40 large tumor antigen nuclear import is regulated by the double-stranded DNA-dependent protein kinase site (serine 120) flanking the nuclear localization sequence. J. Biol. Chem. 272: 22191-22198. [Abstract/Free Full Text]
  39. Underwood, D. C., R. R. Osborn, C. J. Kotzer, J. L. Adams, J. C. Lee, E. F. Webb, D. C. Carpenter, S. Bochnowicz, H. C. Thomas, D. W. Hay, D. E. Griswold. 2000. SB 239063, a potent p38 MAP kinase inhibitor, reduces inflammatory cytokine production, airways eosinophil infiltration, and persistence. J. Pharmacol. Exp. Ther. 293: 281-288. [Abstract/Free Full Text]
  40. Duan, W., J. H. Chan, K. McKay, J. R. Crosby, H. H. Choo, B. P. Leung, J. G. Karras, W. S. Wong. 2005. Inhaled p38{alpha} mitogen-activated protein kinase antisense oligonucleotide attenuates asthma in mice. Am. J. Respir. Crit. Care Med. 171: 571-578. [Abstract/Free Full Text]
  41. Barnes, P. J.. 2006. Novel signal transduction modulators for the treatment of airway diseases. Pharmacol. Ther. 109: 238-245. [Medline]
  42. Barnes, P. J.. 2004. New drugs for asthma. Nat. Rev. Drug Discov. 3: 831-844. [Medline]
  43. Yamane, H., J. Zhu, W. E. Paul. 2005. Independent roles for IL-2 and GATA-3 in stimulating naive CD4+ T cells to generate a Th2-inducing cytokine environment. J. Exp. Med. 202: 793-804. [Abstract/Free Full Text]
  44. Nakamura, Y., M. Hoshino. 2005. TH2 cytokines and associated transcription factors as therapeutic targets in asthma. Curr. Drug Targets Inflamm. Allergy 4: 267-270. [Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Suzuki, X. Zheng, X. Zhang, M. Li, C. Vladau, T. E. Ichim, H. Sun, L. R. Min, B. Garcia, and W.-P. Min
Novel Vaccination for Allergy through Gene Silencing of CD40 Using Small Interfering RNA
J. Immunol., June 15, 2008; 180(12): 8461 - 8469.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
D. Inman, K. Kawana, D. Schust, R. Lininger, and S. Young
Cyclic Regulation of T-Bet and GATA-3 in Human Endometrium
Reproductive Sciences, January 1, 2008; 15(1): 83 - 90.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maneechotesuwan, K.
Right arrow Articles by Adcock, I. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maneechotesuwan, K.
Right arrow Articles by Adcock, I. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS