The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Wang, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Wang, J. M.
The Journal of Immunology, 2007, 178: 1759-1766.
Copyright © 2007 by The American Association of Immunologists, Inc.

Induction of the Formyl Peptide Receptor 2 in Microglia by IFN-{gamma} and Synergy with CD40 Ligand1,2

Keqiang Chen*,§, Pablo Iribarren*, Jian Huang*, Lingzhi Zhang, Wanghua Gong{ddagger}, Edward H. Cho{dagger}, Stephen Lockett{dagger}, Nancy M. Dunlop* and Ji Ming Wang3,*

* Laboratory of Molecular Immunoregulation, Center for Cancer Research, National Cancer Institute-Frederick, Frederick, MD 21702; {dagger} Image Analysis Laboratory and {ddagger} Basic Research Program, Science Applications International Corporation, National Cancer Institute at Frederick, Frederick, MD 21702; § School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China; and Shanghai Asia United Antibody Medical, Shanghai, China


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human formyl peptide receptor (FPR)-like 1 (FPRL1) and its mouse homologue mFPR2 are functional receptors for a variety of exogenous and host-derived chemotactic peptides, including amyloid beta 1–42 (Abeta42), a pathogenic factor in Alzheimer’s disease. Because mFPR2 in microglial cells is regulated by proinflammatory stimulants including TLR agonists, in this study we investigated the capacity of IFN-{gamma} and the CD40 ligand (CD40L) to affect the expression and function of mFPR2. We found that IFN-{gamma}, when used alone, induced mFPR2 mRNA expression in a mouse microglial cell line and primary microglial cells in association with increased cell migration in response to mFPR2 agonists, including Abeta42. IFN-{gamma} also increased the endocytosis of Abeta42 by microglial cells via mFPR2. The effect of IFN-{gamma} on mFPR2 expression in microglial cells was dependent on activation of MAPK and I{kappa}B-{alpha}. IFN-{gamma} additionally increased the expression of CD40 by microglial cells and soluble CD40L significantly promoted cell responses to IFN-{gamma} during a 6-h incubation period by enhancing the activation of MAPK and I{kappa}B-{alpha} signaling pathways. We additionally found that the effect of IFN-{gamma} and its synergy with CD40L on mFPR2 expression in microglia was mediated in part by TNF-{alpha}. Our results suggest that IFN-{gamma} and CD40L, two host-derived factors with increased concentrations in inflammatory central nervous system diseases, may profoundly affect microglial cell responses in the pathogenic process in which mFPR2 agonist peptides are elevated.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Alzheimer’s disease (AD)4 is a progressive neurodegenerative disease that affects ~30 million individuals worldwide (1). A hallmark of AD is the presence of senile plaques characterized by the deposition of aberrantly produced amyloid peptides (Abeta), in particular the 42-aa form Abeta42, in association with neuronal damage (1, 2, 3, 4). In addition to its direct neurotoxicity (5), Abeta42 is a potent activator of microglia, the mononuclear phagocytes in the brain that surround and infiltrate senile plaques composed of Abeta deposits and neurofibrillary tangles in AD (6, 7). In vitro, Abeta42 induces the chemotaxis and release of neurotoxins by mouse microglial cells activated by proinflammatory stimulants (8, 9) through the mouse formyl peptide receptor 2 (mFPR2), a seven-transmembrane, G protein-coupled receptor. The human homologue of mFPR2, formyl peptide receptor-like 1 (FPRL1), was originally identified as a low-affinity receptor for the bacterial chemotactic peptide formyl-methionyl-leucyl-phenylalanine (fMLF) (10). FPRL1 also contributes to the internalization of Abeta42 into the cytoplasmic compartment of macrophages where Abeta42 forms fibrillary aggregates (11, 12). Interestingly, in mouse microglia the expression of the FPRL1 counterpart mFPR2 was markedly enhanced when the cells were activated by ligands for TLRs such as LPS (a ligand for TLR4), CpG (a ligand for TLR9), PGN (a ligand for TLR2), and the proinflammatory cytokine TNF-{alpha} (13, 14, 15, 16). Thus, the expression of mFPR2 in microglial cells is subject to up-regulation by both pathogen- and host-derived molecules associated with inflammatory responses.

IFN-{gamma} is a pleiotropic cytokine involved in the regulation of nearly all phases of immune and inflammatory responses, including the activation, growth, and differentiation of T cells, B cells, macrophages, NK cells, and other cell types such as endothelial cells and fibroblasts. In microglial cells, IFN-{gamma} induces changes in the expression level of at least 450 genes encoding chemokines, signaling molecules, and the MHC (17). IFN-{gamma} also increases microglial responses to Abeta peptides by the production of proinflammatory and neurotoxic mediators (18). Although under physiological conditions IFN-{gamma} remains low or absent in brain parenchyma, in inflammatory and immunological disease states of the CNS, IFN-{gamma} is significantly elevated presumably because of production by infiltrating T lymphocytes and NK cells (19). Moreover, nonimmune cells of the CNS such as astroglia and neuronal cells have also been reported as potential sources of IFN-{gamma} (20, 21, 22). In a transgenic mouse model, overexpression of IFN-{gamma} in the hippocampus markedly increased the reactivity of microglial cells and their production of proinflammatory cytokines (23). The production of IFN-{gamma} and other proinflammatory cytokines is particularly high in old age (24, 25). In addition, in aged human and rodent brains the level of constitutively produced IFN-{gamma} is significantly higher than in the younger counterparts (26). Therefore, IFN-{gamma} is not only a potent activator of microglial cells and plays an important role in inflammatory CNS diseases but also is also considered a risk factor for AD (27).

To further elucidate the role of IFN-{gamma} in CNS inflammation and immune responses, in this study we investigated the capacity of this Th1 cytokine to regulate the expression and function of mFPR2 in microglia. We report that microglial cells stimulated with IFN-{gamma} expressed high levels of mFPR2 and migrate in response to a variety of mFPR2 agonist peptides including Abeta42. We additionally observed that IFN-{gamma} treatment enhanced the capacity of microglial cells to uptake Abeta42 through mFPR2. Furthermore, IFN-{gamma} up-regulated the expression of CD40 on the microglial cell surface, and soluble CD40 ligand (CD40L) markedly increased the effect of IFN-{gamma} on the expression of mFPR2. Our study suggests that IFN-{gamma} and CD40 may profoundly affect microglial cell responses in the pathogenic process of proinflammatory CNS diseases in which mFPR2 agonist peptides are elevated.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Reagents and cells

Recombinant murine IFN-{gamma} and recombinant murine soluble (s) CD40L were purchased from PeproTech. A neutralizing anti-TNF-{alpha} Ab and isotype Ab rat IgGI{kappa} were purchased from Endogen. fMLF and LPS were purchased from Sigma-Aldrich. SB202190, PD098059, and BAY117082 were obtained from Calbiochem. The Abeta42 peptide was from California Peptide Research. Abs specific for total ERK1/2, ERK1/2 phosphorylated (p-) at Tyr204 (p-ERK), total p38 MAPK, p-p38 MAPK, total I{kappa}B-{alpha} and p-I{kappa}B-{alpha}, total Akt, and Akt phosphorylated at Ser473 (p-Akt) were purchased from Cell Signaling Technology. The murine microglial cell line N9 was a gift from Dr. P. Ricciardi-Castagnoli (Universita Degli Studi di Milano-Bicocca, Milan, Italy) and was grown in IMDM supplemented with 5% heat-inactivated FCS, 2 mM glutamine, 100 U/ml penicillin, 100 g/ml streptomycin, and 50 µM 2-ME. Primary murine microglial cells were isolated from 1-day-old newborn C57BL/6 mice and grown in DMEM supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 M HEPES, 2.5 µg/ml Fungizone, 100 µM nonessential amino acids, and 5 µg/ml insulin. N9 cells grown to 4.0 x 106 cells per 25-cm2 flask were used for experiments except for Western immunoblotting, in which 1 x 106 cells/well cultured on 6-well plates were used. Primary microglial cells isolated from newborn mice were cultured at 1.0 x 106 cells/ml in 5-ml polypropylene round-bottom tubes (BD Labware) for experiments.

Chemotaxis assays

Chemotaxis assays for microglial cells were performed with 48-well chemotaxis chambers and polycarbonate filters (8-µm pore size) (NeuroProbe) as described (15, 28). The results are expressed as the mean ± SD of the chemotaxis index (CI), which represents the fold increase in the number of migrated cells counted in three high-power fields (x400) in response to chemoattractants over spontaneous cell migration (to control medium).

RT-PCR

Total RNA was extracted from cells with a RNeasy mini kit and depleted of contaminating DNA with RNase-free DNase (Qiagen). For amplification of the mFPR2 gene, primers 5'-TCTACCATCTCCAGAGTTCTGTTGG-3' (sense) and 5'-TACATCTACCACAATGTGAACTA-3' (antisense) were designed to yield a 268-bp product. Mouse beta-actin primers were TGTGATGGTGGGAATGGGTCA (sense) and TTTGATGTGACGCACGATTTCCC (antisense), which yield a product of 514 bp. Mouse CD40 primers were CGCTATGGGGCTGCTTGTTGACAG (sense) and GACGGTATCAGTGGTCTCAGTGGC (antisense), which yield a product of 400 bp. RT-PCR was performed with 0.5 µg of total RNA for each sample (High Fidelity ProSTAR HF system; Stratagene), consisting of a 15-min reverse transcription at 37°C, 1 min inactivation of Moloney murine leukemia virus reverse transcriptase at 95°C, 40 cycles of denaturing at 95°C (45 s), annealing at 55°C (45 s), and extension at 72°C (1 min) with a final extension for 10 min at 72°C. All PCR products were resolved by 1.5% agarose gel electrophoresis and visualized with ethidium bromide. For quantitation, gels were scanned and the pixel intensity for each band was determined using the ImageJ program (NIH Image) and normalized to the amount of beta-actin.

Fluorescence confocal microscopy

N9 cells were seeded at 2.8 x 104 cells/well on eight-well chamber slides (Nalge Nunc International) for 24 h. The cells were then treated at 37°C with IFN-{gamma} or CD40L or both in combination for 12 h. Activated N9 cells were further treated in the presence or absence of G protein receptor deactivator pertussis toxin (PTX) for 1 h followed by Abeta42 (50 µg/ml) for 30 min. The cells were fixed in 2% paraformaldehyde for 20 min at room temperature, washed with PBS, and incubated with 5% normal goat serum (Sigma-Aldrich) in PBS plus 0.05% Tween 20 for 1 h to reduce nonspecific binding of Abs to the cell surface and for cell permeabilization. An anti-Abeta42 Ab (Sigma-Aldrich) was applied to the slides, which were further incubated for 1 h at room temperature. After three rinses with PBS, the slides were incubated with FITC-conjugated goat anti-mouse IgG (BD Pharmingen) in TBS containing 1% BSA for 60 min. After three washes with PBS, the slides were stained with propidium iodide (PI) for 20 min at room temperature. The slides were mounted with an anti-fade, water-based mounting medium and analyzed under a laser-scanning confocal fluorescence microscope (Zeiss LSM510 NLO Meta). Excitation wavelengths of 488 nm (for FITC) and 561 nm (for PI) were used to generate fluorescence emission in green (for Abeta42) and red (for nuclei), respectively. The intensity of green fluorescence detected for Abeta42 was analyzed with ImageJ (NIH software).

Flow cytometry

N9 cells or primary mouse microglial cells stimulated with IFN-{gamma} alone or in combination with CD40L were examined for the expression of CD40 by labeling with PE-conjugated mAbs (BD Pharmingen). All staining procedures were completed at 4°C in Dulbecco’s PBS containing 5 mM EDTA and 1% FCS. After extensive washing, the cells were analyzed using a FACScan flow cytometer (BD Biosciences).

Western immunoblotting

N9 cells grown to 1 x 106 cells/well in 6-well plates were cultured overnight in FCS-free medium and stimulated with 10 ng/ml IFN-{gamma} and 1 µg/ml CD40L each or in combination. LPS (300 ng/ml) was used as a positive control. The cells were lysed with 1 x SDS sample buffer (62.5 mM Tris-HCI (pH 6.8), 2% SDS, 10% glycerol, and 50 mM DTT), sonicated for 15 s, and then heated at 100° C for 5 min. The cell lysate was centrifuged at 12,000 rpm (4°C) for 5 min, and the protein concentration of the supernatant was measured by the Micro BCA protein assay system (Pierce). Proteins (50 µg for each sample) were resolved by 10% SDS-PAGE (Invitrogen Life Technologies) and transferred onto nitrocellulose membranes (Bio-Rad). The membranes were blocked for 2 h at room temperature in 3% nonfat milk prepared in Tris-buffered saline-T (10 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 0.1% Tween 20) and probed with anti-p-p38, p-ERK1/2, p-I{kappa}B-{alpha} Abs overnight at 4°C. The membranes were then washed and incubated with HRP-conjugated secondary Ab for 1 h at room temperature. The proteins were visualized using a SuperSignal chemiluminescent substrate (Pierce) and BIOMAX-MR film (Eastman Kodak). For detection of total p38, ERK1/2, and I{kappa}B-{alpha}, the membranes were stripped with Restore Western blot stripping buffer (Pierce) followed by incubation with specific Abs.

Statistical analysis

All experiments were performed at least three times. The statistical significance of the differences in the mean values (±SD) between test and control groups was analyzed with a two-tailed t test. All mean values (±SD) were obtained from at least three experiments. p values equal to or <0.05 were considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
IFN-{gamma} induces the expression of functional mFPR2 in microglia

The mouse microglial cell line N9 and primary microglial cells treated with IFN-{gamma} increased their expression of mFPR2 mRNA. The effect of IFN-{gamma} was concentration and time dependent (Fig. 1, A and B), with optimal induction of mFPR2 at 10 ng/ml for 12 h. Although nonstimulated primary microglial cells isolated from the brains of newborn mice expressed a relatively higher baseline level of mFPR2 mRNA as compared with nonstimulated N9 cells (13), this was probably due to a higher level of activation or differentiation status of the primary cells. Nevertheless, IFN-{gamma} treatment also significantly enhanced the level of mFPR2 mRNA in these cells (Fig. 1C). The increased mFPR2 mRNA expression in IFN-{gamma}-stimulated N9 microglial cells was associated with cell chemotaxis in response to mFPR2 agonist peptides, including fMLF derived from Gram-negative bacteria and Abeta42 associated with AD (Fig. 2, A and B). Similar results were obtained with primary murine microglial cells (Fig. 2, C and D).


Figure 1
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 1. Up-regulation of mFPR2 mRNA in murine microglial cells by IFN-{gamma}. N9 cells (4.0 x 106 cells per 25-cm2 flask) were incubated with various concentrations of IFN-{gamma} for 24 h (A) or with IFN-{gamma} at 10 ng/ml for the indicated time intervals, and cells treated with LPS (300 ng/ml) for 36 h were used as a control (B). Total RNA was extracted and examined for mFPR2 mRNA expression by RT-PCR. C, Primary microglial cells (1.0 x 106 cells/ml) were stimulated with 10 ng/ml IFN-{gamma} for 24 h and the mRNA was examined for mRNA of mFPR2. The RT-PCR products were electrophoresed on a 1.5% agarose gel and visualized with ethidium bromide staining. The density of product bands was measured by ImageJ (NIH software) with normalization against beta-actin bands. *, Significantly increased cell migration (p < 0.05) as compared with medium control.

 

Figure 2
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 2. mFPR2 agonist-induced chemotaxis of microglial cells stimulated by IFN-{gamma}. N9 cells (4.0 x 106 cells per 25-cm2 flask) (A and B) or primary mouse microglial cells (1.0 x 106 cells/ml) (C and D) were incubated with 10 ng/ml IFN-{gamma} for 24 h. The cells were examined for migration in response to fMLF (10–5 M) or Abeta42 (50 µg/ml). E, LPS (100 ng/ml) or IFN-{gamma} (10 ng/ml) preincubated with polymyxin B (PolyB; 10 µg/ml) for 1 h at 37°C was used to stimulate N9 cells for 24 h at 37°C, and the cells were then examined for migration in response to fMLF (10–5 M). The results are expressed as the CI, representing the fold increase in cell migration in response to chemoattractants vs medium control. *, Significantly increased cell migration (p < 0.05) as compared with medium control (A–D); #, significantly reduced cell responses (p < 0.05) as compared with cells treated with LPS alone (E).

 
To ascertain the purity of IFN-{gamma}, we tested polymyxin B, an LPS inhibitor, and found that it did not affect the capacity of IFN-{gamma} to induce the expression of functional mFPR2 in microglial cells. In contrast, polymyxin B inhibited the effect of LPS on mFPR2 induction (Fig. 2E). Thus, the capacity of IFN-{gamma} to induce mFPR2 in mouse microglial cells was not dependent on contaminating LPS.

Involvement of MAPK in the up-regulation of mFPR2 in microglial cells by IFN-{gamma}

Because it has been reported that IFN-{gamma} activates MAPKs and NF-{kappa}B in microglial cells (29, 30), we assessed their role in IFN-{gamma} induction of mFPR2. Fig. 3 shows that the level of mFPR2 mRNA induced by IFN-{gamma} was significantly reduced in microglial cells when the cells were pretreated with SB202190, a p38 MAPK inhibitor, the MEK-ERK1/2 inhibitor PD98059, or the highly selective I{kappa}B-{alpha} phosphorylation inhibitor BAY117082 (Fig. 3, A–C). This was accompanied by attenuated cell migration in response to mFPR2 agonist (Fig. 3, D–F). These results suggest that p38 and ERK1/2 MAPKs as well as NF-{kappa}B are important mediators for IFN-{gamma} to induce the expression of functional mFPR2 in microglial cells.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 3. Activation of MAPKs and I{kappa}B-{alpha} by IFN-{gamma} in microglial cells. N9 cells (4.0 x 106 cells per 25-cm2 flask) were pretreated for 1 h at 37°C in the presence of different concentrations of SB202190 (SB) (A), PD98059 (PD) (B), or BAY117082 (BAY) (C) before stimulation with 10 ng/ml IFN-{gamma} for an additional 24 h at 37°C. LPS (300 ng/ml, 24 h at 37°C) was used as a positive control (A–C). Total cellular RNA was extracted and examined for mFPR2 mRNA expression by RT-PCR. The RT-PCR products were electrophoresed and visualized with ethidium bromide staining. D–F, Primary mouse microglial cells (1.0 x 106 cells/ml) were pretreated for 1 h at 37°C in the presence of SB202190 (SB) (D), PD98059 (PD) (E), or BAY117082 (BAY) (F) before stimulation with 10 ng/ml IFN-{gamma} for additional 24 h at 37°C. The cells were then examined for migration in response to fMLF (10–5 M). *, Significantly decreased mFPR2 mRNA or cell migration (p < 0.05) as compared with cells treated with IFN-{gamma} alone.

 
IFN-{gamma} and CD40L synergistically increase CD40 expression by microglia

Because IFN-{gamma} has been reported to increase the expression of CD40 by microglial cells, which, in turn, are further activated by CD40 to produce proinflammatory cytokines, we examined whether CD40 participates in the regulation of mFPR2. We found that, consistent with the previously published results (31, 32, 33, 34), nonstimulated N9 microglial cells expressed low levels of CD40 mRNA and cell surface CD40 protein, but the expression was progressively increased after stimulation with IFN-{gamma} as well as CD40L. As shown in Fig. 4, CD40 mRNA was rapidly up-regulated by IFN-{gamma} or CD40L alone at 3 h after stimulation (Fig. 4A). The effect was pronounced when IFN-{gamma} and CD40L were used in combination. This was accompanied by an up-regulated cell surface expression of CD40 (Fig. 4B). The effect of IFN-{gamma} alone was delayed and a significantly up-regulated cell surface CD40 was seen at 12 h (Fig. 4C). These results suggest that although CD40L and IFN-{gamma} each enhances the expression of CD40 in microglial cells, their combination results in a more rapid up-regulation. In contrast, unlike CD40, the expression of CD14 in microglial cells was not changed by treatment with IFN-{gamma} or CD40L at the time points tested in this study (data not shown), indicating their preferential regulatory activity.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 4. Up-regulation of CD40 in microglial cells by IFN-{gamma}. A and B, N9 cells (4.0 x 106 cells per 25-cm2 flask) were stimulated with 10 ng/ml IFN-{gamma}, 1 µg/ml CD40L, or in combination for 3–6 h and then examined for the mRNA of mouse CD40. The RT-PCR products were electrophoresed and visualized with ethidium bromide. The density of the RT-PCR product bands was measured by ImageJ (NIH software) with normalization against beta-actin bands. *, Significantly increased mCD40 mRNA (p < 0.05) as compared with medium control; #, significantly increased mCD40 mRNA (p < 0.05) as compared with cells treated with IFN-{gamma} or CD40L alone for 3 h (A). Murine primary microglial cells (1.0 x 106 cells/ml) were stimulated with 10 ng/ml IFN-{gamma}, 1 µg/ml CD40L, or in combination for 6 h and then examined for surface expression of CD40 by flow cytometry (B). C, N9 cells (4.0 x 106 cells per 25-cm2 flask) cultured in the presence or absent of IFN-{gamma} (10 ng/ml) for the indicated time intervals were examined for surface expression of CD40 by flow cytometry. The results are presented as mean fluorescence intensity (MFI) and percentage of positive cells in histograms.

 
CD40L and IFN-{gamma} synergistically promote the expression and function of mFPR2 in microglial cells

We then examined the function of CD40 expressed by IFN-{gamma} stimulated microglial cells. Fig. 5A shows cross-linking of the low levels of CD40 on nonstimulated microglia by its soluble ligand (CD40L) did not induce the expression of mFPR2 mRNA, nor did CD40L treatment promote the chemotaxis responses of the cells to mFPR2 agonist peptides. However, CD40L markedly enhanced the expression of mFPR2 by microglial cells incubated with IFN-{gamma} for 6 h, when the effect of IFN-{gamma} on mFPR2 gene expression was at a low level (Fig. 5B). The same results were observed in experiments with primary mouse microglial cells (Fig. 5C). We also found that pretreatment of microglial cells with IFN-{gamma} for 2 h followed by CD40L for 4 h was sufficient to significantly enhance the expression of mFPR2 in microglial cells (Fig. 5D), in association with increased cell chemotaxis (Fig. 5E).


Figure 5
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 5. Synergistic effect of IFN-{gamma} and CD40L on induction of mFPR2 mRNA in microglial cells. A and B, N9 cells (4.0 x 106 cells per 25-cm2 flask) were stimulated in the presence or absence of IFN-{gamma} (10 ng/ml), CD40L (1 µg/ml), or LPS (300 ng/ml) for 24 h (A) or for different time periods (B). C, Mouse primary microglial cells were incubated with IFN-{gamma} (10 ng/ml), CD40L (1 µg/ml), or in combination for 6 h. Total RNA of the cells was extracted and examined for mFPR2 mRNA by RT-PCR. The RT-PCR products were electrophoresed and visualized with ethidium bromide. The density of the RT-PCR product bands was measured by ImageJ (NIH software) and normalized against beta-actin. *, Significantly increased mFPR2 mRNA (p < 0.05) as compared with cells treated with IFN-{gamma} alone. D, N9 cells (4.0 x 106 cells per 25-cm2 flask) treated with IFN-{gamma} (10 ng/ml) for a total of 6 h in the presence of CD40L for different times (hours) followed by the measurement of mFPR2 mRNA expression with RT-PCR. E, Mouse primary microglial cells (1.0 x 106/ml) incubated with IFN-{gamma} (10 ng/ml), CD40L (1 µg/ml), or in combination for 6 h were examined for migration in response to fMLF (10–5 M). The results are expressed as a CI representing the fold increase in cell migration in response to chemoattractants vs medium control. *, Significantly increased cell migration (p < 0.05) as compared with cells treated in the absence of cytokines; #, significantly increased cell migration (p < 0.05) as compared with cells treated with IFN-{gamma} alone.

 
CD40L and IFN-{gamma} synergistically promote the uptake of Abeta42 peptide by microglia through mFPR2

As our previous studies showed that microglial cells activated by TLR agonists increased their capacity to uptake Abeta42 peptides via mFPR2 (14, 15), we therefore investigated whether cells treated by IFN-{gamma} in the presence or absence of CD40L also might increase Abeta42 ingestion. Fig. 6 shows that N9 microglial cells treated with IFN-{gamma} alone increased their capacity to endocytose Abeta42 peptide as measured by confocal microscopy (Fig. 6A). In contrast, whereas CD40L alone slightly increased the levels of Abeta42 fluorescence in microglial cells, its combination with IFN-{gamma} resulted in a markedly enhanced Abeta42 localization in the cytoplasmic compartment of microglial cells as shown by significantly increased values of the fluorescence intensity (FI) for cell-associated Abeta42 and increased percentage of Abeta42-positive cells (Fig. 6, B and C). The results were confirmed with primary microglial cells (Fig. 6, D and E). The ingestion of Abeta42 by microglial cells stimulated with IFN-{gamma} or in combination with CD40L was significantly inhibited by PTX, an inhibitor of G{alpha}i protein-coupled receptors, or by another mFPR2 agonist, W pep (Fig. 6 and data not shown), suggesting that mFPR2 is involved in Abeta42 uptake by microglia activated by IFN-{gamma} alone or in combination with CD40L. Interestingly, a slightly increased Abeta42 uptake by microglial cells treated with CD40L alone was not inhibited by PTX, suggesting that CD40L may increase the expression of other putative Abeta42 binding molecules that might weakly assist in cell uptake of Abeta42 (35).


Figure 6
View larger version (62K):
[in this window]
[in a new window]

  		FIGURE 6. The uptake of Abeta42 by microglial cells. N9 cells treated for 24 h in the presence or absence of IFN-{gamma} (10 ng/ml), CD40L (1 µg/ml), or a combination of IFN-{gamma} (10 ng/ml) and CD40L (1 µg/ml) were further incubated with Abeta42 for 30 min. The intracellular Abeta42 was detected by a FITC-conjugated anti-Abeta42 Ab in green fluorescence by confocal microscopy. The nuclei of the cells are shown in red with PI (A). The intensity of green fluorescence detected for Abeta42 was analyzed with ImageJ (NIH software) in alphabetical order. The results are expressed as the fold increase in FI over medium control (B). The percentage of Abeta42-positive cells was calculated in each group (C). Primary microglial cells seeded on eight-well chamber slides were treated with IFN-{gamma} (10 ng/ml), CD40L (1 µg/ml), or in combination for 24 h at 37°C. The cells then incubated with Abeta42 for 30 min. Cell-associated Abeta42 was detected by a FITC-conjugated anti-Abeta42 Ab in green fluorescence, and the nuclei of the cells are shown in red with PI (D). The results are expressed as the fold increase in FI over the control cell (Medium) (Ea). *, Significantly increased Abeta42 FI or percentage of Abeta42-positive cells as compared with cells treated with medium alone (p < 0.05) (B and C); #, significantly decreased Abeta42 FI or percentage of Abeta42-positive cells as compared with cells treated with IFN-{gamma} alone (p < 0.05) (B and C). {diamond}, Significantly increased Abeta42 FI as compared with cells treated with IFN-{gamma} alone (p < 0.05) (Ec).

 
Enhanced activation of MAPKs and I{kappa}B-{alpha} in microglial cells stimulated by IFN-{gamma} and CD40L

To elucidate the mechanistic basis for the synergistic effect of CD40L and IFN-{gamma} on the induction of mFPR2 in microglial cells, we evaluated the activation of signaling pathways involving MAPKs and I{kappa}B-{alpha}, a key molecule controlling the activation of NF-{kappa}B. In N9 cells treated with IFN-{gamma} alone, phosphorylation of p38 was detected at 1 h, whereas activated ERK1/2 and I{kappa}B-{alpha} were detected at 6 h (Fig. 7A). IFN-{gamma} did not induce detectable levels of phosphorylated JNK in microglial cells (data not shown). In contrast, microglial cells treated with CD40L alone showed detectable phosphorylation of p38, ERK1/2, and I{kappa}B at 1 h. Furthermore, microglial cells pretreated with IFN-{gamma} for 3 h followed by stimulation with CD40L showed a more rapid phosphorylation of p38, ERK1/2 (15 min), and I{kappa}B-{alpha} (30 min) (Fig. 7B). It is interesting to note a unique pattern of phosphorylated vs nonphosphorylated I{kappa}B-{alpha} species in microglial cell stimulated by both IFN-{gamma} and CD40L, presumably caused by the rapid degradation and de novo synthesis of the I{kappa}B-{alpha} species. These results indicate that IFN-{gamma} and CD40L synergistically activate important signaling molecules involved in promoting the expression of mFPR2 in microglial cells.


Figure 7
View larger version (48K):
[in this window]
[in a new window]

  		FIGURE 7. The synergistic effect of IFN-{gamma} and CD40L on activation of MAPK and I{kappa}B-{alpha} cascade in murine microglia. A, N9 cells (1.0 x 106 cells/well) were stimulated with 10 ng/ml IFN-{gamma} for different time periods (min). B, N9 cells were treated with 1 µg/ml CD40L for different time periods (minutes), or CD40L (1 µg/ml) for different time points (min) after the cells were pretreated with IFN-{gamma} (10 ng/ml) for 3 h. LPS (300 ng/ml, 60 min) was used as a positive control. Whole cell lysates were electrophoresed on a 10% SDS-polyacrylamide gel. Western immunoblotting was performed using Abs specific for the p-p38, p-ERK1/2, or p-I{kappa}B-{alpha}, respectively. The membranes were then stripped and reprobed with Abs against total p38, ERK or I{kappa}B-{alpha} as protein loading controls.

 
Involvement of TNF-{alpha} in the induction of mFPR2 by IFN-{gamma} and CD40L

Because IFN-{gamma} has been reported to induce TNF-{alpha} expression in a variety of cell types including microglia and, more importantly, since our previous study showed that TNF-{alpha} (18, 36, 37, 38) is a potent inducer of mFPR2 in microglial cells (16), we assessed whether TNF-{alpha} is involved in the effect of IFN-{gamma} on mFPR2 expression. We found that a TNF-{alpha}-neutralizing Ab reduced the level of mFPR2 expression in both a microglial cell line (29 ± 4%) and in primary microglial cells (70 ± 3%) stimulated by IFN-{gamma} (Fig. 8, A and B). The anti-TNF-{alpha} Ab also partially inhibited the synergistic induction of mFPR2 by IFN-{gamma} in combination with CD40L (37 ± 4%) (Fig. 8C). These results confirmed the previously reported capacity of IFN-{gamma} to induce the production of TNF-{alpha} by microglial cells and indicate that TNF-{alpha} contributes to the induction of mFPR2 by IFN-{gamma} and its synergy with CD40L in microglial cells.


Figure 8
View larger version (19K):
[in this window]
[in a new window]

  		FIGURE 8. Involvement of TNF-{alpha} in the induction of mFPR2 in microglia by IFN-{gamma} and CD40L. N9 cells (4.0 x 106 cells per 25-cm2 flask) (A and C) or mouse primary microglial cells (1.0 x 106 cells/ml) (B) were treated with IFN-{gamma} and CD40L in the presence of an anti-TFN-{alpha} Ab for 6, 12, or 6 h, respectively. An isotype-matched mouse IgG (20 µg/ml) was used as a control. Total RNA was extracted and examined for mFPR2 mRNA expression by RT-PCR. The RT-PCR products were electrophoresed and visualized with ethidium bromide staining. The density of the RT-PCR products was measured by ImageJ (NIH software) and normalized against beta-actin. *, Significantly reduced (p < 0.05) mFPR2 mRNA as compared with the cells treated with IFN-{gamma} alone, CD40L alone, or in combination.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we identified IFN-{gamma} as an inducer of functional mFPR2 in murine microglial cells. The effect of IFN-{gamma} is further increased by cross-linking CD40, which is up-regulated on the cell surface of IFN-{gamma}-activated microglial cells. This is the first demonstration of the synergistic regulation by two host-derived factors of the G protein-coupled receptor mFPR2 in microglial cells. As a consequence, microglial cells exhibited markedly increased chemotaxis in response to mFPR2 agonist peptides and endocytosis of Abeta42, a principal pathogenic factor of AD.

Although IFN-{gamma} is a classical T and NK cell cytokine produced mainly in the peripheral tissues during inflammatory and immune responses, its immunoreactivity and gene expression have been detected in human sensory neurons in the CNS (22). In addition, it has been reported that human glial cells and rat astrocytes have the capacity to produce IFN-{gamma} after stimulation with proinflammatory cytokines (20, 21, 37). Alternatively, under proinflammatory and immunological conditions in the CNS, T lymphocytes, which are capable of crossing the blood-brain barrier (BBB), may become a major source of IFN-{gamma}. In fact, multiple pathogenic factors are capable of disrupting the integrity of BBB, allowing for the entry of T cells to the brain parenchyma in response to locally produced chemoattractants, mainly chemokines produced by activated astrocytes and microglial cells (27, 39). It is interesting to note that increased levels of IFN-{gamma} are detected in the hippocampus of aged rodents (26) as well as in the CNS of senior normal human subjects, who comprise the principal risk population that succumbs to neurodegenerative diseases, in particular AD (24, 27, 40). Thus, under pathological conditions and the aging process, IFN-{gamma} is readily available in the CNS as an inducer of mFPR2, which mediates the chemotactic responses microglial cells to multiple microbial and host-derived chemotactic agonist peptides, including AD-associated Abeta42 (5, 9, 41).

In our study, a relatively weaker effect of IFN-{gamma} on the induction of mFPR2 in microglial cells at early stages (6 h) of incubation was markedly increased by the soluble ligand for CD40. In nonstimulated microglial cells, CD40L showed little activity on the expression of mFPR2, which may be attributable to the low level of expression of CD40 by such cells. In contrast, IFN-{gamma} enhanced surface expression of CD40 by microglial cells, which then became responsive to CD40L by further increasing mFPR2 at both mRNA and functional levels. Consequently, IFN-{gamma} and CD40L synergistically promoted the microglial cell chemotaxis to Abeta42 peptides and their internalization via mFPR2.

The CD40/CD40L dyad mediates a broad spectrum of inflammatory and immune responses in diseases including AD (42, 43, 44). In a coculture model of primary neurons and microglia, CD40 cross-linking by soluble CD40L or an anti-CD40 Ab potently promoted the neurotoxicity of microglial cells induced by Abeta via the production of proinflammatory mediators (45). Interestingly, in this model, microglial cells were incubated in the presence of IFN-{gamma}, suggesting its "priming" effect on cell responses to CD40L. This is in agreement with our present study in which CD40 only exhibited its activity on mFPR2 induction in microglial costimulated by IFN-{gamma}. In addition to activated microglia, CD40 was also detected on microvasculature in the brain of AD patients (46), suggesting that CD40 may play an important role in orchestrating inflammatory responses in CNS diseases. To support the biological relevance of CD40 in the CNS, CD40L has been detected immunocytochemically in astrocytes in the brains of aged human subjects and AD patients. Likewise, in the brains of mice carrying the mutant amyloid precursor protein and presenilin 1, transgenes that develop AD-like pathology, as well as in rat injury models (47, 48), CD40L was expressed by "reactive" astrocytes. Therefore, under inflammatory conditions, astrocytes, in addition to the T lymphocytes potentially infiltrating brain parenchyma due to breached BBB, provide essential signals for activation of CD40, which is up-regulated on activated microglial cells.

Our findings that IFN-{gamma} alone induces mFPR2 in microglia and its synergism with CD40 cross-linking may have important pathophysiological significance in the disease process of AD. In the AD brain, microglia accumulate at plaque lesions containing high levels of Abeta42 (5, 9). Although microglial cells are believed to mediate the "indirect" neurotoxicity of Abeta peptides by secreting toxins, they may play an essential role in phagocytosing and processing Abeta peptides (14, 15, 49, 50, 51, 52). In culture, microglia isolated from human AD brains migrate to aggregated Abeta peptides and are capable of removing Abeta deposits. Consistent with this, cultured rat microglia interact with Abeta peptides, which become localized on the cell surface as well as in phagosome-like intracellular vesicles (53). In in vivo experiments, Abeta peptides injected into rat striatum are rapidly phagocytosed by microglia (50), followed by degradation and clearance (52). In mouse AD models, immunization with Abeta peptides (54, 55) or with Abs against Abeta (56) resulted in the reduction of Abeta deposits, apparently mediated by activated microglia. Thus, microglial uptake of Abeta peptides may represent a host defense to eliminate undesirable irritants in the CNS. However, microglial ingestion of Abeta peptides may also present the dilemma of a "double-edged" sword in that, as a consequence of prolonged exposure, Abeta peptides taken by human mononuclear phagocytes formed fibrillary aggregates in the cytoplasmic compartment and increased the apoptotic death of the cells (11, 12, 15). It is therefore possible that the capacity of microglial cells or brain macrophages to eliminate or to promote deposition of Abeta peptides may be determined by the Abeta peptide burden in the brain and the duration of cell exposure. In this context, a fine tuning of microglial cell responses in the inflammatory milieu of AD will be crucial for maximizing the beneficial host responses while minimizing the detrimental consequences that may favor the progression of the disease. Further studies are therefore warranted to more clearly elucidate the biological significance of IFN-{gamma} and CD40 synergy in microglial activation in CNS diseases to facilitate the development of more effective therapeutic agents for AD and other inflammatory CNS diseases.


   Acknowledgments
 
We thank Dr. Joost J. Oppenheim for critically reviewing the manuscript and Cheryl Fogle and Cheryl Nolan for secretarial assistance.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This project has been funded in part with federal funds from the National Cancer Institute, National Institutes of Health, under contract no. NO1-CO-12400. The research was also supported (in part) by the Intramural Research Program of the National Cancer Institute, National Institutes of Health. Back

2 The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does the mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. NCI-Frederick is accredited by the American Association for the Accreditation of Laboratory Animal Care International and follows the Public Health Service Policy for the Care and Use of Laboratory Animals. Animal care was provided in accordance with the procedures outlined in the "Guide for Care and Use of Laboratory Animals" (National Research Council; 1996; National Academy Press, Washington D.C.). Back

3 Address correspondence and reprint requests to Dr. Ji Ming Wang, Laboratory of Molecular Immunoregulation, Center for Cancer Research, National Cancer Institute at Frederick, Building 560, Room 31-76, Frederick, MD 21702-1201. E-mail address: wangji{at}mail.ncifcrf.gov Back

4 Abbreviations used in this paper: AD, Alzheimer’s disease; Abeta, amyloid beta; BBB, blood-brain barrier; CD40L, CD40 ligand; CI, chemotaxis index; FI, fluorescence intensity; fMLF, formyl-methionyl-leucyl-phenylalanine; mFPR2, mouse formyl peptide receptor 2; PI, propidium iodide; PTX, pertussis toxin; BBB, blood-brain barrier. Back

Received for publication May 2, 2006. Accepted for publication November 21, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Selkoe, D. J.. 2004. Alzheimer disease: mechanistic understanding predicts novel therapies. Ann. Intern. Med. 140: 627-638. [Free Full Text]
  2. Eikelenboom, P., J. M. Rozemuller, F. L. van Muiswinkel. 1998. Inflammation and Alzheimer’s disease: relationships between pathogenic mechanisms and clinical expression. Exp. Neurol. 154: 89-98. [Medline]
  3. Cotter, R. L., W. J. Burke, V. S. Thomas, J. F. Potter, J. Zheng, H. E. Gendelman. 1999. Insights into the neurodegenerative process of Alzheimer’s disease: a role for mononuclear phagocyte-associated inflammation and neurotoxicity. J. Leukocyte Biol. 65: 416-427. [Abstract]
  4. McGeer, P. L., E. G. McGeer. 1999. Inflammation of the brain in Alzheimer’s disease: implications for therapy. J. Leukocyte Biol. 65: 409-415. [Abstract]
  5. Iribarren, P., Y. Zhou, J. Hu, Y. Le, J. M. Wang. 2005. Role of formyl peptide receptor-like 1 (FPRL1/FPR2) in mononuclear phagocyte responses in Alzheimer disease. Immunol. Res. 31: 165-176. [Medline]
  6. Le, Y., W. Gong, H. L. Tiffany, A. Tumanov, S. Nedospasov, W. Shen, N. M. Dunlop, J. L. Gao, P. M. Murphy, J. J. Oppenheim, J. M. Wang. 2001. Rapid communication: amyloid beta42 activates a G-protein-coupled chemoattractant receptor, FPR-like-1. J. Neurosci. 21: 1-5. RC123. [Medline]
  7. Meda, L., P. Baron, G. Scarlato. 2001. Glial activation in Alzheimer’s disease: the role of Abeta and its associated proteins. Neurobiol. Aging 22: 885-893. [Medline]
  8. Giulian, D.. 1999. Microglia and the immune pathology of Alzheimer disease. Am. J. Hum. Genet. 65: 13-18. [Medline]
  9. Cui, Y., Y. Le, H. Yazawa, W. Gong, J. M. Wang. 2002. Potential role of the formyl peptide receptor-like 1 (FPRL1) in inflammatory aspects of Alzheimer’s disease. J. Leukocyte Biol. 72: 628-635. [Abstract/Free Full Text]
  10. Tiffany, H. L., M. C. Lavigne, Y. H. Cui, J. M. Wang, T. L. Leto, J. L. Gao, P. M. Murphy. 2001. Amyloid-beta induces chemotaxis and oxidant stress by acting at formylpeptide receptor 2, a G protein-coupled receptor expressed in phagocytes and brain. J. Biol. Chem. 276: 23645-23652. [Abstract/Free Full Text]
  11. Yazawa, H., Z. X. Yu, K. Takeda, Y. Le, W. Gong, V. J. Ferrans, J. J. Oppenheim, C. C. Li, J. M. Wang. 2001. beta amyloid peptide (Abeta42) is internalized via the G-protein-coupled receptor FPRL1 and forms fibrillar aggregates in macrophages. FASEB J. 15: 2454-2462. [Abstract/Free Full Text]
  12. Ying, G., P. Iribarren, Y. Zhou, W. Gong, N. Zhang, Z. X. Yu, Y. Le, Y. Cui, J. M. Wang. 2004. Humanin, a newly identified neuroprotective factor, uses the G protein-coupled formylpeptide receptor-like-1 as a functional receptor. J. Immunol. 172: 7078-7085. [Abstract/Free Full Text]
  13. Cui, Y. H., Y. Le, W. Gong, P. Proost, J. Van Damme, W. J. Murphy, J. M. Wang. 2002. Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor formyl peptide receptor 2 in murine microglial cells. J. Immunol. 168: 434-442. [Abstract/Free Full Text]
  14. Iribarren, P., K. Chen, J. Hu, W. Gong, E. H. Cho, S. Lockett, B. Uranchimeg, J. M. Wang. 2005. CpG-containing oligodeoxynucleotide promotes microglial cell uptake of amyloid beta 1–42 peptide by up-regulating the expression of the G-protein-coupled receptor mFPR2. FASEB J. 19: 2032-2034. [Abstract/Free Full Text]
  15. Chen, K., P. Iribarren, J. Hu, J. Chen, W. Gong, E. H. Cho, S. Lockett, N. M. Dunlop, J. M. Wang. 2006. Activation of Toll-like receptor 2 on microglia promotes cell uptake of Alzheimer disease-associated amyloid beta peptide. J. Biol. Chem. 281: 3651-3659. [Abstract/Free Full Text]
  16. Cui, Y. H., Y. Le, X. Zhang, W. Gong, K. Abe, R. Sun, J. Van Damme, P. Proost, J. M. Wang. 2002. Up-regulation of FPR2, a chemotactic receptor for amyloid beta 1–42 (Abeta42), in murine microglial cells by TNF-{alpha}. Neurobiol. Dis. 10: 366-377. [Medline]
  17. Rock, R. B., S. Hu, A. Deshpande, S. Munir, B. J. May, C. A. Baker, P. K. Peterson, V. Kapur. 2005. Transcriptional response of human microglial cells to interferon-{gamma}. Genes Immun. 6: 712-719. [Medline]
  18. Meda, L., M. A. Cassatella, G. I. Szendrei, L. Otvos, Jr, P. Baron, M. Villalba, D. Ferrari, F. Rossi. 1995. Activation of microglial cells by beta-amyloid protein and interferon-{gamma}. Nature 374: 647-650. [Medline]
  19. Lambertsen, K. L., R. Gregersen, M. Meldgaard, B. H. Clausen, E. K. Heibol, R. Ladeby, J. Knudsen, A. Frandsen, T. Owens, B. Finsen. 2004. A role for interferon-{gamma} in focal cerebral ischemia in mice. J. Neuropathol. Exp. Neurol. 63: 942-955. [Medline]
  20. Nitta, T., M. Ebato, K. Sato, K. Okumura. 1994. Expression of tumour necrosis factor-{alpha}, -beta and interferon-{gamma} genes within human neuroglial tumour cells and brain specimens. Cytokine 6: 171-180. [Medline]
  21. Xiao, B. G., H. Link. 1998. IFN-{gamma} production of adult rat astrocytes triggered by TNF-{alpha}. Neuroreport 9: 1487-1490. [Medline]
  22. Neumann, H., H. Schmidt, E. Wilharm, L. Behrens, H. Wekerle. 1997. Interferon {gamma} gene expression in sensory neurons: evidence for autocrine gene regulation. J. Exp. Med. 186: 2023-2031. [Abstract/Free Full Text]
  23. Jensen, M. B., I. V. Hegelund, N. D. Lomholt, B. Finsen, T. Owens. 2000. IFN-{gamma} enhances microglial reactions to hippocampal axonal degeneration. J. Neurosci. 20: 3612-3621. [Abstract/Free Full Text]
  24. Maes, M., N. DeVos, A. Wauters, P. Demedts, V. W. Maurits, H. Neels, E. Bosmans, C. Altamura, A. Lin, C. Song, et al 1999. Inflammatory markers in younger vs elderly normal volunteers and in patients with Alzheimer’s disease. J. Psychiatr. Res. 33: 397-405. [Medline]
  25. Saurwein-Teissl, M., I. Blasko, K. Zisterer, B. Neuman, B. Lang, B. Grubeck-Loebenstein. 2000. An imbalance between pro- and anti-inflammatory cytokines, a characteristic feature of old age. Cytokine 12: 1160-1161. [Medline]
  26. Frank, M. G., R. M. Barrientos, J. C. Biedenkapp, J. W. Rudy, L. R. Watkins, S. F. Maier. 2005. mRNA up-regulation of MHC II and pivotal pro-inflammatory genes in normal brain aging. Neurobiol. Aging 27: 717-722.
  27. Blasko, I., G. Ransmayr, R. Veerhuis, P. Eikelenboom, B. Grubeck-Loebenstein. 2001. Does IFN-{gamma} play a role in neurodegeneration?. J. Neuroimmunol. 116: 1-4. [Medline]
  28. Hu, J. Y., Y. Le, W. Gong, N. M. Dunlop, J. L. Gao, P. M. Murphy, J. M. Wang. 2001. Synthetic peptide MMK-1 is a highly specific chemotactic agonist for leukocyte FPRL1. J. Leukocyte Biol. 70: 155-161. [Abstract/Free Full Text]
  29. Han, I. O., H. S. Kim, H. C. Kim, E. H. Joe, W. K. Kim. 2003. Synergistic expression of inducible nitric oxide synthase by phorbol ester and interferon-{gamma} is mediated through NF-{kappa}B and ERK in microglial cells. J. Neurosci. Res. 73: 659-669. [Medline]
  30. Han, I. O., K. W. Kim, J. H. Ryu, W. K. Kim. 2002. p38 mitogen-activated protein kinase mediates lipopolysaccharide, not interferon-{gamma}-induced inducible nitric oxide synthase expression in mouse BV2 microglial cells. Neurosci. Lett. 325: 9-12. [Medline]
  31. Tan, J., T. Town, D. Paris, A. Placzek, T. Parker, F. Crawford, H. Yu, J. Humphrey, M. Mullan. 1999. Activation of microglial cells by the CD40 pathway: relevance to multiple sclerosis. J. Neuroimmunol. 97: 77-85. [Medline]
  32. Alderson, M. R., R. J. Armitage, T. W. Tough, L. Strockbine, W. C. Fanslow, M. K. Spriggs. 1993. CD40 expression by human monocytes: regulation by cytokines and activation of monocytes by the ligand for CD40. J. Exp. Med. 178: 669-674. [Abstract/Free Full Text]
  33. Nguyen, V. T., E. N. Benveniste. 2000. Involvement of STAT-1 and Ets family members in interferon-{gamma} induction of CD40 transcription in microglia/macrophages. J. Biol. Chem. 275: 23674-23684. [Abstract/Free Full Text]
  34. Nguyen, V. T., W. S. Walker, E. N. Benveniste. 1998. Post-transcriptional inhibition of CD40 gene expression in microglia by transforming growth factor-beta. Eur. J. Immunol. 28: 2537-2548. [Medline]
  35. Townsend, K. P., T. Town, T. Mori, L. F. Lue, D. Shytle, P. R. Sanberg, D. Morgan, F. Fernandez, R. A. Flavell, J. Tan. 2005. CD40 signaling regulates innate and adaptive activation of microglia in response to amyloid beta-peptide. Eur. J. Immunol. 35: 901-910. [Medline]
  36. Jana, M., S. Dasgupta, X. Liu, K. Pahan. 2002. Regulation of tumor necrosis factor-{alpha} expression by CD40 ligation in BV-2 microglial cells. J. Neurochem. 80: 197-206. [Medline]
  37. De Simone, R., G. Levi, F. Aloisi. 1998. Interferon {gamma} gene expression in rat central nervous system glial cells. Cytokine 10: 418-422. [Medline]
  38. Nguyen, V. T., E. N. Benveniste. 2002. Critical role of tumor necrosis factor-{alpha} and NF-]kappa]B in interferon-{gamma} -induced CD40 expression in microglia/macrophages. J. Biol. Chem. 277: 13796-13803. [Abstract/Free Full Text]
  39. Owens, T., A. A. Babcock, J. M. Millward, H. Toft-Hansen. 2005. Cytokine and chemokine inter-regulation in the inflamed or injured CNS. Brain Res. Brain Res. Rev. 48: 178-184. [Medline]
  40. Fassbender, K., O. Mielke, T. Bertsch, F. Muehlhauser, M. Hennerici, M. Kurimoto, S. Rossol. 1999. Interferon-{gamma}-inducing factor (IL-18) and interferon-{gamma} in inflammatory CNS diseases. Neurology 53: 1104-1106. [Abstract/Free Full Text]
  41. Le, Y., P. M. Murphy, J. M. Wang. 2002. Formyl-peptide receptors revisited. Trends Immunol. 23: 541-548. [Medline]
  42. Allan, S. M., N. J. Rothwell. 2001. Cytokines and acute neurodegeneration. Nat. Rev. Neurosci. 2: 734-744. [Medline]
  43. Howard, L. M., K. L. Neville, L. M. Haynes, M. C. Dal Canto, S. D. Miller. 2003. CD154 blockade results in transient reduction in Theiler’s murine encephalomyelitis virus-induced demyelinating disease. J. Virol. 77: 2247-2250. [Abstract/Free Full Text]
  44. Howard, L. M., M. C. Dal Canto, S. D. Miller. 2002. Transient anti-CD154-mediated immunotherapy of ongoing relapsing experimental autoimmune encephalomyelitis induces long-term inhibition of disease relapses. J. Neuroimmunol. 129: 58-65. [Medline]
  45. Tan, J., T. Town, D. Paris, T. Mori, Z. Suo, F. Crawford, M. P. Mattson, R. A. Flavell, M. Mullan. 1999. Microglial activation resulting from CD40-CD40L interaction after beta-amyloid stimulation. Science 286: 2352-2355. [Abstract/Free Full Text]
  46. Schonbeck, U., P. Libby. 2001. The CD40/CD154 receptor/ligand dyad. Cell. Mol. Life Sci. 58: 4-43. [Medline]
  47. Calingasan, N. Y., H. A. Erdely, C. A. Altar. 2002. Identification of CD40 ligand in Alzheimer’s disease and in animal models of Alzheimer’s disease and brain injury. Neurobiol. Aging 23: 31-39. [Medline]
  48. Togo, T., H. Akiyama, H. Kondo, K. Ikeda, M. Kato, E. Iseki, K. Kosaka. 2000. Expression of CD40 in the brain of Alzheimer’s disease and other neurological diseases. Brain Res. 885: 117-121. [Medline]
  49. Frackowiak, J., H. M. Wisniewski, J. Wegiel, G. S. Merz, K. Iqbal, K. C. Wang. 1992. Ultrastructure of the microglia that phagocytose amyloid and the microglia that produce beta-amyloid fibrils. Acta Neuropathol. 84: 225-233. [Medline]
  50. Frautschy, S. A., G. M. Cole, A. Baird. 1992. Phagocytosis and deposition of vascular beta-amyloid in rat brains injected with Alzheimer beta-amyloid. Am. J. Pathol. 140: 1389-1399. [Abstract]
  51. Shigematsu, K., P. L. McGeer, D. G. Walker, T. Ishii, E. G. McGeer. 1992. Reactive microglia/macrophages phagocytose amyloid precursor protein produced by neurons following neural damage. J. Neurosci. Res. 31: 443-453. [Medline]
  52. Weldon, D. T., S. D. Rogers, J. R. Ghilardi, M. P. Finke, J. P. Cleary, E. O’Hare, W. P. Esler, J. E. Maggio, P. W. Mantyh. 1998. Fibrillar beta-amyloid induces microglial phagocytosis, expression of inducible nitric oxide synthase, and loss of a select population of neurons in the rat CNS in vivo. J. Neurosci. 18: 2161-2173. [Abstract/Free Full Text]
  53. Ard, M. D., G. M. Cole, J. Wei, A. P. Mehrle, J. D. Fratkin. 1996. Scavenging of Alzheimer’s amyloid beta-protein by microglia in culture. J. Neurosci. Res. 43: 190-202. [Medline]
  54. Schenk, D., R. Barbour, W. Dunn, G. Gordon, H. Grajeda, T. Guido, K. Hu, J. Huang, K. Johnson-Wood, K. Khan, D. Kholodenko, et al 1999. Immunization with amyloid-beta attenuates Alzheimer-disease-like pathology in the PDAPP mouse. Nature 400: 173-177. [Medline]
  55. Lombardo, J. A., E. A. Stern, M. E. McLellan, S. T. Kajdasz, G. A. Hickey, B. J. Bacskai, B. T. Hyman. 2003. Amyloid-beta antibody treatment leads to rapid normalization of plaque-induced neuritic alterations. J. Neurosci. 23: 10879-10883. [Abstract/Free Full Text]
  56. Wilcock, D. M., G. DiCarlo, D. Henderson, J. Jackson, K. Clarke, K. E. Ugen, M. N. Gordon, D. Morgan. 2003. Intracranially administered anti-Abeta antibodies reduce beta-amyloid deposition by mechanisms both independent of and associated with microglial activation. J. Neurosci. 23: 3745-3751. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
S. D. Kim, J. M. Kim, S. H. Jo, H. Y. Lee, S. Y. Lee, J. W. Shim, S.-K. Seo, J. Yun, and Y.-S. Bae
Functional Expression of Formyl Peptide Receptor Family in Human NK Cells
J. Immunol., November 1, 2009; 183(9): 5511 - 5517.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
K. Chen, L. Zhang, J. Huang, W. Gong, N. M. Dunlop, and J. M. Wang
Cooperation between NOD2 and Toll-like receptor 2 ligands in the up-regulation of mouse mFPR2, a G-protein-coupled A{beta}42 peptide receptor, in microglial cells
J. Leukoc. Biol., June 1, 2008; 83(6): 1467 - 1475.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, K.
Right arrow Articles by Wang, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, K.
Right arrow Articles by Wang, J. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS