The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kremer, K. N.
Right arrow Articles by Hedin, K. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kremer, K. N.
Right arrow Articles by Hedin, K. E.
The Journal of Immunology, 2007, 178: 1581-1588.
Copyright © 2007 by The American Association of Immunologists, Inc.

Haplotype-Independent Costimulation of IL-10 Secretion by SDF-1/CXCL12 Proceeds via AP-1 Binding to the Human IL-10 Promoter1

Kimberly N. Kremer, Ashok Kumar and Karen E. Hedin2

Department of Immunology, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN 55905


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Costimulation by the chemokine, stromal cell-derived factor-1 (SDF-1)/CXCL12, has been shown to increase the amount of IL-10 secreted by TCR-stimulated human T cells; however, the molecular mechanisms of this response are unknown. Knowledge of this signaling pathway may be useful because extensive evidence indicates that deficient IL-10 secretion promotes autoimmunity. The human IL-10 locus is highly polymorphic. We report in this study that SDF-1 costimulates IL-10 secretion from T cells containing all three of the most common human IL-10 promoter haplotypes that are identified by single-nucleotide polymorphisms at –1082, –819, and –592 bp (numbering is relative to the transcription start site). We further show that SDF-1 primarily costimulates IL-10 secretion by a diverse population of CD45RA– ("memory") phenotype T cells that includes cells expressing the presumed regulatory T cell marker, Foxp3. To address the molecular mechanisms of this response, we showed that SDF-1 costimulates the transcriptional activities in normal human T cells of reporter plasmids containing 1.1 kb of all three of the common IL-10 promoter haplotypes. IL-10 promoter activity was ablated by mutating two nonpolymorphic binding sites for the AP-1 transcription factor, and chromatin immunoprecipitation assays of primary human T cells revealed that SDF-1 costimulation enhances AP-1 binding to both of these sites. Together, these results delineate the molecular mechanisms responsible for SDF-1 costimulation of T cell IL-10 secretion. Because it is preserved among several human haplotypes and in diverse T cell populations including Foxp3+ T cells, this pathway of IL-10 regulation may represent a key mechanism for modulating expression of this important immunoregulatory cytokine.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin-10 potently inhibits inflammatory immune reactions in both humans and mice, primarily by inhibiting the immune activation of monocytes, dendritic cells, and macrophages, and their secretion of inflammatory mediators. For example, IL-10 profoundly inhibits monocyte expression of MHC class II, ICAM-1, B7.1, B7.2, and TLR4, thereby limiting their ability to act as APCs to promote the activation of Th1-type inflammatory T cells (1). IL-10 also critically limits the initiation, duration, and associated pathology of inflammatory immune responses by limiting the secretion of many chemokines and proinflammatory cytokines. IL-10 thereby ameliorates sepsis, endotoxemia, pancreatitis, uveitis, and hepatitis in mouse models (1). Interestingly, mice with the IL-10 gene deleted only from their T cells develop gut inflammation with immune features similar to human inflammatory bowel disease, even though gut macrophages and other cell types in these animals express IL-10 (2). T cell-derived IL-10 also plays important roles in inhibiting allergy and asthma (3). Therapies aimed at increasing T cell secretion of IL-10 may therefore hold promise for ameliorating autoimmunity. Unfortunately, the molecular mechanisms responsible for regulating IL-10 secretion by T cells are only poorly understood.

Stromal cell-derived factor-1 (SDF-13; CXCL12) is a member of the superfamily of chemokines that regulate the growth and migration of multiple cell types (4, 5, 6). CXCR4 is the receptor for SDF-1 and is expressed by most T cell subsets. SDF-1/CXCR4 signaling results in T cell adhesion (7), chemotaxis (8), and gene expression important for regulating cell-cycle progression and apoptosis (9). SDF-1 critically modulates T cell immune functions. For example, SDF-1/CXCR4 signal transduction contributes to regulating lymphocyte development (10) and homeostasis (11), and both SDF-1 and CXCR4 regulate T cell-mediated inflammation (9, 12, 13) and infection by HIV type-1 (HIV-1) (14, 15). SDF-1/CXCR4 signaling also induces the expression of multiple genes, via mechanisms including activation of the MEK-1/ERK MAPK pathway that regulates downstream transcription factors including AP-1 (9, 16, 17, 18). Nevertheless, the immunological role(s) of SDF-1 regulation of gene expression are, as yet, incompletely understood.

Mapping of the human IL-10 promoter has revealed multiple predicted transcription factor binding sites and two microsatellite regions that are likely to regulate IL-10 gene transcription (19, 20, 21, 22, 23). Interestingly, IL-10 promoter polymorphisms among humans affect levels of IL-10 secretion and susceptibility to autoimmune diseases and related immune conditions (20, 21, 22, 23, 24, 25). These polymorphisms include 46 single-nucleotide polymorphisms (SNPs) and multiple variations within two microsatellites. Thirty-eight of the published polymorphisms are located in the 5' flanking and presumed promoter region of the IL-10 gene, suggesting that they affect IL-10 expression. In particular, three linked SNPs located within 1.1 kb of the transcription start site characterize three haplotypes that we shall refer to here as ATA, ACC, and GCC, which are defined by G or A at –1082 bp, C or T at –819 bp, and C or A at –592 bp (numbering is relative to the transcription start site). The ATA, ACC, and GCC haplotypes also contain other linked polymorphisms, including other SNPs and variations in two microsatellite CA repeat regions located –4 kb and –1 kb (summarized in Ref. 23). The ATA, ACC, and GCC haplotypes are particularly common: each is present at least heterozygously in 20–33% of Caucasian individuals, and the ATA haplotype is present in up to 70% of Asian subpopulations (23, 25). The haplotypes are therefore likely to have been preserved and disseminated among human populations via selective pressure. Consistent with this idea, the ATA, ACC, and GCC haplotypes are associated with low, medium, and high levels of IL-10 secretion, respectively (25, 26). In contrast to the higher-IL-10-expressing ACC and GCC haplotypes, the lower-IL-10-expressing ATA haplotype is epidemiologically associated with the development of autoimmune diseases, including Sjogren’s syndrome, rheumatoid arthritis, systemic lupus erythematosus, and psoriasis (27, 28). ATA is also associated with other immune-related conditions, including increased risk of graft rejection after renal or cardiac transplantation (28), increased risk of HIV-1 infection and faster progression to AIDS (29), and decreased risk of graft-vs-host disease and death after HLA-identical sibling hemopoietic cell transplantation (23, 26). Strikingly, the range of IL-10 secretion levels associated with the haplotypes is relatively small: GCC+ individuals secrete on the average only 2- to 3-fold more IL-10 than ATA+ individuals (25, 26). Thus, even small differences in IL-10 secretion evidently can significantly impact the development of immune-related diseases including autoimmunity.

Below, we show that the chemokine, SDF-1/CXCL12, potently costimulates IL-10 secretion by human memory T cell subsets. In addition, we address the molecular mechanisms responsible for this costimulation by isolating and characterizing in primary human T cells SDF-1 and TCR stimulation effects on ATA, ACC, GCC human IL-10 promoter constructs. These results significantly enhance understanding of the molecular mechanisms responsible for regulating IL-10 secretion by T cells. By establishing that SDF-1 is a potent regulator of T cell IL-10 secretion, these results in addition suggest a critical role for SDF-1 in preventing the development of the diverse autoimmune diseases and immune disregulations that are linked to IL-10 deficiency.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Cells

Human PBMC were isolated from the defibrinated peripheral blood of healthy volunteers using a Ficoll gradient and were used for experiments following 12–24 h of culture at 37°C. Blood was obtained and used with informed consent and approval by the Mayo Institutional Review Board. Typical PBMC preparations contained 75–80% CD3+ T lymphocytes (70–75% CD4+ and 25–30% CD8+), and essentially 100% of CD3+ cells expressed CXCR4. T cells were purified from buffy coats using the RosetteSep Human T cell enrichment mixture according to the manufacturer’s instructions (StemCell Technologies). Where indicated, additional purification of T cell subsets used the CD4 and CD8 Multisort kits from Miltenyi Biotec. The purified CD4+ or CD8+ T cell preparations were divided into two parts and further separated into naive vs memory cells as follows: CD45RA or CD45RO beads were added and CD45RA– (memory) or CD45RO– (naive) cells were isolated by negative-selection. Purities of the isolated cell populations were determined by flow cytometry to be 97–99% for CD4+CD45RO– and CD4+CD45RA– cells, and ≥88% for CD8+ CD45RO– and CD8+CD45RA– cells.

Cell culture and stimulation

Cells were cultured in medium A (RPMI 1640 supplemented with 10% FCS, 10 mM HEPES (pH 7.4), 2 mM L-glutamine, 1 mM sodium pyruvate, and 2 µM 2-ME) at 1 x 106–2 x 106 cells/ml. Stimulations were performed at 37°C and SDF-1{alpha} (R&D Systems) was used at 5 x 10–8 M. TCR ligation was achieved by cross-linking anti-TCR mAbs: for reporter assays, chromatin immunoprecipitation (ChIP) assays, and cytokine production assays, the TCR was ligated via plate-bound 1 µg/ml anti-CD3 mAb (OKT3; Ortho Biotech); for biochemical assays, the TCR was ligated via 1 µg/ml soluble OKT3 mAb that was then cross-linked with 0.1 mg/ml goat anti-mouse IgG (Sigma-Aldrich). Where indicated, cells were pretreated for 90 min with either 50 µM PD098059 (Sigma-Aldrich) or an equivalent amount of vehicle (DMSO) as a control.

Assays of IL-10 and marker expression by human T cells

Cells were stimulated as indicated, then assayed. Stimulation times were 24 h for both IL-10 intracellular cytokine staining and ELISA. Cell surface staining of CD4, CD3, CD8, CD69, CCR7, and CXCR3 and intracellular staining of IL-10 were performed using the Cytoperm/Cytofix intracellular cytokine staining kit (BD Pharmingen). The kit was used according to the manufacturer’s instructions, except that cells were treated with 4x GolgiPlug for 6 h before staining. Intracellular Foxp3 staining was performed using the Foxp3 staining set from eBioscience. Supernatant IL-10 was assayed using an ELISA kit (BD Pharmingen). Statistical analysis of data throughout the manuscript was via paired t test.

IL-10 promoter expression constructs

DNA sequence –1111 bp to +1 bp from the human IL-10 promoter (numbering is relative to the transcription start site) was amplified by PCR (primers available upon request) from normal human blood and subcloned into the luciferase vector, pGL4 (Promega). Site-directed mutagenesis of the GCC promoter construct was performed using the QuikChange II XL kit (Stratagene) to change the GGGTCA AP-1 site at –775 bp to GTTCAG and the CCAATCA AP-1 site at –202 bp to CAGGCAG. After subcloning and/or mutagenesis, the identity of each construct was confirmed by DNA sequencing.

Transient transfections and assays of activities of IL-10 promoter constructs in primary human T cells

Purified human T cells (3 x 107) were mixed with 100 µg of the indicated expression plasmid. To compare different transfections done the same day, the cells were additionally transfected with 40 ng of pRL-TK (Promega), which encodes a Renilla luciferase. Cells were transfected by electroporation using a BTX Electro-square-porator model T820 (BTX) as described previously (30), except that 350 volts were used. Typical transfection efficiencies were 10–20%. Transfected cells were cultured in medium A for 2.5 h and then stimulated for 18 h, as indicated. Luciferase activities derived from both experimental and control pRL-TK plasmids were measured in the same samples using the Dual-Luciferase assay kit (Promega), and Renilla luciferase values were used for normalization. Results shown are presented as fold increases as compared with unstimulated samples in the same experiment.

Assay of active, phosphorylated ERK

Cells were stimulated as indicated, then whole cell lysates were assayed for active ERK phosphorylated on Thr202 and Tyr204 after SDS-PAGE and immunoblotting with phospho-specific anti- p44/p42 ERK1/ERK2 (Thr202/Tyr204; Cell Signaling Technology). Total ERK2 protein was determined as a control by stripping bound Abs off the same blots and re-immunoblotting with p44 ERK kinase antiserum (Santa Cruz Biotechnology).

Assay of IL-10 mRNA

Cells were stimulated as indicated. RNA was isolated using TRIzol (Invitrogen Life Technologies), and IL-10 and actin mRNA was assayed using the Thermoscript RT-PCR System (Invitrogen Life Technologies) according to the manufacturer’s directions. Briefly, each reaction used 2 µg of total RNA that was subjected to cDNA synthesis, 10% of the cDNA reaction was then subjected to 35 cycles of PCR at denaturing, annealing, and elongation temperatures of 94°C, 55°C, and 72°C, respectively, in an i-Cycler PCR machine (Bio-Rad). The primers used were CTCTGTTGCCTGGTCCTCCTG and GTCCTCCAGCAAGGACTCC for IL-10 mRNA, and ATGTTTGAGACCTTCAACAC and ACGTCACACTTCATGATGGA for actin mRNA.

ChIP assay

Purified T cells (2 x 106 cells per test) were stimulated for 12 h as indicated. ChIP assays were performed on lysed cells using a ChIP Assay kit (Upstate Technology). ChIP assays were performed according to the manufacturer’s instructions, except that the sonicated suspension was precleared for 3 h at 4°C before incubation with 1 µg of either c-Fos rabbit polyclonal antisera (Santa Cruz Biotechnology) or normal rabbit control polyclonal IgG (R&D Systems) overnight at 4°C, and the salmon sperm DNA/protein A-agarose slurry was blocked for 30 min at room temperature in 5% BSA/PBS before incubation with the immune complexes for 3 h at 4°C. Sonicated DNA was between 200 and 1000 bp in length. Each sample was subjected to 30 cycles of PCR at denaturing, annealing, and elongation temperatures of 94°C, 55°C, and 72°C, respectively, using an i-Cycler PCR machine (Bio-Rad). The primers used to amplify the –775 bp AP-1 site were GTGCTGGAGATGGTGTACAGTAGG and GGTAAGAGTAGTCTGCACTTGCTG, and the primers used to amplify the –202 bp AP-1 site were CCTAGGAACACGCGAATGAGAACC and GCTTAGAGCTCCTCCTTCTCTAACC. As a control, 0.12% of each input DNA sample before immunoprecipitation was assayed by PCR amplification under identical conditions of the –202 bp AP-1 site ("input").


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
SDF-1 costimulates IL-10 secretion by human T cells of both GCC+ and GCC– genomic haplotypes

We analyzed SDF-1 costimulation of IL-10 secretion by T cells from different individuals. Human PBMC were isolated from normal blood donors, stimulated in vitro with immobilized anti-TCR-CD3 mAb with or without SDF-1, and assayed for IL-10 production. SDF-1 costimulation increased the number of T cells producing IL-10 protein, as shown by intracellular cytokine staining of CD4+ CD3+ cells (Fig. 1A). SDF-1 costimulation also increased the number of T cells producing IL-10 protein among CD8+CD3+ T cells (Fig. 1A and data not shown). SDF-1 costimulation of IL-10-expressing T cells was consistently observed among different blood donors (Fig. 1B). The percentage of IL-10-expressing T cells induced after CD3 mAb alone or CD3 plus SDF-1 stimulation varied among individual donors (Fig. 1B); therefore, we asked whether IL-10 promoter haplotype influenced the ability of SDF-1 to costimulate T cell IL-10 expression. The GCC haplotype has previously been associated with higher IL-10 levels (25, 26); therefore, genomic DNA sequencing of the –1082 bp SNP site was used to classify blood donors as either GCC+ or GCC–. All individuals who lacked the GCC haplotype were confirmed by DNA sequencing to contain either ATA and/or ACC haplotypes (data not shown). SDF-1 costimulation enhanced the amount of IL-10 secreted by all T cells, including individuals both with and without the –1082 bp G SNP (p < 0.05) (Fig. 1C). In contrast to SDF-1 costimulation, SDF-1 alone had no effect on T cell IL-10 production or secretion as measured either by intracellular cytokine staining or ELISA (Fig. 1, A and B, and data not shown). Together, the results in this section indicate that SDF-1 costimulates IL-10 production and secretion by human T cells, via a mechanism independent of the presence or absence of the GCC IL-10 promoter haplotype.


Figure 1
View larger version (37K):
[in this window]
[in a new window]

  		FIGURE 1. SDF-1 costimulates IL-10 secretion by human T cells of both GCC+ and GCC– genomic haplotypes. A, Normal human PBMC were purified from peripheral blood, then stimulated in vitro for 24 h with 1 µg/ml immobilized CD3 mAb ± SDF-1 (5 x 10–8 M). IL-10 expression was determined by intracellular cytokine staining. Results shown are gated on CD3+ T cells. B, Results of analyzing multiple PBMC donors as in A. C, Normal human T cells were purified and stimulated as in A, then secreted IL-10 was determined by ELISA in triplicate (SD for all data points were ≤10%). The results from different donors are grouped according to a haplotype-characteristic SNP at –1082 relative to the IL-10 transcription start site: donors in which the GCC haplotype is present are at left, donors in which the GCC haplotype is absent are at right. Lines connect results from the same donor.

 
SDF-1 costimulates activity of GCC, ACC, and ATA IL-10 promoter haplotype constructs expressed in human T cells

We next addressed the molecular mechanisms responsible for SDF-1 costimulation of T cell IL-10 secretion. Because we found no effect of SDF-1/CXCR4 signaling on mRNA stability regulated by the IL-10 3'-untranslated region (31, 32) (data not shown), we analyzed SDF-1 costimulation of IL-10 promoter activity. The 1.1-kb 5' of the human IL-10 transcription start site contains the three SNPs that define the GCC, ACC, and ATA haplotypes discussed in this study, as well as several predicted transcription factor binding sites (Fig. 2A, top). We therefore subcloned this region from GCC, ACC, and ATA human haplotypes into a luciferase reporter plasmid vector, creating haplotype luciferase reporter constructs (Fig. 2A, bottom). The reporter plasmids were transiently transfected into normal human T cells, and luciferase was assayed and compared after in vitro stimulation of the T cells with TCR mAb with or without SDF-1 (Fig. 2B). All three IL-10 promoter haplotype constructs responded with increased transcriptional activity in response to CD3 mAb stimulation of the TCR (for each construct, p < 0.05; n = 5). Moreover, SDF-1 costimulation enhanced the activity of all three haplotypes of the IL-10 promoter luciferase constructs (for each construct, p < 0.05; n = 5). Thus, all three of the most common human polymorphic IL-10 promoter haplotypes respond to TCR stimulation by increasing transcriptional activity, and SDF-1 further costimulates the TCR-dependent transcriptional activity of all three haplotypes.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 2. SDF-1 costimulates activity of GCC, ACC, and ATA IL-10 promoter haplotype constructs expressed in human T cells. A (top), Cartoon of the proximal human IL-10 promoter region, showing SNPs referred to in the text and the AP-1 transcription factor binding sites. Bottom, Cartoons showing the 1.1-kb fragments of the IL-10 promoters of the most common haplotypes (ATA, ACC, and GCC) that were subcloned into a luciferase reporter plasmid to create IL-10 promoter haplotype constructs. B, The IL-10 promoter luciferase constructs containing the indicated haplotypes were transiently transfected into purified human T cells. Cells were stimulated in vitro for 18 h with 1 µg/ml immobilized CD3 mAb ± SDF-1 (5 x 10–8 M) and assayed for luciferase activity. Fold increases in promoter activity were calculated as compared with unstimulated samples in the same experiment, and the results of multiple independent experiments were then normalized so that the fold increase of the unmutated, unstimulated construct in each experiment = 1. The results of multiple experiments performed on different days are shown; lines connect results from the same experiment; each point denotes the mean of two independent determinations; y-axes denote the fold increase in luciferase activity as compared with unstimulated cells analyzed in the same experiment.

 
SDF-1 costimulates the MEK-1/ERK pathway in human T cells, and both IL-10 mRNA accumulation and IL-10 secretion by human T cells requires MEK-1 activity

Both TCR and SDF-1 signaling activate the MEK-1/ERK pathway in human T cells (9, 16, 17, 18). We therefore asked whether SDF-1 costimulates TCR-mediated activation of this pathway. PBMC T cells were stimulated with either SDF-1 or cross-linked anti-TCR (CD3) mAb, lysed and assayed for active, phosphorylated ERK. The results indicate that both SDF-1 and CD3 mAb stimulated ERK activation, and that ERK activation was enhanced by costimulation with both SDF-1 and CD3 mAb (Fig. 3A, upper gel). The same gel was stripped and reprobed with antiserum recognizing total ERK2, as a loading control (Fig. 3A, lower gel). Thus, SDF-1 costimulation enhances TCR-mediated ERK activation. We next asked whether the MEK-1/ERK pathway is required for T cell IL-10 secretion. For this purpose we used the MEK-1 inhibitor drug, PD098059. PD098059 pretreatment abrogated IL-10 mRNA accumulation after either TCR or TCR+SDF-1 stimulation of normal human T cells (Fig. 3B). The same MEK-1 inhibitor also inhibited TCR and TCR+SDF-1-mediated stimulation of IL-10 protein secretion by human T cells (Fig. 3C). Thus, SDF-1 costimulates the MEK-1/ERK pathway in human T cells, and both IL-10 mRNA accumulation and IL-10 secretion by stimulated human T cells is sensitive to upstream blockade of the MEK-1/ERK pathway.


Figure 3
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 3. SDF-1 costimulates the MEK-1/ERK pathway in human T cells, and both IL-10 mRNA accumulation and IL-10 secretion by human T cells requires MEK-1 activity. A, Cells were stimulated with 1 µg/ml cross-linked CD3 mAb with or without SDF-1 (5 x 10–8 M) for 12 min as indicated, then active, phosphorylated ERK was assayed by SDS-PAGE and immunoblotting with specific antisera (P-ERK; upper gel). As a control, the same membrane was stripped and reprobed with antisera recognizing total ERK2 (lower gel). B, Normal human T cells were pretreated with either vehicle (DMSO) or the MEK-1 inhibitor, PD098059 (PD), then stimulated as in Fig. 1A. Cells were then lysed and IL-10 mRNA levels were assayed by RT-PCR (upper gel). As a control, actin mRNA levels of the same samples were similarly assayed by RT-PCR (lower gel). C, Normal human T cells were pretreated with either vehicle (DMSO) or the MEK-1 inhibitor, PD098059, then stimulated as in Fig. 1A. Secreted IL-10 was assayed by ELISA as in Fig. 1C. The bar graph shows mean IL-10 levels ± SD of three independent determinations. Results in A–C are each representative of three independent experiments.

 
SDF-1 costimulates activity of the human IL-10 promoter in T cells by enhancing binding of the AP-1 transcription factor to two nonpolymorphic binding sites located at –775 bp and –202 bp

We next addressed the mechanism by which SDF-1 costimulation of the MEK-1/ERK pathway leads to enhanced IL-10 promoter activity. Activation of the MEK-1/ERK pathway frequently leads to activation of downstream AP-1-dependent transcriptional activity (9, 33, 34), and we recently showed that SDF-1 selectively costimulates TCR-mediated AP-1 transcriptional activity (17). Because the human IL-10 promoter contains two putative AP-1 binding sites located approximately at –775 bp and –202 bp in all three common haplotypes of the IL-10 promoter (Fig. 2A), we hypothesized that AP-1 might mediate SDF-1 costimulatory effects on IL-10 gene transcription in T cells. To test this idea, we first asked whether the activity of the IL-10 promoter constructs in human T cells requires the two putative AP-1 sites. Mutagenesis of both AP-1 sites of the IL-10 promoter construct significantly impaired both TCR and TCR+SDF-1-mediated activation of the IL-10 promoter in T cells (Fig. 4A), suggesting a critical role for AP-1 in regulating activity of the IL-10 promoter in T cells. Consistent with this idea, the transcriptional activity in T cells of the unmutated IL-10 promoter constructs was abrogated by the MEK-1 inhibitor drug, PD098059 (data not shown).


Figure 4
View larger version (43K):
[in this window]
[in a new window]

  		FIGURE 4. SDF-1 costimulates activity of the human IL-10 promoter in T cells by enhancing binding of the AP-1 transcription factor to two nonpolymorphic binding sites located at –775 bp and –202 bp. A, Either the GCC haplotype IL-10 promoter luciferase construct or this construct with both putative AP-1 sites mutated (see Fig. 2A) was transiently transfected into purified human T cells. The cells were then stimulated as indicated and assayed for luciferase activity as in Fig. 2B. Fold increases in promoter activity were calculated as compared with unstimulated samples in the same experiment, and the results of multiple independent experiments were then normalized so that the fold increase of the unmutated, unstimulated construct in each experiment = 10. B, Normal human T cells of GCC/GCC genotype were stimulated as in Fig. 1A for 12 h. The presence of the AP-1 subunit, c-Fos, bound to two sites of the endogenous IL-10 promoter was then detected by ChIP assay. ChIP of the SDF-1 plus CD3 sample was also performed with control IgG (far right lane). The upper and middle gels denote c-Fos binding to the AP-1 sites located at ~–775 and –202 bp of the human IL-10 promoter (numbering is relative to the transcription start site). The lower gel shows a control PCR showing the amount of IL-10 promoter DNA present in each sample before ChIP (input). The results shown are representative of two independent experiments using different donors.

 
To further address whether SDF-1 costimulates IL-10 promoter activity by enhancing AP-1 binding to the IL-10 promoter, we used a ChIP assay. The most common transactivating form of AP-1 is composed of one c-Fos and one c-Jun subunit (35, 36). Purified human T cells were stimulated in vitro and c-Fos-specific Abs were used to immunoprecipitate AP-1 together with bound genomic DNA. PCR characterization of precipitated DNA revealed that, as compared with unstimulated cells or cells stimulated with either TCR or SDF-1 alone, TCR+SDF-1 stimulation enhanced c-Fos binding to both the –775 bp AP-1 binding site and the –202 AP-1 binding site of the endogenous IL-10 promoter (Fig. 4B, upper and middle gels). In contrast to the results obtained from using c-Fos-specific Abs for ChIP, IL-10 promoter DNA was not specifically immunoprecipitated by nonspecific control IgG (Fig. 4B, far right lane). Moreover, all samples contained similar amounts of IL-10 genomic DNA before immunoprecipitation (Fig. 4B, lower gel, input). Together, the results in this section indicate that SDF-1 costimulation enhances AP-1 binding to two sites of the human IL-10 promoter, and that this event is required for the promoter’s transcriptional activity in T cells.

SDF-1 costimulates IL-10 secretion by a subset of human CD4+ and CD8+ memory-phenotype T cells

To gain a better understanding of the immunological role of SDF-1 costimulation of T cell IL-10 secretion, we characterized T cell subsets that respond to SDF-1 costimulation with enhanced IL-10 production and secretion. Several T cell subsets have been previously shown to produce IL-10, including Th2 effector cells and various regulatory and memory T cell subsets (1, 37, 38, 39). We therefore purified human peripheral blood T cells according to their expression of CD4, CD8, and the naive/memory markers, CD45RA and CD45RO. Purified T cells were stimulated in vitro and assayed for secreted IL-10. Compared with naive-phenotype (CD45-RO-negative) T cells, SDF-1 potently costimulated IL-10 secretion by both CD4+ and CD8+ memory-phenotype (CD45-RA-negative) T cells (Fig. 5A). The effect of SDF-1 was particularly potent on CD4+CD45-RA-negative T cells: SDF-1 enhanced CD3-mediated IL-10 secretion by >10-fold in four of five donors (data not shown). Similar results were obtained using intracellular cytokine staining to detect IL-10-producing T cells (data not shown). Thus, SDF-1 costimulates IL-10 secretion by human CD4+ and CD8+ memory-phenotype T cells, particularly the CD4+ memory-phenotype T cells. Cell surface and other FACS analysis was then used together with intracellular cytokine staining to further characterize the CD4+ memory-phenotype T cells that express IL-10 after SDF-1 costimulation. Interestingly, CD4+ memory T cells that responded to SDF-1 costimulation with enhanced IL-10 production included cells both positive and negative for the transcription factor Foxp3 that has been associated with regulatory T cells (Fig. 5C). In contrast to Foxp3 staining, all IL-10+CD4+ memory-phenotype T cells were positive for the activation marker, CD69 (Fig. 5B). Similarly, all IL-10+ cells were positive for the activation marker, CD25 (data not shown). Thus, the CD4+ memory-phenotype T cells that respond to SDF-1 costimulation with enhanced IL-10 production appear to include both Foxp3+ regulatory and other types of memory-phenotype T cells. In addition to regulatory T cells, memory-phenotype T cell populations contain both "central" and "peripheral" memory T cells that are defined via expression or nonexpression of the CCR7 chemokine receptor, respectively (40). Most IL-10-secreting cells expressed CCR7; however, SDF-1 costimulated IL-10 production by both CCR7+ and CCR7– subsets of the CD4+ memory-phenotype T cells (Fig. 5D). Thus, SDF-1 appears to costimulate IL-10 secretion by a subset of both central and peripheral memory T cells. Finally, we assayed expression of the CXCR3 chemokine receptor by SDF-1-costimulated IL-10-expressing CD4+ memory-phenotype T cells. CXCR3 expression has been associated with both activation and tissue-homing effector and memory T cell subsets (41, 42, 43). Most IL-10-secreting cells expressed CXCR3, although SDF-1 costimulated IL-10 expression of CD4+ memory-phenotype T cells that were also CXCR3– (Fig. 5E). Together, these results indicate that SDF-1 is capable of costimulating IL-10 secretion by diverse T cell subsets within the population characterized by expression of the previously activated/memory cell surface CD45 markers, including presumed regulatory Foxp3+ T cells, both central and peripheral memory T cells, and CXCR3+ memory T cells.


Figure 5
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 5. SDF-1 costimulates IL-10 secretion by a subset of human CD4+ and CD8+ memory-phenotype T cells. Purified human T cells were separated into CD4, CD8, CD45RA, and CD45RO populations then stimulated in vitro as in Fig. 1A. A, Secreted IL-10 was assayed by ELISA as in Fig. 1C. Each bar shows the mean of two determinations ± range. B–E, Purified CD4+ memory-phenotype T cells stimulated as in A were further characterized by intracellular cytokine staining for IL-10 expression together with staining for either cell surface CD69, intracellular Foxp3, or cell surface CCR7 or CXCR3. Results in A–E are each typical of three to five independent experiments using different donors.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Despite extensive genetic evidence linking particular human IL-10 promoter polymorphisms to various autoimmune diseases and immune conditions (19, 20, 21, 22, 23), the molecular mechanisms that regulate activity of the human IL-10 promoter in T cells have until now been only poorly understood. Moreover, despite previous reports describing SDF-1 costimulation of IL-10 secretion by human T cells (17, 44, 45), neither the particular T cell subset(s) targeted by SDF-1, nor any signaling pathway(s) or molecular mechanisms responsible for this effect of SDF-1, have been defined. Knowledge about these mechanisms becomes particularly urgent to acquire as epidemiological evidence is accumulating that small, genetically determined differences in IL-10 secretion can significantly alter human susceptibility to certain autoimmune diseases and autoimmune conditions including Sjogren’s syndrome, rheumatoid arthritis, and graft-vs-host disease (20, 21, 22, 23, 24, 25). In addition, understanding the regulation of IL-10 secretion by T cells is of particular importance because experimental evidence indicates that T cell-derived IL-10, in contrast to IL-10 secreted by other cell types, is critical for inhibiting the development of autoimmunity (2) and the airway inflammation associated with allergy and asthma (3). We therefore investigated the molecular mechanisms responsible for SDF-1 costimulation of human T cell IL-10 secretion. In addition, we compared the effects of SDF-1 costimulation on common human T cell IL-10 locus haplotypes and investigated the subpopulation(s) of T cells in which IL-10 production is regulated by SDF-1.

Our results indicate that SDF-1 costimulates IL-10 secretion in human T cells via a mechanism in which SDF-1 enhances TCR-mediated activation of the MEK-1/ERK signaling pathway, thereby leading to enhanced AP-1 production, enhanced AP-1 binding to the IL-10 promoter, and enhanced IL-10 gene transcription. Moreover, we show that the costimulatory effects of SDF-1 on IL-10 promoter activity and T cell secretion of IL-10 are haplotype-independent, occurring similarly in all three of the most common haplotypes of the polymorphic IL-10 promoter. Finally, we show that SDF-1 costimulates IL-10 secretion by several T cell populations that are characterized by cell surface memory-marker phenotypes, including T cells both expressing and not expressing the putative regulatory T cell marker, Foxp3. Together, our results represent a novel and important advance in the understanding of the molecular and genetic regulation of the human IL-10 promoter in T cells. The signaling pathway defined in this study may in addition represent a mechanism that could be usefully modulated therapeutically to regulate T cell IL-10 secretion and related immunopathologies.

No previous studies have determined whether SDF-1 costimulates IL-10 in a haplotype-dependent or -independent manner. We found that SDF-1 costimulated IL-10 secretion by human T cells from all donors tested, whether or not the donor was positive for the previously reported high-expressing IL-10 promoter haplotype that is identified by the –1082 G SNP (25, 26). To more clearly define the effects of SDF-1 costimulation on IL-10 promoter activity, and the impact of different haplotypes on this effect of SDF-1, we isolated and cloned into luciferase analysis plasmids the three most common haplotypes of IL-10 promoters from human donors that are defined by three linked SNPs of ATA, ACC, and GCC. In normal human T cells, TCR stimulation increased the promoter activities of all three haplotypes, and SDF-1 costimulation significantly further enhanced the promoter activities of all three haplotypes. Thus, SDF-1 costimulates T cell IL-10 secretion in a similar manner in the three most common polymorphic variants of the human IL-10 promoter.

The above results suggested that SDF-1 costimulation of human IL-10 promoter activity is mediated via a nonpolymorphic transcription factor binding site of the promoter. Several of our results indicate that SDF-1 costimulates T cell IL-10 gene transcription and IL-10 secretion by enhancing TCR-mediated activation of the MEK-1-ERK pathway and downstream AP-1, which then binds the IL-10 promoter at a nonpolymorphic site and enhances its transcriptional activity. First, we recently showed that SDF-1/CXCR4 signals in T cells via the TCR, and that this novel pathway is required for SDF-1 to stimulate prolonged ERK activation and robust activation of AP-1-dependent transcriptional activity (16, 17). SDF-1 is relatively unique among several chemokines in its ability to stimulate ERK activation in T cells for a prolonged period of time (18), suggesting that SDF-1-mediated ERK activation subserves a special biological role. Indeed, whereas blockade of MEK-1/ERK activation has no effect on SDF-1-directed chemotaxis (46), MEK-1/ERK activity is required for SDF-1 to induce the expression of multiple genes involved in signal transduction and for the prevention of apoptosis in a T cell line (9). ERK phosphorylates and regulates the functions of transcription factors (47, 48), thereby regulating gene expression. Second, we showed that SDF-1 costimulates TCR-mediated activation of the MEK-1-ERK pathway, and that blockade of this pathway by a MEK-1 inhibitor drug abrogates both IL-10 mRNA accumulation and IL-10 secretion by stimulated T cells. Third, we showed that mutation of two nonpolymorphic consensus AP-1 binding sites within the IL-10 promoter disrupts activation of this promoter in T cells. Fourth, we showed using a ChIP assay that SDF-1 plus TCR stimulation of human T cells enhances the binding of c-Fos-containing AP-1 transcription factors to the IL-10 promoter. Together, these results provide strong support for the idea that the mechanism by which SDF-1 costimulates T cell IL-10 secretion is by enhancing TCR-mediated activation of the MEK-1/ERK signaling pathway, which leads to enhanced AP-1 production, enhanced AP-1 binding to the IL-10 promoter, and enhanced IL-10 gene transcription. Similar to the classic situation of CD28 costimulation of the IL-2 promoter, our results also indicate that activation of the ERK/AP-1 pathway by SDF-1 is not by itself sufficient to induce IL-10 secretion. Thus, in addition to activation of the ERK/AP-1 pathway, other regulatory signals induced in response to anti-CD3/TCR stimulation are likely to be required for IL-10 secretion.

This is the first study to indicate the importance of AP-1 in regulating IL-10 promoter activity in human T cells. Basal promoter elements have previously been shown to exist near the IL-10 promoter TATA-box (49). As for many inducible promoters, an Sp1 binding site at approximately –80 bp relative to the transcription start site is essential for IL-10 promoter activity in T cells and macrophages of both humans and mice (50, 51, 52). Analysis of the human IL-10 promoter in the human T lymphoma cell line HuT78 identified and characterized roles for NF-{kappa}B in its regulation (53), and a STAT3 site located at –120 bp was shown to be involved in LPS-induced activation of the human IL-10 promoter in a B cell line (54). A SMAD binding site previously characterized as mediating IL-10 secretion in murine T cells in response to TGF-beta is unlikely to function in human T cells because it is not present in the human IL-10 promoter (55). In contrast to this SMAD binding site, AP-1 regulation of the IL-10 promoter in T cells is likely to be conserved between mouse and humans, because the mouse IL-10 promoter also contains an AP-1 binding site that was shown to be functional in a mouse Th2 cell clone (56). The ATA, ACC, and GCC haplotypes have been associated with low, medium, and high levels of IL-10 secretion, respectively (25, 26). However, none of these previously reported linked polymorphisms, nor any other polymorphisms of the IL-10 promoter described in the literature, specifically target either AP-1 site.

Our results further indicate that SDF-1 costimulates IL-10 secretion by several different subsets of previously activated T cells. SDF-1 costimulated both central and peripheral memory T cells defined as CD45RA– and either CCR7+ or CCR7–, as well as CD45RA– T cells that are CXCR3+ and may therefore be capable of migrating into inflamed tissues. SDF-1 also appears to costimulate IL-10 secretion by CD4+CD45RA– T cells that are both positive and negative for the presumed regulatory T cell marker, Foxp3. SDF-1 costimulation of T cell IL-10 secretion may therefore have the potential to broadly antagonize inflammatory responses, both in the lymph nodes and within inflamed tissues.

The biological functions of many chemokine receptors including CXCR4 are often assumed to be derived primarily from their ability to regulate cellular migration. Thus, SDF-1/CXCR4 signaling has been proposed to play a homeostatic role in regulating the migration patterns of immune and other cell types (10, 11). In this study, we show that SDF-1/CXCR4 signaling also significantly regulates T cell gene expression of the critical immune regulatory cytokine, IL-10. SDF-1/CXCR4 signaling therefore appears to contribute to immune homeostasis via multiple critical mechanisms, including both immune cell migration and regulation of IL-10 gene expression. Although IL-10 levels have not been specifically examined in mice or humans either completely or partially deficient in expression of SDF-1 and/or CXCR4, it is therefore possible that some phenotypes and conditions associated with mutation of these genes might be exacerbated by changes in SDF-1-dependent IL-10 secretion in addition to changes in SDF-1-dependent cellular migration. For example, mice completely deficient in either SDF-1 or CXCR4 die perinatally from multiple developmental defects in the brain, gut, and bone marrow (10). Humans bearing a relatively common human SDF-1 polymorphism (801A) that is thought to decrease SDF-1 expression (57) are at higher risk for certain conditions that might theoretically be exacerbated by low IL-10 levels, including transmitting HIV-1 maternally (58), developing early onset type I diabetes after a shorter lag time (59), and developing lung cancer (60). In addition, rare mutations in CXCR4 that truncate CXCR4 and enhance some SDF-1-dependent signals are linked to WHIM syndrome, which is characterized by extensive human papillomavirus infection in addition to other pathologies (61). Thus, SDF-1/CXCR4 signaling may contribute to immune homeostasis via multiple critical mechanisms, including both immune cell migration and regulation of IL-10 gene expression.


   Acknowledgments
 
We are grateful to J. Tarara and the Mayo Flow Cytometry Core Facility for providing expert technical assistance and to L. Pease, R. Bram, S. Kauffman, and P. Leibson for comments on the manuscript.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by the philanthropy of Barbara Lipps to the Mayo Clinic and by National Institutes of Health RO1 Grant GM59763 (to K.E.H.). Back

2 Address correspondence and reprint requests to Dr. Karen E. Hedin, Mayo Clinic, Department of Immunology, Guggenheim Building, 3rd Floor, 200 First Street Southwest, Rochester, MN 55905. E-mail address: hedin.karen{at}mayo.edu Back

3 Abbreviations used in this paper: SDF-1, stromal cell-derived factor-1; HIV-1, HIV type-1; SNP, single-nucleotide polymorphism; ChIP, chromatin immunoprecipitation. Back

Received for publication May 22, 2006. Accepted for publication November 11, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Groux, H., F. Cottrez. 2003. The complex role of IL-10 in autoimmunity. J. Autoimm. 20: 281-285.
  2. Roers, A., L. Siewe, E. Strittmatter, M. Deckert, D. Schluter, W. Stenzel, A. D. Gruber, T. Krieg, L. Rajewsky, W. Muller. 2004. T cell-specific inactivation of the IL-10 gene in mice results in enhanced T cell responses but normal innate responses to lipopolysaccharide or skin irritation. J. Exp. Med. 200: 1289-1297. [Abstract/Free Full Text]
  3. Hawrylowicz, C. M., A. O’Garra. 2005. Potential role of interleukin-10-secreting regulatory T cells in allergy and asthma. Nat. Rev. Immunol. 5: 271-283. [Medline]
  4. Ansel, K. M., J. G. Cyster. 2001. Chemokines in lymphopoiesis and lymphoid organ development. Curr. Opin. Immunol. 13: 172-179. [Medline]
  5. Campbell, J. J., E. C. Butcher. 2000. Chemokines in tissue-specific and microenvironment-specific lymphocyte homing. Curr. Opin. Immunol. 12: 336-341. [Medline]
  6. Murphy, P. M., M. Baggiolini, I. F. Charo, C. A. Hebert, R. Horuk, K. Matsushima, L. H. Miller, J. J. Oppenheim, C. A. Power. 2000. International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52: 145-176. [Abstract/Free Full Text]
  7. Laudanna, C., J. Y. Kim, G. Constantin, E. C. Butcher. 2002. Rapid leukocyte integrin activation by chemokines. Immunol. Rev. 186: 37-46. [Medline]
  8. Phillips, R., A. Ager. 2002. Activation of pertussis toxin-sensitive CXCL12 (SDF-1) receptors mediates transendothelial migration of T lymphocytes across lymph node high endothelial cells. Eur. J. Immunol. 32: 837-847. [Medline]
  9. Suzuki, Y., M. Rahman, H. Mitsuya. 2001. Diverse transcriptional response of CD4+ T cells to Stromal cell-derived factor (SDF)-1: cell survival promotion and priming effects of SDF-1 on CD4+ T cells. J. Immunol. 167: 3064-3073. [Abstract/Free Full Text]
  10. Zou, Y.-R., A. H. Kottmann, M. Kuroda, I. Taniuchi, D. R. Littman. 1998. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393: 595-599. [Medline]
  11. Sawada, S., K. Gowrishankar, R. Kitamura, M. Suzuki, G. Suzuki, S. Tahara, A. Koito. 1998. Disturbed CD4+ T cell homeostasis and in vitro HIV-1 susceptibility in transgenic mice expressing T cell line-tropic HIV-1 receptors. J. Exp. Med. 187: 1439-1449. [Abstract/Free Full Text]
  12. Gonzalo, J. A., C. M. Lloyd, A. Peled, T. Delaney, A. J. Coyle, J. C. Gutierrez-Ramos. 2000. Critical involvement of the chemotactic axis CXCR4/stromal cell-derived factor-1{alpha} in the inflammatory component of allergic airway disease. J. Immunol. 165: 499-508. [Abstract/Free Full Text]
  13. Matin, K., M. A. Salam, J. Akhter, N. Hanada, H. Senpuku. 2002. Role of stromal-cell derived factor-1 in the development of autoimmune diseases in non-obese diabetic mice. Immunology 107: 222-232. [Medline]
  14. Verani, A., P. Lusso. 2002. Chemokines as natural HIV antagonists. Curr. Mol. Med. 2: 691-702. [Medline]
  15. Feng, Y., C. C. Broder, P. E. Kennedy, E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272: 1955-1958. [Abstract]
  16. Kremer, K. N., T. D. Humphreys, A. Kumar, N.-X. Qian, K. E. Hedin. 2003. Distinct role of ZAP-70 and Src Homology 2 domain-containing leukocyte protein of 76 kDa in the prolonged activation of extracellular signal-regulated protein kinase by the stromal-cell-derived factor 1-{alpha}/CXCL12 chemokine. J. Immunol. 171: 360-367. [Abstract/Free Full Text]
  17. Kumar, A., T. D. Humphreys, K. N. Kremer, P. S. Bramati, L. Bradfield, C. E. Edgar, K. E. Hedin. 2006. CXCR4 physically associates with the T cell receptor to signal in T cells. Immunity 25: 213-224. [Medline]
  18. Tilton, B., L. Ho, E. Oberlin, P. Loetscher, F. Baleux, I. Clark-Lewis, M. Thelen. 2000. Signal transduction by CXC chemokine receptor 4: stromal cell-derived factor 1 stimulates prolonged protein kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes. J. Exp. Med. 192: 313-324. [Abstract/Free Full Text]
  19. Kim, J. M., C. I. Brannan, N. G. Copeland, N. A. Jenkins, T. A. Khan, K. W. Moore. 1992. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J. Immunol. 148: 3618-3623. [Abstract]
  20. Kube, D., C. Platzer, A. von Knethen, H. Straub, H. Bohlen, M. Hafner, H. Tesch. 1995. Isolation of the human IL-10 promoter: characterization of the promoter activity in Burkitt’s lymphoma cell lines. Cytokine 7: 1-7. [Medline]
  21. Eskdale, J., D. Kube, H. Tesch, G. Gallagher. 1997. Mapping of the human IL-10 gene and further characterization of the 5' flanking sequence. Immunogenetics 46: 120-128. [Medline]
  22. Kube, D., H. Rieth, J. Eskdale, P. G. Kremsner, G. Gallagher. 2001. Structural characterisation of the distal 5' flanking region of the human IL-10 gene. Genes Immun. 2: 181-190. [Medline]
  23. Lin, M.-T., B. Storer, P. J. Martin, L.-H. Tseng, T. Gooley, P.-J. Chen, J. A. Hansen. 2003. Relation of an IL-10 promoter polymorphism to graft-versus-host disease and survival after hematopoietic-cell transplantation. N. Engl. J. Med. 349: 2201-2210. [Abstract/Free Full Text]
  24. Howell, W. M.. 2005. Cytokine polymorphisms, cancer susceptibility, and prognosis. American Society for Histocompatibility and Immunogenetics Quarterly First Quarter 2005: 10-15.
  25. Eskdale, J., G. Gallagher, C. L. Verweij, V. Keijsers, R. G. J. Westendorp, T. W. J. Huizinga. 1998. IL-10 secretion in relation to human IL-10 locus haplotypes. Proc. Natl. Acad. Sci. USA 95: 9465-9470. [Abstract/Free Full Text]
  26. Hoffman, S. C., E. M. Stanley, E. D. Cox, N. Craighead, B. S. DiMercurio, D. E. Koziol, D. M. Harlan, A. D. Kirk, P. J. Blair. 2001. Association of cytokine polymorphic inheritance and in vitro cytokine production in anti-CD3/CD28-stimulated peripheral blood lymphocytes. Transplantation 72: 1444-1450. [Medline]
  27. Bidwell, J., L. Keen, G. Gallagher, R. Kimberly, T. Huizinga, M. F. McDermott, J. Oksenberg, J. McNicholl, F. Pociot, C. Hardt, S. D’Alfonso. 1999. Cytokine gene polymorphism in human disease: on-line databases. Genes Immun. 1: 3-19. [Medline]
  28. Haukim, N., J. Bidwell, A. J. P. Smith, L. Keen, G. Gallagher, R. Kimberly, T. Huizinga, D. H. McDermott, J. Oksenberg, J. McNicholl, et al 2002. Cytokine gene polymorphism in human disease: on-line databases. Genes Immun. 3: (Suppl. 2):313-330. [Medline]
  29. Shin, H. D., C. Winkler, J. C. Stephens, J. Bream, H. Young, J. J. Goedert, T. R. O’Brien, D. Vlahov, S. Buchbinder, J. Giorgi, et al 2000. Genetic restriction of HIV-1 pathogenesis to AIDS by promoter alleles of IL-10. Proc. Natl. Acad. Sci. USA 97: 14467-14472. [Abstract/Free Full Text]
  30. Bell, M. P., C. Huntoon, D. Graham, D. J. McKean. 2001. The analysis of costimulatory receptor signaling cascades in normal T lymphocytes using in vitro gene transfer and reporter gene analysis. Nat. Med. 10: 1155-1158. [Medline]
  31. Powell, M. J., S. A. J. Thampson, Y. Tone, H. Waldmann, M. Tone. 2000. Posttranscriptional regulation of IL-10 gene expression through sequences in the 3'-untranslated region. J. Immunol. 165: 292-296. [Abstract/Free Full Text]
  32. Winzen, R., M. Kracht, B. Ritter, A. Wilhelm, C.-Y. A. Chen, A.-B. Shyu, M. Muller, M. Gaestel, K. Resch, H. Holtmann. 1999. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region targeted mechanism. EMBO J. 18: 4969-4980. [Medline]
  33. Vaudry, D., P. J. Stork, P. Lazarovici, L. E. Eiden. 2002. Signaling pathways for PC12 cell differentiation: making the right connections. Science 296: 1648-1649. [Abstract/Free Full Text]
  34. Harada, T., T. Morooka, S. Ogawa, E. Nishida. 2001. ERK induces p35, a neuron-specific activator of CDK5, through induction of Egr1. Nature Cell Biol. 3: 453-459. [Medline]
  35. Murphy, L. O., S. Smith, R.-H. Chen, D. C. Fingar, J. Blenis. 2002. Molecular interpretation of ERK signal duration by immediate early gene products. Nature Cell Biol. 4: 556-564. [Medline]
  36. Treisman, R.. 1994. Ternary complex factors: growth factor regulated transcriptional activators. Curr. Opin. Gen. Dev. 4: 96-101. [Medline]
  37. Moore, K. W., R. D. W. Malefyt, R. L. Coffman, A. O’Garra. 2001. IL-10 and the IL-10 receptor. Annu. Rev. Immunol. 19: 683-765. [Medline]
  38. Yssel, H., R. D. W. Malefyt, M.-G. Roncarolo, J. S. Abrams, R. Lahesmaa, H. Spits, J. E. deVries. 1992. IL-10 is produced by subsets of human CD4+ T cell clones and peripheral blood T cells. J. Immunol. 149: 2378-2384. [Abstract]
  39. Bouma, G., W. Strober. 2003. The immunological and genetic basis of inflammatory bowel disease. Nat. Rev. Immunol. 3: 521-533. [Medline]
  40. Sallusto, F., A. Lanzavecchia. 2001. Exploring pathways for memory T cell generation. J. Clin. Invest. 108: 805-806. [Medline]
  41. Loetscher, M., P. Loetscher, N. Brass, E. Meese, B. Moser. 1998. Lymphocyte-specific chemokine receptor CXCR3: regulation, chemokine binding, and gene localization. Eur. J. Immunol. 28: 3696-3705. [Medline]
  42. Hancock, W. W., W. Gao, K. Faia, V. Csizmadia. 2000. Chemokines and their receptors in allograft rejection. Curr. Opin. Immunol. 12: 511-516. [Medline]
  43. Lazzeri, E., P. Romagnani. 2005. CXCR3-binding chemokines: novel multifunctional therapeutic targets. Curr. Drug Targets Immune Endocr. Metabol. Disord. 5: 109-118. [Medline]
  44. Nanki, T., P. E. Lipsky. 2000. Cutting edge: stromal cell-derived factor-1 is a costimulator for CD4+ T cell activation. J. Immunol. 164: 5010-5014. [Abstract/Free Full Text]
  45. Molon, B., G. Gri, M. Bettella, C. Gomez-Mouton, A. Lanzavecchia, C. Martinez-A, S. Manes, A. Viola. 2005. T cell costimulation by chemokine receptors. Nat. Immunol. 6: 465-471. [Medline]
  46. Cherla, R. P., R. K. Ganju. 2001. Stromal cell-derived factor 1{alpha}-induced chemotaxis in T cells is mediated by nitric oxide signaling pathways. J. Immunol. 166: 3067-3074. [Abstract/Free Full Text]
  47. Marshall, C. J.. 1994. MAP kinase kinase kinase, MAP kinase kinase, and MAP kinase. Curr. Opin. Genet. Dev. 4: 82-89. [Medline]
  48. Chang, L., M. Karin. 2001. Mammalian MAP kinase signalling cascades. Nature 410: 37-40. [Medline]
  49. Brenner, S., S. Prosch, K. Schenke-Layland, U. Riese, U. Gausmann, C. Platzer. 2003. cAMP-induced IL-10 promoter activation depends on CCAAT/enhancer-binding protein expression and monocytic differentiation. J. Biol. Chem. 278: 5597-5604. [Abstract/Free Full Text]
  50. Tone, M., M. J. Powell, Y. Ton, S. A. J. Thompson, H. Waldmann. 2000. IL-10 gene expression is controlled by the transcription factors Sp1 and Sp3. J. Immunol. 165: 286-291. [Abstract/Free Full Text]
  51. Brightbill, H. D., S. E. Plevy, R. L. Modlin, S. T. Smale. 2000. A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J. Immunol. 164: 1940-1951. [Abstract/Free Full Text]
  52. Ma, W., W. Lim, K. Gee, S. Aucoin, D. Nandan, M. Kozlowski, F. Diaz-Mitoma, A. Kumar. 2001. The p38 mitogen-activated kinase pathway regulates the human IL-10 promoter via the activation of Sp1 transcription factor in lipopolysaccharide-stimulated human macrophages. J. Biol. Chem. 276: 13664-13674. [Abstract/Free Full Text]
  53. Mori, N., D. Prager. 1997. Activation of the IL-10 gene in the human T lymphoma line HuT 78: identification and characterization of NF-{kappa}B binding sites in the regulatory region of the IL-10 gene. Eur. J. Haematol. 59: 162-170. [Medline]
  54. Benkahrt, E. M., M. Siedlar, A. Wedel, T. Werner, H. W. L. Ziegler-Heitbrock. 2000. Role of STAT3 in lipopolysaccharide-induced IL-10 gene expression. J. Immunol. 165: 1612-1617. [Abstract/Free Full Text]
  55. Kitani, A., I. Fuss, K. Nakamura, F. Kumaki, T. Usui, W. Strober. 2003. Transforming growth factor (TGF)-beta-1-producing regulatory T cells induce SMAD-mediated IL-10 secretion that facilitates coordinated immunoregulatory activity and amelioration of TGF-beta-1-mediated fibrosis. J. Exp. Med. 198: 1179-1188. [Abstract/Free Full Text]
  56. Wang, Z.-Y., H. Sato, S. Kusam, S. Sehra, L. M. Toney, A. L. Dent. 2005. Regulation of IL-10 gene expression in Th2 cells by Jun proteins. J. Immunol. 174: 2098-2105. [Abstract/Free Full Text]
  57. Dommange, F., G. Cartron, C. Espanel, N. Gallay, J. Domenech, L. Benboubker, M. Ohresser, P. Colombat, C. Binet, H. Watier, O. Herault. 2006. CXCL12 polymorphism and malignant cell dissemination/tissue infiltration in acute myeloid leukemia. FASEB J. 20: 1913-1915. [Abstract/Free Full Text]
  58. John, G. C., C. Rousseau, T. Dong, S. Rowland-Jones, R. Nduati, D. Mbori-Ngacha, T. Rostron, J. K. Kreiss, B. A. Richardson, J. Overbaugh. 2000. Maternal SDF1 3' A polymorphism is associated with increased perinatal human immunodeficiency virus type 1 transmission. J. Virol. 74: 5736-5739. [Abstract/Free Full Text]
  59. Dubois-Laforgue, D., H. Hendel, S. Caillat-Zucman, J.-F. Zagury, C. Winkler, C. Boitard, J. Timsit. 2001. A common stromal cell-derived factor-1 chemokine gene variant is associated with the early onset of type 1 diabetes. Diabetes 50: 1121-1213.
  60. Razmkhah, M., M. Doroudchi, S. M. A. Ghayumi, N. Erfani, A. Ghaderi. 2005. Stromal cell-derived factor-1 (SDF-1) gene and susceptibility of Iranian patients with lung cancer. Lung Cancer 49: 311-315. [Medline]
  61. Hernandez, P. A., R. J. Gorlin, J. N. Lukens, S. Taniuchi, J. Bohinjec, F. Francois, M. E. Klotman, G. A. Diaz. 2003. Mutations in the chemokine receptor gene CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease. Nat Genet. 34: 70-74. [Medline]



This article has been cited by other articles:


Home page
 J. Virol.Home page
D. D. Sloan and K. R. Jerome
Herpes Simplex Virus Remodels T-Cell Receptor Signaling, Resulting in p38-Dependent Selective Synthesis of Interleukin-10
J. Virol., November 15, 2007; 81(22): 12504 - 12514.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kremer, K. N.
Right arrow Articles by Hedin, K. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kremer, K. N.
Right arrow Articles by Hedin, K. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS