The Journal of Immunology, 2007, 178: 817-828.
Copyright © 2007 by The American Association of Immunologists, Inc.
SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase1
Megan M. McCausland*,
Isharat Yusuf*,
Hung Tran*,
Nobuyuki Ono
,
Yusuke Yanagi
and
Shane Crotty2,*
* Division of Vaccine Discovery, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037;
Department of Medical Biophysics and Immunology, Princess Margaret Hospital, Toronto, Canada; and
Department of Virology, Faculty of Medicine, Kyushu University, Fukuoka, Japan
 |
Abstract
|
|---|
Mutations in SH2D1A resulting in lack of SLAM-associated protein (SAP) expression cause the human genetic immunodeficiency X-linked lymphoproliferative disease. A severe block in germinal center development and lack of long-term humoral immunity is one of the most prominent phenotypes of SAP mice. We show, in this study, that the germinal center block is due to an essential requirement for SAP expression in Ag-specific CD4 T cells to develop appropriate follicular helper T cell functions. It is unknown what signaling molecules are involved in regulation of SAP-dependent CD4 T cell help functions. SAP binds to the cytoplasmic tail of SLAM, and we show that SLAM is expressed on resting and activated CD4 T cells, as well as germinal center B cells. In addition, SAP can recruit Fyn kinase to SLAM. We have now examined the role(s) of the SLAM-SAP-Fyn signaling axis in in vivo CD4 T cell function and germinal center development. We observed normal germinal center development, long-lived plasma cell development, and Ab responses in SLAM/ mice after a viral infection (lymphocytic choriomeningitis virus). In a separate series of experiments, we show that SAP is absolutely required in CD4 T cells to drive germinal center development, and that requirement does not depend on SAP-Fyn interactions, because CD4 T cells expressing SAP R78A are capable of supporting normal germinal center development. Therefore, a distinct SAP signaling pathway regulates follicular helper CD4 T cell differentiation, separate from the SLAM-SAP-Fyn signaling pathway regulating Th1/Th2 differentiation.
 |
Introduction
|
|---|
The gene SH2D1A (SAP/DSHP) encodes SLAM-associated protein (SAP).3 Mutations in SH2D1A resulting in lack of SAP expression or destabilized SAP protein are the cause of the human genetic immunodeficiency X-linked lymphoproliferative disease (XLP) (1, 2, 3). XLP patients exhibit a variety of immunological defects. The most notable and problematic symptoms of SAP-deficient humans are the inability to control EBV infection (as well as difficulties with other infections, including measles virus, Neisseria meningitidis, and vaccinia virus), the development of progressive hypogammaglobulinemia, and a heightened occurrence of B cell lymphomas (4, 5, 6, 7). Before recent improvements in diagnosis and treatment, most XLP patients died before reaching adulthood.
SAP is a small SH2-domain protein expressed in CD4 T cells, CD8 T cells, NK cells, NKT cells, and some B cells (3, 8, 9). SAP is now known to play a role in an impressive array of lymphocyte functions. Examination of SAP-deficient mice revealed roles for SAP in CD8 and CD4 T cell proliferation (10, 11, 12, 13, 14), T cell IFN-
production (10, 11, 15), CD4 T cell Th1/Th2 differentiation (10, 11, 16, 17), and germinal center formation, and the generation of memory B cells (12, 18). Recent work has also shown that SAP is essential for the development of NKT cells, both in mice and humans (19, 20, 21). Work in XLP humans has confirmed the memory B cell defect and germinal center defect observed in SAP mice (22, 23, 24). Separately, a collection of studies in humans have shown that SAP plays multifaceted roles in the regulation of NK cell killing (25, 26, 27). How does SAP regulate or influence such a wide range of lymphocyte functions? SAP binds to the cytoplasmic tail of SLAM (CD150) via an ITAM/ITIM-related motif termed an immunotyrosine switch motif (ITSM) (3, 28, 29). SLAM plays roles in cell adhesion (via homotypic interactions), costimulation, and cytokine synthesis (28, 30, 31, 32, 33). SLAM is also the primary receptor for measles virus, a highly lymphotropic virus (34, 35, 36). A cluster of seven receptors related to SLAM are closely grouped together on chromosome 1 of both mice and humans. These genes are termed the SLAM family of receptors: CD150 (SLAM), CD244 (2B4), CD229 (Ly9), CS1 (CRACC), CD48, CD84, and LY108 (NTB-A) (4, 5, 28). All of these genes encode surface receptors with at least two ITSM motifs in their cytoplasmic tail, except CD48, which has no cytoplasmic tail (28). Intriguingly, a major systemic lupus erythematosus genetic susceptibility locus maps to the SLAM family receptors in both human and mice (37, 38). SAP is known to bind to SLAM, CD244, CD229, CD84, and Ly108/NTB-A (3, 26, 39, 40). SAP binding to these receptors is not identical, because SAP can bind to SLAM in the presence or absence of tyrosine phosphorylation (41). SAP binding to other SLAM family receptors appears to be fully dependent on tyrosine phosphorylation.
The initial observation that SAP is a small SH2 domain protein without any additional adaptor or enzymatic domains led to the observation that SAP can function as a negative inhibitor, preventing other SH2 domain containing proteins from binding the ITSM phosphotyrosines of SLAM family receptors (3). Subsequently, it was shown that SAP recruits Fyn kinase to SLAM (and other SLAM family receptors) by direct binding via an unconventional SH3 domain binding surface (15, 42, 43). That surprising recruitment and activation of Fyn is critical for SAP regulation of Th2 differentiation in CD4 T cells (16, 17) and controlling IFN-
production (17, 42). SAP-Fyn interactions also appear to be essential for NKT cell development, because NKT cells are absent in Fyn/ and SAP mouse strains (19, 20, 21, 44). Therefore, data currently in the literature indicate that SAPs major signaling contributions in T cells may occur primarily via recruitment of Fyn kinase to different SLAM family receptors.
A severe block in germinal center development is one of the most prominent phenotypes of SAP mice. That block results in a failure to generate memory B cells and long-lived plasma cells, and thereby results in a failure to establish long-term humoral immunity (4, 12). This role for SAP in humoral immunity and immunological memory is conserved in humans (4, 22, 23, 24). We show in this study that the germinal center block is due to an essential requirement for SAP expression in Ag-specific CD4 T cells to develop appropriate follicular helper CD4 T cell functions. It is unknown what signaling molecules are involved in SAP-dependent regulation of CD4 T cell help functions and humoral immunity. Our studies reported in this study have focused on dissecting the role(s) of the SLAM-SAP-Fyn signaling axis in germinal center development, because SLAM is the prototypic member of the SLAM family of receptors and Fyn is the primary downstream kinase activated by SAP. We observed normal germinal center development in SLAM-deficient mice. In a separate series of experiments, we demonstrate that whereas SAP is absolutely required in CD4 T cells to drive germinal center development, germinal center T cell help is not dependent on SAP-Fyn interaction. Therefore, a distinct SAP signaling pathway regulates follicular helper CD4 T cell differentiation, separate from the SLAM-SAP-Fyn signaling pathway regulating Th1/Th2 differentiation.
 |
Materials and Methods
|
|---|
Mice
C57BL/6J (B6), B6 CD4/, and B6 SJL (Ly5.1+/+) mice were purchased from The Jackson Laboratory. SLAM/ mice were generated at Kyushu University by replacing exon 2 of the CD150 gene with a neo cassette in a 129 ES cell line (17). SLAM-deficient 129 mice were backcrossed two generations to C57BL/6, and SLAM/ and SLAM+/ progeny from that F2 cross were interbred and used in all experiments. SAP mice backcrossed nine generations to B6 were provided by Dr. P. Schwartzberg (National Human Genome Research Institute, National Institutes of Health, Bethesda, MD) (10), and then backcrossed to B6 for one additional generation and bred at La Jolla Institute for Allergy and Immunology (LIAI). Because the SAP gene is X-linked, knockout mice were either or /. SMARTA-2 TCR transgenic mice (SMtg+) are specific for the immunodominant I-Ab MHC class II (MHCII) lymphocytic choriomeningitis virus (LCMV) epitope gp6180 (45), and SMtg+ mice fully backcrossed to B6 were obtained from Dr. C. Surh (The Scripps Research Institute, San Diego, CA), courtesy of Dr. H. Hengartner (Zurich, Switzerland) and Dr. R. Zinkernagel (Zurich, Swizterland), and then bred at LIAI and backcrossed to Ly5.1+ congenics. SAPSMtg+Ly5.1+/+ B6 and SMtg+Ly5.1+/+ B6 mice were generated in-house. Sex-matched, 6- to 12-wk-old mice were used for all LCMVarm infection experiments. Animals were maintained in an accredited facility at the LIAI, and the studies reported in this study conform to the principles outlined by the Animal Welfare Act and the National Institutes of Health guidelines for the care and use of animals in biomedical research.
Viruses
Plaque-purified clones of the Armstrong strain of LCMV (LCMVarm) were propagated in BHK-21 cells (American Type Culture Collection) (46), and tested for biological activity in vitro and in vivo (M. M. McCausland and S. Crotty, unpublished data). A second passage stock of subclone SC3 (LCMVarm-sc3) was used for all LCMVarm experiments. For acute infections, mice received 1 x 105 PFU LCMVarm in a volume of 0.5 ml (suspended in RPMI 1640) by bilateral i.p. inoculation.
Lymphocyte isolation and purification
Single-cell suspensions of spleen were prepared by standard gentle mechanical disruption through a 70-µm nylon mesh screen (BD Falcon) using a 3-ml syringe plunger (BD Biosciences), followed by removal of RBC with ACK Lysis Solution (BioSource International).
Untouched SMtg+ CD4 T cells were magnetically purified from spleen and lymph node preparations (MACS CD4 T cell Isolation Kit; Miltenyi Biotec). A total of 95% purity and naive status was confirmed by surface Ab staining (CD4, V
2, V
8.3, CD44, and CD62L) and flow cytometry.
Flow cytometry staining and analysis
Staining for flow cytometry used mAbs to CD4, B220, CD44, CD45.1, CD45.2, CD62L, CD19, CD3, IFN-
, TNF, IL-2 (eBioscience); polyclonal goat anti-mouse IgG
(Caltag Laboratories); Fas, CD138, V
2, V
8.3 (BD Pharmingen); CD150 (SLAM) (clone TC15-12F12.2; Biolegend); biotinylated anti-IgD (Southern Biotechnology Associates); streptavidin-allophycocyanin, streptavidin-PE, and FITC-labeled peanut lectin agglutinin (PNA) (Vector Laboratories). MHCI tetramer of Db loaded with LCMV GP3341 was provided by Dr. H. Cheroutre (LIAI, La Jolla, CA). Cells were fixed in 2% ultrapure formaldehyde (Polysciences) before acquisition. Flow cytometry samples were acquired on a FACSCalibur instrument (BD Biosciences) and analyzed using FlowJo software (Tree Star). For intracellular cytokine staining, 1 x 106 cells were cultured in the absence or presence of 2 µg/ml MHCII peptide (LCMV gp6180 or np309328) or 0.2 µg/ml MHCI peptide (LCMV gp3341 or gp276286) and brefeldin A for 56 h at 37°C. Following staining for surface Ags, cells were fixed and permeabilized with 2% (w/v) paraformaldehyde and 0.1% saponin for 15 min, then stained for the intracellular cytokine of interest in the presence of 0.1% saponin and 2% Newborn calf serum for 30 min. Cells were washed and then fixed in 2% ultrapure formaldehyde before acquisition.
Ig ELISA
Anti-LCMV Ab was measured by ELISA using sonicated cell lysate from LCMV-infected BHK-21 cells as capture Ag. Ninety-six-well Polysorp microtiter plates (Nunc) were coated overnight with lysate in PBS and then UV inactivated (300 mJ in Stratalinker 1800; Stratagene). All samples were run in duplicate. HRP-conjugated goat anti-mouse Ig secondary Abs directed against IgG
or the isotype or IgG subclass of interest (Caltag Laboratories) were used.
Duplicate 2-fold serial dilutions of mAb 11.3 were run in each LCMV ELISA as a calibrated standard. Mouse mAb 11.3 directed against LCMV nucleoprotein was obtained from Dr. M. Buchmeier (The Scripps Research Institute, La Jolla, CA) (47). Absolute concentration of stock mAb 11.3 was determined by total IgG
ELISA, titrating against a 0.5 mg/ml IgG2a standard Ab (Southern Biotechnology Associates). Standard curve r2 regularly exceeded 0.98, and the sensitivity was
3 ng/ml in all assays.
LCMV viral load quantitative real-time PCR (QPCR)
A detailed version of this assay will be published elsewhere (M. M. McCausland and S. Crotty, unpublished data) (14). Briefly, RNA was isolated from 50 µl of serum using RNAqueous (Ambion). All serum samples were frozen at 80°C until time for RNA extraction. RNA was eluted in a volume of 20 µl and purified RNA was frozen at 80°C until use. A total of 10 µl of RNA was used in a 20 µl cDNA reaction with SuperScript III Reverse Transcriptase (Invitrogen Life Technologies) and a gene specific primer (GP-R, GCAACTGCTGTGTTCCCGAAAC). A total of 5 µl of cDNA was then used as a template for 25 µl of QPCR reaction on a GeneAmp 5700 (ABI), using primers GP-R and GP-F (CATTCACCTGGACTTTGTCAGACTC). A standard curve was generated using the pSG5-GP plasmid (48), a gift from Dr. J. C. de la Torre (The Scripps Research Institute, San Diego, CA). All QPCR samples were run in duplicate. Standard curves were log-linear over >105 range with high r2 values (
98%).
Immunofluorescence
The 7-µm OCT-embedded frozen spleen sections were fixed in acetone and stained for germinal centers with monoclonal anti-B220 IgG labeled with Alexa647(Caltag Laboratories) and PNA-FITC (Vector Laboratories), or rabbit anti-Bcl6 (Santa Cruz Biotechnology) and PE-labeled anti-rabbit secondary Ab (Jackson ImmunoResearch Laboratories). Sections were visualized using a Marianas fluorescence microscope with deconvolution software.
Retrovirus molecular biology, production, and transductions
SAP cDNA was cloned from B6 thymus RNA and sequenced. SAP R78A mutation was introduced using the QuickChange II mutagenesis kit (Stratagene), and the mutation was confirmed by DNA sequencing. Genes were cloned into the retroviral expression vector pMIGR-GFP, upstream of the internal ribosome entry site-driven GFP. Retrovirus production was done by transfection of PLAT-E cells with GeneJammer (Stratagene) plus the retroviral construct of interest (pMIG-GFP, pMIG-SAP, pMIG-SAP R78A) and collection and filtration of culture supernatant at 48 h posttransfection. Before transduction, SMtg+ CD4 T cells were activated for 48 h (2.25 x 106 SMtg+ CD4 T cells with 3.75 x 106 mitomycin C treated splenocytes as APCs plus 1 µg/ml peptide and 10 ng/ml IL-2 in a 24-well dish well). Transduction was done by centrifugation of viral medium plus 2 x 106 activated SMtg+ cells plus 8 µg/ml polybrene and 10 ng/ml IL-2 at 1200 rpm for 90 min at room temperature. Medium was then replaced with DMEM with 10% FCS (D-10) plus 10 ng/ml IL-2, and cells were incubated for two additional days. Cells were then washed and replated at 5 x 106 cells/ml in plain D-10 in a 96-well dish. After 72-h rest, cells were collected and live CD4+GFP+7AAD cells were obtained by cell sorting using a FACSDiva (BD Biosciences).
Adoptive transfers
For adoptive transfers into CD4/ mice (see Figs. 5 and 6), purified Ly5.1+SMtg+ CD4 T cells were i.v. injected via the retro-orbital sinus. A total of 4 x 103, 2 x 104, and 5 x 104 SMtg+ cells was used in preliminary experiments, with similar outcomes (data not shown); 2 x 104 SMtg+ cell transfers were used in all experiments shown. Mice were given LCMVarm i.p. immediately thereafter.

View larger version (25K):
[in this window]
[in a new window]
|
FIGURE 5. Anti-viral Ab response in the absence of SLAM. Anti-LCMV plasma cells and serum IgG in SLAM+/ and SLAM/ mice after LCMV infection. a, ELISPOT detected anti-LCMV IgG plasma cells at day 8 postinfection in spleen and (b) day 30 postinfection in spleen and (c) bone marrow. No significant difference was observed (p > 0.05; n = 4/group). d, Anti-LCMV IgG levels were quantified in the serum at day 8, 15, and 30 postinfection. SLAM+/, ; SLAM/, ; n = 46/group. e, Total IgG plasma cells in spleen and (f) bone marrow were quantified at day 30 postinfection as described above. Data are representative of 23 independent experiments.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIGURE 6. Rescue of germinal center development in CD4/ mice. a, Germinal center T cell help experimental design. SMARTA TCR transgenic (SMtg+) CD4 T cells specific for the immunodominant LCMV gp6180 I-Ab MHCII epitope were isolated. Small numbers of SMtg+ CD4 T cells (5,00020,000) were adoptively transferred into CD4/ mice, which were then infected with LCMV. SMtg+ CD4 T cell expansion and germinal center B cell differentiation was subsequently analyzed. b, Germinal centers postimmunization. CD4/ recipients receiving no cells () made no germinal centers. CD4/ recipients receiving SMtg+ CD4 T cells (SMtg+) generated germinal center B cells with comparable efficiency to immunized WT B6 mice. Additional control groups included uninfected CD4/ mice and uninfected CD4/ mice that received SMtg+ cells; no germinal centers or SMtg+ cell expansion was observed in those negative controls (data not shown). Results are representative of five independent experiments. c, Flow cytometric analysis of germinal center B cells. B220+IgD-gated B cells are shown. Box demarcates the germinal center B cells (PNA+Fashigh). **, p < 0.01.
|
|
For adoptive transfers into CD4-depleted mice (see Fig. 7), 5 x 104 purified Ly5.1+SMtg+ CD4 T cells were i.v. injected via the retro-orbital sinus. Wild-type (WT) B6 mice were first depleted of endogenous CD4 T cells by a single i.v. injection of 150 µg of mAb GK1.5 7 days before the SMtg+ CD4 T cell adoptive transfer (day 7). In a series of preliminary experiments, we established that a single i.v. 150-µg dose of GK1.5 fully depleted the endogenous CD4 T cells, and the GK1.5 was cleared by day 0 such that the adoptively transferred CD4 T cells survived normally (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIGURE 7. SAP CD4 T cells are defective for follicular help function. Examination of germinal center help capabilities of WT vs SAP SMtg+ CD4 T cells. a, Germinal center T cell help experimental design. Twenty thousand WT or SAP SMtg+ CD4 T cells were adoptively transferred into immunized CD4/ hosts, as per Fig. 5. b, Efficient WT and SAPSMtg+ CD4 T cell expansion, day 8 after LCMV infection of CD4/ hosts, determined by FACS quantitation of CD4+ TCR transgenic T cells. c, Germinal centers. WT, CD4/ mice receiving WT SMtg+ CD4 T cells; SAP, CD4/ mice receiving SAP SMtg+ CD4 T cells; , control LCMV-infected CD4/ mice receiving no donor SMtg+ cells. Results are representative of five independent experiments. *, p < 0.05.
|
|
Protein biochemistry
CD4 T cells were magnetically purified from spleen and lymph node preparation of SAP SMTg+ mice. Purified CD4s were then stimulated with 200 ng/well anti-CD3 and anti-CD28 (eBioscience) in plates precoated with 30 µg/ml anti-hamster IgG (H+L) (Vector Laboratories) and retrovirally transduced at 24 and 36 h poststimulation with either vector alone (SAP), WT SAP (SAP+), or mutant SAP (SAP-R78A+). Cells were stimulated for 4 days total and rested in 20 ng/ml IL-2 (R&D Systems) for 3 days. After 3 days in IL-2, cells were restimulated for 15 min with plate-bound anti-CD3 and anti-CD28. A total of 10 x 106 cells was harvested and lysed in 500 µl of 1x TNE buffer (50 mM Tris (pH 8.0), 1% Nonidet P-40, and 2 mM EDTA) supplemented with protease and phosphatase inhibitors. Lysates were incubated with 2 µl of anti-SAP (a gift from P. Schwartzberg, National Institutes of Health, Bethesda, MD) overnight at 4°C followed by immunoprecipitation with protein G agarose (Promega) for 2 h at 4°C. Lysates were resolved in a 412% gradient SDS-PAGE gel and immunoblotted with anti-Fyn (FYN3) and anti-SAP (FL-128) Abs (Santa Cruz Biotechnology). Secondary Abs used were anti-rabbit IgG, L chain-specific HRP (Jackson ImmunoResearch Laboratories), and anti-rabbit IgG (H+L) HRP (Promega).
Statistical analysis
Tests were performed using Prism 4.0 (GraphPad). Statistics were done using two-tailed, unpaired Students t test with 95% confidence bounds unless otherwise indicated. Data involving multiple time points or groups were analyzed by two-way ANOVA. Error bars are ±1 SEM unless otherwise indicated. Arithmetic means were used for all analyses.
 |
Results
|
|---|
SLAM is constitutively expressed on the surface of resting CD4 T cells, CD8 T cells, and B cells (Fig. 1). No SLAM protein is detectable on these cell populations in SLAM/ mice (Fig. 1, a and b, and data not shown). SLAM is substantially up-regulated on the surface of WT CD4 T cells after TCR-mediated activation in vitro (17, 32). SLAM is also up-regulated after CD4 T cell activation in vivo (Fig. 1). Effector CD4 T cells responding to an LCMV infection express 5-fold higher levels of SLAM than naive CD4 T cells (Fig. 1c). Increased SLAM expression is not only present on activated CD4 T cells, but is also maintained at elevated levels on memory CD4 T cells (Fig. 1c). SLAM up-regulation on effector CD4 T cells in vivo was also shown by adoptive transfer of SMARTA TCR transgenic CD4 T cells, specific for the immunodominant gp6180 I-Ab MHCII epitope. At day 8 after LCMV infection, SMARTA CD4 T cells had strongly up-regulated SLAM expression (Fig. 1d). SLAM is also up-regulated on effector and memory CD8 T cells (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
FIGURE 1. SLAM expression modulation. a, SLAM is constitutively expressed on the surface of splenic CD4 T cells and B cells. SLAM+/, thick black line; SLAM/, thin black line; isotype control, filled line. b, SLAM is constitutively expressed on murine peripheral blood leukocytes (SLAM+, black line). No SLAM expression is detectable in SLAM/ mice (filled line). c, SLAM is up-regulated on activated effector CD4 T cells in vivo (CD62LlowCD44high, thick line), day 8 postinfection with LCMV, stained directly ex vivo. Naive CD4 T cells (CD44low), thin line. SLAM is also up-regulated on memory CD4 T cells (CD44high), thick line, day 36 postinfection, stained directly ex vivo. d, SLAM is up-regulated on Ag-specific effector CD4 T cells in vivo. Adoptively transferred congenic SMARTA TCR transgenic (SMtg+) LCMV-specific CD4 T cells (thick line) were analyzed at day 8 after LCMV infection. Naive CD4 T cells, thin line. e, SLAM is up-regulated on germinal center B cells (GC B cells) in vivo. Germinal center B cells (B220+IgDPNA+Fashigh) were stained for surface expression of SLAM, day 30 after LCMV infection (thick line). B220+Fas B cells, thin line.
|
|
SLAM is constitutively expressed on murine B cells (Fig. 1a). Much like CD4 T cells, B cells increase SLAM expression after activation, with uniformly higher levels of SLAM receptor present on the surface of germinal center B cells (Fig. 1e).
Role of SLAM in T cell expansion
Given the roles of SLAM in SAP function, and the prominent expression of SLAM on B and T lymphocytes, we probed the roles of SLAM in vivo by examining SLAM-deficient mice. Excessive T cell proliferation is observed in SAP mice during acute infection with LCMVarm (10, 11, 12, 14) or infection with murine
-herpesvirus 68 (13). Excessive T cell proliferation is a phenotype observed in human XLP (4). Excessive SAP CD8 T cell proliferation causes severe XLP-like disease immunopathology in a mouse chronic viral infection model (14). We therefore examined T cell proliferation in SLAM/ mice during an acute LCMV infection. Unlike SAP mice, excessive CD4 T cell expansion was not observed in SLAM/ mice (Fig. 2). A trend of lower effector CD4 T cell responses was observed in SLAM-deficient mice, both to the immunodominant LCMV MHCII gp61 epitope (Fig. 2a), and the subdominant np309 epitope (Fig. 2d), although these differences did not reach statistical significance. The SLAM
SAP signaling pathway has been shown to be important for suppression of IFN-
production in vitro (15). Increased IFN-
production by SLAM/ virus-specific effector CD4 T cells was not observed (Fig. 2b and data not shown), nor were there any significant alterations in the number of SLAM/ IL-2-producing LCMV-specific CD4 T cells (Fig. 2c; p >> 0.05). Numbers of effector CD8 T cells to the immunodominant LCMV MHCI gp33 epitope were normal in SLAM/ mice both by MHCI tetramer staining (Fig. 3a; p >> 0.05) and IFN-
production (Fig. 3b). Normal numbers of effector CD8 T cells to the subdominant gp276 epitope were also observed (Fig. 3c). Control and clearance of LCMV is primarily mediated by CD8 T cells, and viral clearance was normal in SLAM/ mice (Fig. 3d).
Role of SLAM in germinal center development and the anti-viral Ab response
One of the major immunological defects observed in SAP mice is the inability to make germinal centers and thereby generate memory B cells and long-lived plasma cells (4, 12, 18, 49), resulting in hypogammaglobulinemia (14, 50, 51). We therefore examined whether this requirement for SAP for the development of long-term humoral immunity occurs via SLAM receptor signaling. SLAM/ mice were infected with LCMV, and germinal center B cells were quantified at 1, 2, and 4 wk postinfection (Fig. 4, ae). Germinal centers were normal in the absence of SLAM (Fig. 4, ae). In contrast, in SAP-deficient mice there were virtually no germinal center B cells (Fig. 4f). Therefore, SAP control of germinal center formation is not dependent on SLAM receptor signaling.

View larger version (41K):
[in this window]
[in a new window]
|
FIGURE 4. Germinal center development in the absence of SLAM. Germinal centers in SLAM+ and SLAM mice after LCMV infection. Germinal center B cells (PNA+FashighIgDB220+) were quantified by flow cytometry at day 8 (a), day 15 (b), and day 30 (c) postinfection (n = 4/group). d, Flow cytometric analysis of germinal center B cells, day 15 postinfection. B220+IgD-gated B cells are shown. Box demarcates the germinal center B cells (PNA+Fashigh). Data for each time point are representative of two independent experiments. e, Immunofluorescence histology of spleen germinal centers. PNA, green; B220, red. f, Flow cytometric analysis of germinal center B cells in SAP mice and WT C57BL/6 after LCMV infection, gated as above.
|
|
We also examined the impact of SLAM-deficiency on the anti-viral Ab response, because both SAP and the SLAM family receptors locus have striking impacts on Ab responses (4, 12, 37, 52). Normal numbers of anti-viral IgG plasma cells were present in spleen at day 8 postinfection, the peak of the acute response to LCMV (Fig. 5a). At 1 mo postinfection, long-lived plasma cell numbers were normal in bone marrow and spleen (Fig. 5, b, c, e, and f). Examination of the kinetics and levels of anti-LCMV serum IgG levels in SLAM/ and SLAM+/ mice postinfection revealed no significant changes in the acute (day 8, 15) or long-term (day 30) anti-viral Ab response (Fig. 5d; p > 0.05), corroborating the SLAM/ plasma cell data obtained above.
Roles of Fyn-SAP interaction in CD4 T cell functions
SAP recruits Fyn kinase to SLAM family receptors via an unconventional SH3 domain binding surface (15, 42, 43). That recruitment of Fyn is critical for SAP regulation of Th2 differentiation (16, 17), T cell IFN-
production (15, 17), and NKT cell development (19, 20, 21). Therefore, it appears that SAPs major signaling contributions may occur primarily via recruitment of Fyn kinase to different SLAM family receptors. Our main interest is SAP-dependent regulation of humoral immunity and germinal center development. Does Fyn regulate SAP-dependent CD4 T cell help to B cells and germinal center development via recruitment by SAP to SLAM family receptors?
To address this issue, we attempted to rescue germinal center T help functions of SAP CD4 T cells, in both Fyn-dependent and -independent manners. Germinal center development is a complex process in vivo that is heavily dependent on CD4 T cells. CD4/ mice fail to make germinal centers or virus-specific plasma cells after infection with LCMV (Fig. 6, b and c, and data not shown). Adoptive transfer of SMARTA TCR transgenic (SMtg+) CD4 T cells specific for the immunodominant LCMV gp6180 I-Ab MHCII epitope rescued germinal center B cell differentiation in CD4/ mice, stimulating the development of over one million germinal center B cells in spleen after an acute LCMV infection (Fig. 6, ac). This rescue was accomplished efficiently with adoptive transfer of as few as 4,000 naive SMtg+ CD4 T cells and, under optimal conditions, the number of germinal center B cells reached levels comparable to that present in intact WT mice immunized with LCMV (Fig. 6b), demonstrating that this experimental system efficiently recapitulates normal physiological development of Ag-specific T and B cell interactions and differentiation.
Adoptively transferred WT SMtg+ CD4 T cells drive excellent germinal center development after LCMV infection (Fig. 6), but adoptively transferred SAP SMtg+ CD4 T cells are completely incapable of providing germinal center help (Fig. 7). Both SAP and WT transgenic CD4 T cells undergo efficient primary expansion after immunization (Fig. 7b). Therefore, the SAP help defect is not due to a proliferation defect but is due to a specific and absolute block in follicular helper CD4 T cell functions (Fig. 7c).
SAP protein requires arginine residue 78 on the backside of the SAP SH2 domain to interact with the SH3 domain of Fyn kinase (42, 43). Mutating that arginine (R78A) ablates SAP binding to Fyn, and thereby minimizes recruitment of Fyn to SLAM (16, 17, 42, 43) and other SLAM family receptors (53). It then follows that if recruitment of Fyn kinase is required for development of SAP-dependent CD4 T cell B cell help functions, CD4 T cells possessing the R78A SAP mutant will be defective for driving germinal center B cell development in vivo. Therefore, we reintroduced WT SAP or R78A mutant SAP into SAP SMtg+ CD4 T cells by retroviral transduction (SAP-RV and SAP R78A-RV) (Fig. 8), and tested the role of SAP-Fyn signaling in follicular help CD4 T cell functions (Fig. 9). Transduction was confirmed by coexpression of a GFP reporter from the bicistronic message (Fig. 9a). Expression of SAP and R78A mutant SAP was confirmed by immunoblot (Fig. 8b) and QPCR (data not shown). Protein function was confirmed in CD4 T cells by demonstrating via immunoprecipitation that binding of Fyn to SAP R78A was severely abrogated in comparison to Fyn binding to WT SAP after SMtg+ CD4 T cell activation (Fig. 8b).

View larger version (24K):
[in this window]
[in a new window]
|
FIGURE 8. Retroviral constructs. a, Chromatogram of WT and mutant SAP retroviral construct DNA sequences, highlighting the R78A mutation. Arginine at residue 78 (codon indicated by black line above) was changed to an alanine in the mutant form (indicated by black line below). b, Immunoprecipitation showing expression of SAP and SAP R78A protein in transduced SAPSMtg+ CD4 T cells, bottom (SAP, SAP SMtg+ CD4 T cells plus GFPonly-RV; SAP+, SAP SMtg+ CD4 T cells plus SAP-RV; SAP R78A+, SAP SMtg+ CD4 T cells plus SAP R78A-RV.). Immunoblotting for Fyn demonstrated SAP-Fyn interaction in SAP-RV+ SAP SMtg+ CD4 T cells after T cell activation and immunoprecipitation of SAP. Fyn binding was ablated in SAP R78A-expressing cells. GFP-RV-transduced SAP SMtg+ CD4 T cells were used as a control.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIGURE 9. Distinct Fyn-independent SAP signaling pathway for B cell help. Germinal center T cell help, functional rescue. a, Experimental design. WT or SAPSMtg+ CD4 T cells were transduced with retroviral vectors expressing only GFP (GFPonly-RV), GFP and full-length SAP protein (SAP-RV), or GFP and a mutant of SAP (R78A) unable to bind Fyn (SAP R78A-RV). GFP+-transduced cells were sorted, and resting GFP+SMtg+ CD4 T cells were adoptively transferred into CD4-depleted WT B6 recipient mice. Mice were injected with LCMV, and the germinal centers and SMtg+ CD4 T cell expansion were analyzed 8 days postinfection. Experimental groups were SAP SMtg+ plus GFPonly-RV (SAP), SAPSMtg+ plus SAP-RV (SAP+), SAPSMtg+ plus SAP R78A-RV (SAP R78A), and WT SMtg+ plus GFPonly-RV (WT). b, Germinal center B cell numbers. SAP-RV and SAP R78A-RV-transduced SAPSMtg+ CD4 T cells both rescued germinal center development. c, Normalization of germinal center help activity. Ratio calculated of germinal center B cell numbers to SMtg+ CD4 T cells in each individual mouse, providing a quantitation of per cell T cell help activity. d, Flow cytometric analysis of germinal center B cells. B220+IgD-gated B cells are shown. Oval demarcates the germinal center B cells (PNA+Fashigh). e, Flow cytometric analysis of SMtg+ CD4 T cells. CD4-gated cells are shown. Box demarcates GFP+SMtg+ CD4 T cells. TCR transgenic cells expressed the congenic marker Ly5.1 and were GFP+ from the retroviral expression vector (RV+). Results are representative of four independent experiments. **, p < 0.01. e, Immunofluorescence histology of spleen germinal centers. Bcl6, green; B220, red.
|
|
In a variation on our earlier experimental strategy (Figs. 67), we adoptively transferred RV-transduced SMtg+ CD4 T cells into CD4-depleted mice, where we could track the ability of the transferred CD4 T cells to provide help to B cells and facilitate germinal center formation after immunization, in the absence of any contributions by endogenous CD4 T cells (Fig. 9, bf). SAP-RV-transduced SAP SMtg+ CD4 T cells were highly efficient at driving germinal center B cell development in vivo (Fig. 9, bd, and f), whereas SAP SMtg+ CD4 T cells transduced with an empty construct (expressing only the GFP reporter, "GFPonly-RV") failed to drive germinal center B cell development (Fig. 9, bd, and f), confirming that SAP is absolutely required in CD4 T cells for germinal center development. Transduced CD4 T cells survived and underwent efficient expansion after LCMV immunization (Fig. 9e). To control for any possible bias introduced by variability in CD4 T cell "take" and expansion between individual animals, the ratio of germinal center B cells generated per SMtg+ CD4 T cell was calculated as an independent metric of CD4 T cell-B cell help functional activity (Fig. 9c). Reconstitution of SAP protein expression resulted in highly efficient follicular helper CD4 T cell functions in transduced SAP SMtg+ CD4 T cells, because these SAP-expressing CD4 T cells were just as potent as WT SMtg+ CD4 T cells at driving germinal center B cell differentiation (Fig. 9, b and c). Importantly, SAP CD4 T cells reconstituted with R78A mutant SAP became efficient germinal center helper CD4 T cells, and SAP R78A cells stimulated high levels of germinal center B cell development, comparable to reconstitution with WT SAP (Fig. 9, bd, and f). Therefore, SAP regulates CD4 T cell helper functions in a Fyn-independent manner, demonstrating that there are distinct CD4 T cell signaling pathways that either regulate Th2 development in a SAP
Fyn-dependent manner or regulate germinal center helper functions in a SAP-dependent but Fyn-independent manner.
 |
Discussion
|
|---|
SAP interacts with at least five different surface receptors of the SLAM family, making it complex to determine the mechanisms for SAP regulation of the many phenotypes observed in SAP mice and XLP humans. SLAM is the prototypic member of the SLAM receptor family. It is expressed on resting and activated CD4 T cells, CD8 T cells, and B cells (Fig. 1 and Refs. 17 , 32 , 54). Because SLAM is a self-ligand, its presence at elevated levels on activated lymphocytes presumably enhances Ag-specific T-B interactions during an immune response, and provides costimulatory signals to both the B cell and CD4 T cell (28, 55). It has been proposed that SLAM may be the critical SLAM family receptor controlling humoral immunity (55). Nevertheless, we observed normal germinal center development in SLAM/ mice, indicating that SLAM-SLAM interactions and SLAM receptor signaling are not essential for T-B interactions and humoral immune responses. Modestly lower CD4 T cell responses were observed in SLAM/ mice, indicating that SLAM may have T cell costimulatory function in vivo, consistent with reports of SLAM costimulatory activity on T cells in vitro using agonist anti-SLAM Abs (16, 32, 33), although no proliferative defect was observed in vitro in an earlier study with SLAM/ mice (54). One of two previous studies reported moderately increased IFN-
production by SLAM-deficient T cells after in vitro stimulation (17, 54). We did not observe a change in T cell IFN-
production after LCMV infection (Figs. 23).
Of separate interest, the lethal immunopathology after EBV infection of XLP patients is thought to involve CD8 T cells (4, 7), and we have recently shown that SAP CD8 T cells cause severe immunopathology and illness during a chronic LCMVcl13 infection in mice (14). Excessive CD8 T cell expansion is observed after either acute (Armstrong strain) or chronic (clone 13 strain) LCMV infection of SAP-deficient mice (10, 11, 12, 14). That aberrant and pathological T cell expansion does not appear to occur via SLAM receptor signaling, because SLAM/ mice exhibited normal development of effector CD8 T cells to an acute LCMV infection (Fig. 3).
As discussed above, SLAM expression on CD4 T cells increases after activation, and it has recently been reported that SLAM expression can modulate CD40L expression (18). We observed no alterations in SLAM/ CD4 T cell help to B cells in vivo, demonstrating that SLAM is not required for SAP-dependent CD4 T cell help to B cells for germinal center formation and T-dependent Ab responses to a viral infection (Figs. 45). There are seven SLAM family receptors, and so it is possible that the functions of SLAM are compensated by another SLAM family receptor in SLAM/ mice. This seems somewhat unlikely for SAP-dependent signaling, because SLAM possesses unique SAP signaling modalities, in which SAP can bind to SLAM ITSMs in both a tyrosine phosphorylation-dependent and -independent manner (41). SAP SH2 domain binding to the other four known SAP-binding SLAM family receptors appears to be more conventional (tyrosine phosphorylation dependent). Therefore, our results indicate that SAP-dependent control of germinal center development is signaled by one of the other SLAM family receptors expressed on CD4 T cells. Recent work by Wakeland and colleagues (37) has shown that a major lupus susceptibility locus maps to the SLAM family receptor cluster. The Sle1b locus causes increased autoantibody production, suggesting that allelic variation in a SLAM family receptor can lead to heightened B cell help functions by CD4 T cells, leading to autoimmunity. That study reported allelic variations in the sequence or expression of CD229/Ly9, CD84, CD244, and Ly108/NTB-A (37). Ly108 appears to be responsible for B cell intrinsic defects resulting in susceptibility to autoantibody production (38). CD229, CD84, and Ly108/NTB-A are expressed on CD4 T cells and interact with SAP (4). Intriguingly, a recent study on human tonsillar CD4 T cells reported increased expression of CD84, CD229, and SAP on CXCR5+ follicular helper CD4 T cells (56). CD229 (Ly9) is not required for germinal center development in mice (57), and CD229/ mice exhibit normal Ab responses and long-lived plasma cell development after a viral infection (57). In aggregate, these data suggest that signaling through SLAM family receptors CD84 or NTB-A/Ly108 may be required for differentiation of follicular helper CD4 T cells and SAP-dependent germinal center formation.
SAP-Fyn and follicular helper differentiation
SAP recruits Fyn kinase to SLAM family receptors. That recruitment provides an obvious mechanism for mediating downstream signaling events (15, 16, 55). Recruitment of Fyn is critical for SAP regulation of Th2 differentiation, as well as SAP control of IFN-
production. However, our earlier data indicated that the germinal center defect is independent of Th2 differentiation, because normal numbers of IL-4+ CD4 T cells were detected in SAP mice after LCMV infection (12). Normal germinal center development in IL-4/, IL-4R/, and STAT6/ mice after immunization also suggested that Th2 differentiation is dispensable for germinal center development (Ref. 58 and M. M. McCausland and S. Crotty, unpublished data). These and other results have led to the proposal that a distinct CD4 T cell differentiation lineage, termed follicular helper cells, is responsible for germinal center B cell help in vivo, independent of Th2 (59, 60, 61, 62, 63). Follicular helper CD4 T cell differentiation is poorly understood, particularly in mice, but appears to involve SAP, Roquin, and ICOS (12, 23, 56, 64, 65, 66, 67, 68). Of note, the CD4 T cell help block in SAP mice is specifically observed at the germinal center stage after LCMV infection, because the early T-dependent anti-viral IgG response is present in the absence of SAP (12), showing that SAPs primary role is to control germinal center CD4 T cell help and SAP can be dispensable for earlier CD4 T cell help to B cells (12).
We tested whether Fyn mediates SAP-dependent CD4 T cell help to B cells and germinal center development. We showed that germinal center T help functions of SAP CD4 T cells could be rescued in vivo by reconstituting SAP protein expression via retroviral transduction, proving that SAP expression in CD4 T cells is required for germinal center T cell help (Figs. 7 and 9). Importantly, we also showed that a SAP mutant capable of binding to SLAM family receptors but defective for Fyn kinase binding is fully able to rescue germinal center CD4 T cell help functions. Therefore, there exist at least two distinct SAP signaling pathways in CD4 T cells: a Fyn-dependent Th2 differentiation pathway, and a Fyn-independent follicular helper differentiation pathway. The phenotypes of Fyn/ and FynT/ mice (69, 70, 71) are difficult to interpret, because both strains are present on mixed backgrounds (The Jackson Laboratory; strain no. 002385, http://jaxmice.jax. org/strain/002385.html and M. M. McCausland and S. Crotty, unpublished data). Nevertheless, Fyn/ and FynT/ mice are able to make germinal centers after immunization (Ref. 18 and M. M. McCausland and S. Crotty, unpublished data) in contrast to SAP mice, corroborating that SAP-dependent CD4 T cell help to B cells, and follicular helper CD4 T cell differentiation in particular, is independent of Fyn signaling.
In summary, SAP signaling regulates a variety of lymphocyte functions via at least five different surface receptors of the SLAM family. We have shown that two of the prominent phenotypes of SAP mice are not dependent on SLAM signaling: excessive T cell proliferation and failure to make germinal centers. These results further elucidate the complexities of SLAM receptor family roles in the array of biological phenotypes impacted by SAP. Our findings also clarify that SAP is essential in CD4 T cells for germinal center development and that a distinct SAP signaling pathway regulates follicular helper CD4 T cell differentiation, independent of the SAP signaling pathway regulating Th1/Th2. These experiments support the existence of follicular helper cells as a distinct CD4 T cell differentiation lineage.
 |
Acknowledgments
|
|---|
We thank Drs. Pamela Schwartzberg, Rafi Ahmed, Charlie Surh, Hans Hengartner, Rolf Zinkernagel, Stephen Schoenberger, Hilde Cheroutre, Juan Carlos de la Torre, and Michael Buchmeier for gifts of mice and reagents. We thank Drs. Michael Croft and Jianxun Song for experimental advice. We thank Samuel Connell for excellent cell sorting assistance, Olga Turovskaya for histology assistance, and Chuck Prickett and Fernando Vasquez for excellent assistance with animal care.
 |
Disclosures
|
|---|
The authors have no financial conflict of interest.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported in part by a Cancer Research Institute Investigator Award (to S.C.) and a Pew Scholar Award (to S.C.). 
2 Address correspondence and reprint requests to Dr. Shane Crotty, Division of Vaccine Discovery, La Jolla Institute for Allergy and Immunology, 9420 Athena Circle, La Jolla, CA 92121. E-mail address: shane{at}liai.org 
3 Abbreviations used in this paper: SAP, SLAM-associated protein; XLP, X-linked lymphoproliferative disease; ITSM, immunotyrosine switch motif; MHCII, MHC class II; LCMV, lymphocytic choriomeningitis virus; PNA, peanut lectin agglutinin; QPCR, quantitative real-time PCR; WT, wild type. 
Received for publication October 19, 2005.
Accepted for publication October 27, 2006.
 |
References
|
|---|
- Coffey, A. J., R. A. Brooksbank, O. Brandau, T. Oohashi, G. R. Howell, J. M. Bye, A. P. Cahn, J. Durham, P. Heath, P. Wray, et al 1998. Host response to EBV infection in X-linked lymphoproliferative disease results from mutations in an SH2-domain encoding gene. Nat. Genet. 20: 129-135. [Medline]
- Nichols, K. E., D. P. Harkin, S. Levitz, M. Krainer, K. A. Kolquist, C. Genovese, A. Bernard, M. Ferguson, L. Zuo, E. Snyder, et al 1998. Inactivating mutations in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome. Proc. Natl. Acad. Sci. USA 95: 13765-13770. [Abstract/Free Full Text]
- Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, L. Notarangelo, R. Geha, M. G. Roncarolo, et al 1998. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the co-receptor SLAM. Nature 395: 462-469. [Medline]
- Nichols, K. E., C. S. Ma, J. L. Cannons, P. L. Schwartzberg, S. G. Tangye. 2005. Molecular and cellular pathogenesis of X-linked lymphoproliferative disease. Immunol. Rev. 203: 180-199. [Medline]
- Engel, P., M. J. Eck, C. Terhorst. 2003. The SAP and SLAM families in immune responses and X-linked lymphoproliferative disease. Nat. Rev. Immunol. 3: 813-821. [Medline]
- Latour, S., A. Veillette. 2003. Molecular and immunological basis of X-linked lymphoproliferative disease. Immunol. Rev. 192: 212-224. [Medline]
- Purtilo, D. T., H. L. Grierson, J. R. Davis, M. Okano. 1991. The X-linked lymphoproliferative disease: from autopsy toward cloning the gene 19751990. Pediatr. Pathol. 11: 685-710. [Medline]
- Feldhahn, N., I. Schwering, S. Lee, M. Wartenberg, F. Klein, H. Wang, G. Zhou, S. M. Wang, J. D. Rowley, J. Hescheler, et al 2002. Silencing of B cell receptor signals in human naive B cells. J. Exp. Med. 196: 1291-1305. [Abstract/Free Full Text]
- Shlapatska, L. M., S. V. Mikhalap, A. G. Berdova, O. M. Zelensky, T. J. Yun, K. E. Nichols, E. A. Clark, S. P. Sidorenko. 2001. CD150 association with either the SH2-containing inositol phosphatase or the SH2-containing protein tyrosine phosphatase is regulated by the adaptor protein SH2D1A. J. Immunol. 166: 5480-5487. [Abstract/Free Full Text]
- Czar, M. J., E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen, A. Sher, C. S. Duckett, R. Ahmed, P. L. Schwartzberg. 2001. Altered lymphocyte responses and cytokine production in mice deficient in the X-linked lymphoproliferative disease gene SH2D1A/DSHP/SAP. Proc. Natl. Acad. Sci. USA 98: 7449-7454. [Abstract/Free Full Text]
- Wu, C., K. B. Nguyen, G. C. Pien, N. Wang, C. Gullo, D. Howie, M. R. Sosa, M. J. Edwards, P. Borrow, A. R. Satoskar, et al 2001. SAP controls T cell responses to virus and terminal differentiation of TH2 cells. Nat. Immunol. 2: 410-414. [Medline]
- Crotty, S., E. N. Kersh, J. Cannons, P. L. Schwartzberg, R. Ahmed. 2003. SAP is required for generating long-term humoral immunity. Nature 421: 282-287. [Medline]
- Chen, G., A. K. Tai, M. Lin, F. Chang, C. Terhorst, B. T. Huber. 2005. Signaling lymphocyte activation molecule-associated protein is a negative regulator of the CD8 T cell response in mice. J. Immunol. 175: 2212-2218. [Abstract/Free Full Text]
- Crotty, S., M. M. McCausland, R. D. Aubert, E. J. Wherry, R. Ahmed. 2006. Hypogammaglobulinemia and exacerbated CD8 T cell mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease. Blood 108: 3085-3093. [Abstract/Free Full Text]
- Latour, S., G. Gish, C. D. Helgason, R. K. Humphries, T. Pawson, A. Veillette. 2001. Regulation of SLAM-mediated signal transduction by SAP, the X-linked lymphoproliferative gene product. Nat. Immunol. 2: 681-690. [Medline]
- Cannons, J. L., L. J. Yu, B. Hill, L. A. Mijares, D. Dombroski, K. E. Nichols, A. Antonellis, G. A. Koretzky, K. Gardner, P. L. Schwartzberg. 2004. SAP regulates TH2 differentiation and PKC-
-mediated activation of NF-
B1. Immunity 21: 693-706. [Medline] - Davidson, D., X. Shi, S. Zhang, H. Wang, M. Nemer, N. Ono, S. Ohno, Y. Yanagi, A. Veillette. 2004. Genetic evidence linking SAP, the X-linked lymphoproliferative gene product, to Src-related kinase FynT in TH2 cytokine regulation. Immunity 21: 707-717. [Medline]
- Cannons, J. L., L. J. Yu, D. Jankovic, S. Crotty, R. Horai, M. Kirby, S. Anderson, A. W. Cheever, A. Sher, P. L. Schwartzberg. 2006. SAP regulates T cell-mediated help for humoral immunity by a mechanism distinct from cytokine regulation. J. Exp. Med. 203: 1551-1565. [Abstract/Free Full Text]
- Nichols, K. E., J. Hom, S. Y. Gong, A. Ganguly, C. S. Ma, J. L. Cannons, S. G. Tangye, P. L. Schwartzberg, G. A. Koretzky, P. L. Stein. 2005. Regulation of NKT cell development by SAP, the protein defective in XLP. Nat. Med. 11: 340-345. [Medline]
- Chung, B., A. Aoukaty, J. Dutz, C. Terhorst, R. Tan. 2005. Signaling lymphocytic activation molecule-associated protein controls NKT cell functions. J. Immunol. 174: 3153-3157. [Abstract/Free Full Text]
- Pasquier, B., L. Yin, M. C. Fondaneche, F. Relouzat, C. Bloch-Queyrat, N. Lambert, A. Fischer, G. de Saint-Basile, S. Latour. 2005. Defective NKT cell development in mice and humans lacking the adapter SAP, the X-linked lymphoproliferative syndrome gene product. J. Exp. Med. 201: 695-701. [Abstract/Free Full Text]
- Malbran, A., L. Belmonte, B. Ruibal-Ares, P. Bare, I. Massud, C. Parodi, M. Felippo, R. Hodinka, K. Haines, K. E. Nichols, M. M. de Bracco. 2004. Loss of circulating CD27+ memory B cells and CCR4+ T cells occurring in association with elevated EBV loads in XLP patients surviving primary EBV infection. Blood 103: 1625-1631. [Abstract/Free Full Text]
- Ma, C. S., N. J. Hare, K. E. Nichols, L. Dupre, G. Andolfi, M. G. Roncarolo, S. Adelstein, P. D. Hodgkin, S. G. Tangye. 2005. Impaired humoral immunity in X-linked lymphoproliferative disease is associated with defective IL-10 production by CD4+ T cells. J. Clin. Invest. 115: 1049-1059. [Medline]
- Ma, C. S., S. Pittaluga, D. T. Avery, N. J. Hare, I. Maric, A. D. Klion, K. E. Nichols, S. G. Tangye. 2006. Selective generation of functional somatically mutated IgM+CD27+, but not Ig isotype-switched, memory B cells in X-linked lymphoproliferative disease. J. Clin. Invest. 116: 322-333. [Medline]
- Tangye, S. G., J. H. Phillips, L. L. Lanier, K. E. Nichols. 2000. Functional requirement for SAP in 2B4-mediated activation of human natural killer cells as revealed by the X-linked lymphoproliferative syndrome. J. Immunol. 165: 2932-2936. [Abstract/Free Full Text]
- Bottino, C., M. Falco, S. Parolini, E. Marcenaro, R. Augugliaro, S. Sivori, E. Landi, R. Biassoni, L. D. Notarangelo, L. Moretta, A. Moretta. 2001. NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface molecule contributing to the inability of natural killer cells to kill Epstein-Barr virus-infected B cells in X-linked lymphoproliferative disease. J. Exp. Med. 194: 235-246. [Abstract/Free Full Text]
- Parolini, S., C. Bottino, M. Falco, R. Augugliaro, S. Giliani, R. Franceschini, H. D. Ochs, H. Wolf, J. Y. Bonnefoy, R. Biassoni, et al 2000. X-linked lymphoproliferative disease: 2B4 molecules displaying inhibitory rather than activating function are responsible for the inability of natural killer cells to kill Epstein-Barr virus-infected cells. J. Exp. Med. 192: 337-346. [Abstract/Free Full Text]
- Sidorenko, S. P., E. A. Clark. 2003. The dual-function CD150 receptor subfamily: the viral attraction. Nat. Immunol. 4: 19-24. [Medline]
- Hwang, P. M., C. Li, M. Morra, J. Lillywhite, D. R. Muhandiram, F. Gertler, C. Terhorst, L. E. Kay, T. Pawson, J. D. Forman-Kay, S. C. Li. 2002. A "three-pronged" binding mechanism for the SAP/SH2D1A SH2 domain: structural basis and relevance to the XLP syndrome. EMBO J. 21: 314-323. [Medline]
- Sidorenko, S. P., E. A. Clark. 1993. Characterization of a cell surface glycoprotein IPO-3, expressed on activated human B and T lymphocytes. J. Immunol. 151: 4614-4624. [Abstract]
- Cocks, B. G., C. C. Chang, J. M. Carballido, H. Yssel, J. E. de Vries, G. Aversa. 1995. A novel receptor involved in T-cell activation. Nature 376: 260-263. [Medline]
- Castro, A. G., T. M. Hauser, B. G. Cocks, J. Abrams, S. Zurawski, T. Churakova, F. Zonin, D. Robinson, S. G. Tangye, G. Aversa, et al 1999. Molecular and functional characterization of mouse signaling lymphocytic activation molecule (SLAM): differential expression and responsiveness in Th1 and Th2 cells. J. Immunol. 163: 5860-5870. [Abstract/Free Full Text]
- Howie, D., S. Okamoto, S. Rietdijk, K. Clarke, N. Wang, C. Gullo, J. P. Bruggeman, S. Manning, A. J. Coyle, E. Greenfield, et al 2002. The role of SAP in murine CD150 (SLAM)-mediated T-cell proliferation and interferon
production. Blood 100: 2899-2907. [Abstract/Free Full Text] - Tatsuo, H., N. Ono, K. Tanaka, Y. Yanagi. 2000. SLAM (CDw150) is a cellular receptor for measles virus. Nature 406: 893-897. [Medline]
- Tatsuo, H., N. Ono, Y. Yanagi. 2001. Morbilliviruses use signaling lymphocyte activation molecules (CD150) as cellular receptors. J. Virol. 75: 5842-5850. [Abstract/Free Full Text]
- Yanagi, Y., N. Ono, H. Tatsuo, K. Hashimoto, H. Minagawa. 2002. Measles virus receptor SLAM (CD150). Virology 299: 155-161. [Medline]
- Wandstrat, A. E., C. Nguyen, N. Limaye, A. Y. Chan, S. Subramanian, X. H. Tian, Y. S. Yim, A. Pertsemlidis, H. R. Garner, Jr, L. Morel, E. K. Wakeland. 2004. Association of extensive polymorphisms in the SLAM/CD2 gene cluster with murine lupus. Immunity 21: 769-780. [Medline]
- Kumar, K. R., L. Li, M. Yan, M. Bhaskarabhatla, A. B. Mobley, C. Nguyen, J. M. Mooney, J. D. Schatzle, E. K. Wakeland, C. Mohan. 2006. Regulation of B cell tolerance by the lupus susceptibility gene Ly108. Science 312: 1665-1669. [Abstract/Free Full Text]
- Sayos, J., M. Martin, A. Chen, M. Simarro, D. Howie, M. Morra, P. Engel, C. Terhorst. 2001. Cell surface receptors Ly-9 and CD84 recruit the X-linked lymphoproliferative disease gene product SAP. Blood 97: 3867-3874. [Abstract/Free Full Text]
- Tangye, S. G., S. Lazetic, E. Woollatt, G. R. Sutherland, L. L. Lanier, J. H. Phillips. 1999. Cutting edge: human 2B4, an activating NK cell receptor, recruits the protein tyrosine phosphatase SHP-2 and the adaptor signaling protein SAP. J. Immunol. 162: 6981-6985. [Abstract/Free Full Text]
- Howie, D., M. Simarro, J. Sayos, M. Guirado, J. Sancho, C. Terhorst. 2002. Molecular dissection of the signaling and costimulatory functions of CD150 (SLAM): CD150/SAP binding and CD150-mediated costimulation. Blood 99: 957-965. [Abstract/Free Full Text]
- Latour, S., R. Roncagalli, R. Chen, M. Bakinowski, X. Shi, P. L. Schwartzberg, D. Davidson, A. Veillette. 2003. Binding of SAP SH2 domain to FynT SH3 domain reveals a novel mechanism of receptor signalling in immune regulation. Nat. Cell Biol. 5: 149-154. [Medline]
- Chan, B., A. Lanyi, H. K. Song, J. Griesbach, M. Simarro-Grande, F. Poy, D. Howie, J. Sumegi, C. Terhorst, M. J. Eck. 2003. SAP couples Fyn to SLAM immune receptors. Nat. Cell Biol. 5: 155-160. [Medline]
- Gadue, P., N. Morton, P. L. Stein. 1999. The Src family tyrosine kinase Fyn regulates natural killer T cell development. J. Exp. Med. 190: 1189-1196. [Abstract/Free Full Text]
- Oxenius, A., M. F. Bachmann, R. M. Zinkernagel, H. Hengartner. 1998. Virus-specific MHC-class II-restricted TCR-transgenic mice: effects on humoral and cellular immune responses after viral infection. Eur. J. Immunol. 28: 390-400. [Medline]
- Ahmed, R., A. Salmi, L. D. Butler, J. M. Chiller, M. B. Oldstone. 1984. Selection of genetic variants of lymphocytic choriomeningitis virus in spleens of persistently infected mice: role in suppression of cytotoxic T lymphocyte response and viral persistence. J. Exp. Med. 160: 521-540. [Abstract/Free Full Text]
- Wright, K. E., M. J. Buchmeier. 1991. Antiviral antibodies attenuate T-cell-mediated immunopathology following acute lymphocytic choriomeningitis virus infection. J. Virol. 65: 3001-3006. [Abstract/Free Full Text]
- Lee, K. J., M. Perez, D. D. Pinschewer, J. C. de la Torre. 2002. Identification of the lymphocytic choriomeningitis virus (LCMV) proteins required to rescue LCMV RNA analogs into LCMV-like particles. J. Virol. 76: 6393-6397. [Abstract/Free Full Text]
- Hron, J. D., L. Caplan, A. J. Gerth, P. L. Schwartzberg, S. L. Peng. 2004. SH2D1A regulates T-dependent humoral autoimmunity. J. Exp. Med. 200: 261-266. [Abstract/Free Full Text]
- Yin, L., U. Al-Alem, J. Liang, W. M. Tong, C. Li, M. Badiali, J. J. Medard, J. Sumegi, Z. Q. Wang, G. Romeo. 2003. Mice deficient in the X-linked lymphoproliferative disease gene sap exhibit increased susceptibility to murine gammaherpesvirus-68 and hypo-gammaglobulinemia. J. Med. Virol. 71: 446-455. [Medline]
- Morra, M., R. A. Barrington, A. C. Abadia-Molina, S. Okamoto, A. Julien, C. Gullo, A. Kalsy, M. J. Edwards, G. Chen, R. Spolski, et al 2005. Defective B cell responses in the absence of SH2D1A. Proc. Natl. Acad. Sci. USA 102: 4819-4823. [Abstract/Free Full Text]
- Komori, H., H. Furukawa, S. Mori, M. R. Ito, M. Terada, M. C. Zhang, N. Ishii, N. Sakuma, M. Nose, M. Ono. 2006. A signal adaptor SLAM-associated protein regulates spontaneous autoimmunity and Fas-dependent lymphoproliferation in MRL-Faslpr lupus mice. J. Immunol. 176: 395-400. [Abstract/Free Full Text]
- Chen, R., F. Relouzat, R. Roncagalli, A. Aoukaty, R. Tan, S. Latour, A. Veillette. 2004. Molecular dissection of 2B4 signaling: implications for signal transduction by SLAM-related receptors. Mol. Cell. Biol. 24: 5144-5156. [Abstract/Free Full Text]
- Wang, N., A. Satoskar, W. Faubion, D. Howie, S. Okamoto, S. Feske, C. Gullo, K. Clarke, M. R. Sosa, A. H. Sharpe, C. Terhorst. 2004. The cell surface receptor SLAM controls T cell and macrophage functions. J. Exp. Med. 199: 1255-1264. [Abstract/Free Full Text]
- Veillette, A.. 2006. Immune regulation by SLAM family receptors and SAP-related adaptors. Nat. Rev. Immunol. 6: 56-66. [Medline]
- Chtanova, T., S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, C. R. Mackay. 2004. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J. Immunol. 173: 68-78. [Abstract/Free Full Text]
- Graham, D. B., M. P. Bell, M. M. McCausland, C. J. Huntoon, J. van Deursen, W. A. Faubion, S. Crotty, D. J. McKean. 2006. Ly9 (CD229)-deficient mice exhibit T cell defects yet do not share several phenotypic characteristics associated with SLAM- and SAP-deficient mice. J. Immunol. 176: 291-300. [Abstract/Free Full Text]
- Tsiagbe, V. K., G. J. Thorbecke. 1998. Overview of germinal center function and structure in normal and genetically engineered mice. G. J. Thorbecke, Jr, and V. K. Tsiagbe, Jr, eds. The Biology of Germinal Centers 1-103. Springer-Verlag, New York.
- Schaerli, P., K. Willimann, A. B. Lang, M. Lipp, P. Loetscher, B. Moser. 2000. CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J. Exp. Med. 192: 1553-1562. [Abstract/Free Full Text]
- Breitfeld, D., L. Ohl, E. Kremmer, J. Ellwart, F. Sallusto, M. Lipp, R. Forster. 2000. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J. Exp. Med. 192: 1545-1552. [Abstract/Free Full Text]
- Mackay, C. R.. 2000. Follicular homing T helper (Th) cells and the Th1/Th2 paradigm. J. Exp. Med. 192: F31-F34. [Free Full Text]
- Heissmeyer, V., K. M. Ansel, A. Rao. 2005. A plague of autoantibodies. Nat. Immunol. 6: 642-644. [Medline]
- Bowen, M. B., A. W. Butch, C. A. Parvin, A. Levine, M. H. Nahm. 1991. Germinal center T cells are distinct helper-inducer T cells. Hum. Immunol. 31: 67-75. [Medline]
- Vinuesa, C. G., M. C. Cook, C. Angelucci, V. Athanasopoulos, L. Rui, K. M. Hill, D. Yu, H. Domaschenz, B. Whittle, T. Lambe, et al 2005. A RING-type ubiquitin ligase family member required to repress follicular helper T cells and autoimmunity. Nature 435: 452-458. [Medline]
- McAdam, A. J., R. J. Greenwald, M. A. Levin, T. Chernova, N. Malenkovich, V. Ling, G. J. Freeman, A. H. Sharpe. 2001. ICOS is critical for CD40-mediated antibody class switching. Nature 409: 102-105. [Medline]
- Tafuri, A., A. Shahinian, F. Bladt, S. K. Yoshinaga, M. Jordana, A. Wakeham, L. M. Boucher, D. Bouchard, V. S. Chan, G. Duncan, et al 2001. ICOS is essential for effective T-helper-cell responses. Nature 409: 105-109. [Medline]
- Dong, C., A. E. Juedes, U. A. Temann, S. Shresta, J. P. Allison, N. H. Ruddle, R. A. Flavell. 2001. ICOS co-stimulatory receptor is essential for T-cell activation and function. Nature 409: 97-101. [Medline]
- Lohning, M., A. Hutloff, T. Kallinich, H. W. Mages, K. Bonhagen, A. Radbruch, E. Hamelmann, R. A. Kroczek. 2003. Expression of ICOS in vivo defines CD4+ effector T cells with high inflammatory potential and a strong bias for secretion of interleukin 10. J. Exp. Med. 197: 181-193. [Abstract/Free Full Text]
- Stein, P. L., H. M. Lee, S. Rich, P. Soriano. 1992. pp59fyn mutant mice display differential signaling in thymocytes and peripheral T cells. Cell 70: 741-750. [Medline]
- Appleby, M. W., J. D. Kerner, S. Chien, C. R. Maliszewski, S. Bondada, R. M. Perlmutter, S. Bondadaa. 1995. Involvement of p59fynT in interleukin-5 receptor signaling. J. Exp. Med. 182: 811-820. [Abstract/Free Full Text]
- Appleby, M. W., J. A. Gross, M. P. Cooke, S. D. Levin, X. Qian, R. M. Perlmutter. 1992. Defective T cell receptor signaling in mice lacking the thymic isoform of p59fyn. Cell 70: 751-763. [Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Linterman, R. J. Rigby, Raphael. K. Wong, D. Yu, R. Brink, J. L. Cannons, P. L. Schwartzberg, M. C. Cook, G. D. Walters, and C. G. Vinuesa
Follicular helper T cells are required for systemic autoimmunity
J. Exp. Med.,
March 16, 2009;
206(3):
561 - 576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Cen, A. Ueda, L. Guzman, J. Jain, H. Bassiri, K. E. Nichols, and P. L. Stein
The Adaptor Molecule Signaling Lymphocytic Activation Molecule-Associated Protein (SAP) Regulates IFN-{gamma} and IL-4 Production in V{alpha}14 Transgenic NKT Cells via Effects on GATA-3 and T-bet Expression
J. Immunol.,
February 1, 2009;
182(3):
1370 - 1378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Kamperschroer, D. M. Roberts, Y. Zhang, N.-p. Weng, and S. L. Swain
SAP Enables T Cells to Help B Cells by a Mechanism Distinct from Th Cell Programming or CD40 Ligand Regulation
J. Immunol.,
September 15, 2008;
181(6):
3994 - 4003.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Nunez-Cruz, W. C. J. Yeo, J. Rothman, P. Ojha, H. Bassiri, M. Juntilla, D. Davidson, A. Veillette, G. A. Koretzky, and K. E. Nichols
Differential Requirement for the SAP-Fyn Interaction during NK T Cell Development and Function
J. Immunol.,
August 15, 2008;
181(4):
2311 - 2320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Veillette, S. Zhang, X. Shi, Z. Dong, D. Davidson, and M.-C. Zhong
SAP expression in T cells, not in B cells, is required for humoral immunity
PNAS,
January 29, 2008;
105(4):
1273 - 1278.
[Abstract]
[Full Text]
[PDF]
|
 |
|