|
|
||||||||
Production by Peritoneal Macrophages in Type 2 Diabetic Mice Is Dependent on Elevated Glucose and Requires p38 MAPK1


* Division of Nutritional Sciences and
Department of Pathology, Integrative Immunology and Behavior Program, University of Illinois, Urbana, IL 61801
| Abstract |
|---|
|
|
|---|
production by resident peritoneal macrophages (PerM
) in type 2 diabetic (db/db) mice is dependent on elevated glucose and requires p38 MAPK. Intraperitoneal LPS administered to db/db and nondiabetic (db/+) mice induced 3- and 4-fold more TNF-
in the peritoneum and serum, respectively, of db/db mice as compared with db/+ mice. Examination of the TLR-4/MD2 complex and CD14 expression showed no difference between db/db and db/+ PerM
. Ex vivo stimulation of PerM
with LPS produced a similar 3-fold increase in TNF-
production in db/db PerM
when compared with db/+ PerM
. PerM
isolated from db/+ mice incubated in high glucose (4 g/L) medium for 12 h produced nearly 2-fold more TNF-
in response to LPS than PerM
incubated in normal glucose medium (1 g/L). LPS-dependent stimulation of PI3K activity, ERK1/2 activation, and p38 kinase activity was greater in PerM
from db/db mice as compared with db/+ mice. Only inhibition of p38 kinase blocked LPS-induced TNF-
production in PerM
from db/db mice. Taken together, these data indicate that augmented TNF-
production induced by LPS in macrophages during diabetes is due to hyperglycemia and increased LPS-dependent activation of p38 kinase. | Introduction |
|---|
|
|
|---|
, is involved in the pathogenesis of and complications associated with type 2 diabetes (T2D)3 (1, 2, 3, 4, 5). We have recently shown in a mouse model of T2D that diabetic mice have excessive responsivity to LPS demonstrating heightened up-regulation of IL-1
and failure to appropriately increases the IL-1 counterregulator molecules IL-1R antagonist (IL-1RA) and IL-1R 2. The consequence of this dysregulation of the IL-1
pathway is increased and prolonged sickness behavior in response to LPS (6). In macrophages, LPS causes elaboration of TNF-
and TNF-
is critical to the brain-based immunobehavioral consequences of bacterial-related illness (7). Importantly, TNF-
has been identified as a potential causative factor of T2D because it can bring about insulin resistance by stimulating JNK-dependent serine phosphorylation of insulin receptor substrates (IRSs) (8), subsequently preventing IRS interaction with the activated insulin receptor. Overall, T2D appears to inhibit the ability of the innate immune system to appropriately regulate relevant immunological challenges. This concept is supported by clinical studies that show individuals with T2D have impaired wound healing (9), higher incidence of infection, and higher rates of infection-related morbidity and mortality (10).
Activated macrophages appear to be the foremost source of TNF-
in the body (11). Macrophage release of TNF-
is mediated by several mechanisms. LPS stimulation of the macrophage TLR4 is the most robust trigger (12), but phagocytosis of undigested particles, such as opsonized RBC, can generate TNF-
elaboration (13). Because macrophages contain their own TNFRs, TNF-
can also cause its own synthesis/release through induction of NF-
B (11, 14). Why TNF-
is elevated in T2D is unclear. Some have ascribed it to increased adiposity associated with T2D (15, 16) and the consequence of fat cell-dependent TNF-
production (8, 17). Others implicate adipose tissue-associated macrophages and their production of TNF-
(17). We postulate that stimuli that would normally induce little or no TNF-
production in nondiabetic individuals cause a marked increase in TNF-
elaboration in persons with T2D. In this study, we show that TNF-
production induced by LPS is augmented in resident peritoneal macrophages from T2D mice when compared with control mice and that this increase in TNF-
is dependent on elevated glucose and requires p38 kinase.
| Materials and Methods |
|---|
|
|
|---|
All reagents and chemicals were purchased from Sigma-Aldrich except those noted below which were obtained from the indicated suppliers: FCS (0.05 ng/ml, 0.48 U/ml endotoxin), Atlanta Biologicals. PD908059 (513000), SB202190 (559388), and LY294002 (440204), Calbiochem. PE-conjugated anti-CD14 (12-01410-81), PE-conjugated anti-TLR4/MD2 (12-9041-80), and PE-conjugated IgG2A isotype control (12-4321-71), eBioscience. Anti-phospho ERK1/2 (sc-7383) and anti-p-38 (sc-728), Santa Cruz Biotechnology. Anti-ERK1/2 (06-182), Upstate Biotechnology/Cell Signaling Solution. Anti-phospho p38 (44-684G), BioSource International. Anti-PI3K and anti-p85 (06-195), Upstate Biotechnology. [
-32P]ATP, PerkinElmer Life Sciences. ECL+ Western blotting analysis system, Amersham Biosciences. Silica Gel 60 thin layer chromatography plates, EM Science. Murine TNF-
ELISA reagents, TNF-
polyclonal Ab (PMTNFAI), biotin-labeled TNF-
mAb (MM350DB), HRP-conjugated streptavidin, TMB substrate solution (N301), and mouse TNF-
ELISA standard (SMTNFA) were purchased from Endogen. Maxisorp-coated 96-well ELISA plates were purchased from Nalge Nunc International. Bio-Rad protein reagent was obtained from Bio-Rad; primer pairs from Qiagen; SYBR Green PCR master mix and MicroAmp optical 96-well reaction plates from Applied Biosystems; TRIzol from Invitrogen Life Technologies; Superscript III RNase H-reverse transcriptase, dNTP mix, and oligo(dT) from primers from Invitrogen Life Technologies; and RNasin RNase inhibitor from Promega.
Animals
All animal care and use was conducted in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council) as we have described (18). B6.Cg-+Leprdb/+Leprolb (db/db) mice and their age-matched nondiabetic B6.Cg-M+/+Leprdb (db/+) littermates were bred in-house from mice purchased from The Jackson Laboratory. Mice were housed in standard shoebox cages and given pelleted food (NIH 5K52, LabDiet; Purina Mills) and water ad libitum in a temperature (23°C)- and humidity (4555%)-controlled environment with a 12-h/12-h dark-light cycle (8:00 a.m. to 8:00 p.m.). Male 8- to 12-wk-old animals were used for all experiments. Animals administered LPS received 5 µg/mouse i.p.
Peritoneal lavage, peritoneal macrophage (PerM
) isolation, and LPS treatment
As we previously described (6), mice were sacrificed by CO2 asphyxiation. Peritoneal fluid for TNF-
testing was recovered by lavage of the peritoneal cavity with 1 ml of ice-cold PBS. Lavage fluid was clarified by centrifugation. Peritoneal cells were collected by peritoneal lavage using 10 ml of ice-cold growth medium (RPMI 1640 supplemented with 10% FCS, 2 g/L sodium bicarbonate, 110 mg/L sodium pyruvate, 62.1 mg/L penicillin, 100 mg/L streptomycin, and 10 mM HEPES (pH 7.4)). Lavage cells were pelleted and resuspended in 10 ml of hypertonic RBC lysis buffer (142 mM NaCl, 1 mM KHCO3, and 118 mM sodium EDTA (pH 7.4)) at room temperature for 5 min then mixed 1:1 with growth medium, pelleted, and resuspended at 37°C. Cells were plated on plastic at 0.5 x 106 cells/ml and after 60 min plates (21 mm 12-well for ELISA, 100 x 20 mm for Western and kinase assay) were washed twice to remove nonadherent cells, resulting in >80% pure macrophages, confirmed by CD11b staining and morphology (19). Results for ELISA, Western, and kinase assays were normalized to total protein for adherent PerM
. Cells were then incubated in fresh growth medium treated with LPS from Escherichia coli 0127:B8 (L-3137; Sigma-Aldrich) for the times and concentrations indicated. For experiments using high and low glucose conditions, cells were incubated for 12 h in growth medium containing 4.0 or 1.0 g/L glucose, respectively, before LPS treatment. Flow cytometry and ELISA experiments used one 12-well plate well per Ab. Western experiments used one 100 x 20 plate per lane. No pooling of mice was used.
Blood glucose measurement
Blood was collected from the lateral saphenous vein as we described previously (6). Briefly, blood glucose levels were measured using a One Touch Ultra glucometer (Johnson & Johnson) per the manufacturers instructions.
TNF-
TNF-
was measured by ELISA as we have described previously (6). Briefly, polyclonal anti-mouse TNF-
Ab at 2 µg/ml was absorbed to 96-well microtiter plates overnight at 25°C. Wells were then blocked with 4% BSA/PBS for 1 h and washed with 0.2% Tween 20 and 50 mM/L Tris (pH 8.0). Standards and experimental samples were incubated at 25°C for 2 h in the presence of biotin-labeled monoclonal anti-mouse TNF-
(250 ng/ml). Wells were washed and HRP-conjugated streptavidin (78 ng/ml) was added for 30 min at 25°C. After washing, 3,3',5,5'-tetramethylbenzidine substrate solution was added for 30 min at 25°C. HRP/substrate reaction was terminated with an equal volume of 0.18 M H2SO4 and absorbance measured on an OPTImax tunable microplate reader (Molecular Devices) at 450550 nm. TNF-
concentrations were determined by reference to the simultaneously generated standard curve. For peritoneal fluid, TNF-
was reported as picograms per milligram of peritoneal fluid protein. For serum, TNF-
was reported as picograms per milligram of serum protein. For cells, TNF-
was reported as picograms per milligram of cellular protein.
RNA isolation and reverse transcription
Total RNA from spleen or PerM
samples were extracted into TRIzol. Reverse transcription was performed using oligo(dT) primers added to 1 µg of spleen or PerM
RNA. The oligo (dT) primer/RNA mix was then inactivated at 70°C for 10 min and chilled on ice. Reverse transcription was performed at 42°C for 90 min in a reaction buffer containing 10 mM/L DTT, 0.5 mM/L (each) dNTP, 200 U of SuperScript III, 93.75 mM/L KCl, 3.75 mmol/L MgCl2, and 62.5 mM/L Tris-HCl (pH 8.3). The reaction was terminated by heat (70°C for 15 min). To minimize interassay variation, all RNA samples from a single experimental group were reverse transcribed simultaneously.
Real-time PCR
Real-time PCR was performed as previously described (20). In brief, Primer Express software (Applied Biosystems) was used to design appropriate primers pairs. The primer sequences used were:
-actin forward: GGCGCTTTTGACTCAGGATT,
-actin reverse: GGGATGTTTGCTCCAACCAA; TNF-
forward: ATCCGCGACGTGGAACTG, TNF-
reverse: ACCGCCTGGAGTTCTGGAA. Real-time RT-PCR was performed on an Applied Biosystems Prism 7700 using SYBR Green PCR Master Mix. To normalize gene expression, a parallel amplification of endogenous genes was also performed. Reactions with no reverse transcription and no template were included as negative controls. Amplifications without reverse transcription or template were included as negative controls. Relative quantitative evaluation of target gene levels was performed by comparing
Ct, where Ct is the threshold concentration.
Flow cytometry
Flow cytometry was preformed as we have described (21). In brief, peritoneal cells were isolated as above and, after treatment with RBC lysis buffer, cells were pelleted, resuspended in cold PBS, and incubated with either PE-labeled CD14, TLR4/MD2, or isotype control at 5 µl/test for 15 min on ice. Cells were then washed (three times) with ice-cold PBS. Fluorescence was detected on an Epics XL flow cytometer (Beckman Coulter) quantifying 1.5 x 104 events using forward scatter, side scatter, and CD14 staining to define the macrophage population. Nonviable cells were excluded from quantification through use of propidium iodide staining.
PI3K assay
PI3K activity was assayed as we have described previously (18). In brief, PerM
were isolated on plastic, treated as indicated, and lysed in ice-cold homogenization buffer (1% Triton X-100, 100 mM NaCl, 50 mM NaF, 1 mM PMSF, 2 µg/ml aprotinin, 2 µg/ml leupeptin, 2 mM sodium orthovanadate, 50 mM okadaic acid, and 50 mM Tris (pH 7.4)). PI3K activity was assayed in anti-p85 or anti-phosphotyrosine (pY) immunoprecipitates after immune complexes were washed (three times) with 1% Triton X-100, 1 mM DTT, and PBS (pH 7.4), and 0.1 M NaCl, 1 mM DTT, and 10 mM Tris (pH 7.4). Kinase assays were performed in 0.4 mM EGTA, 0.4 mM NaPO4, 8 µM [
-32P]ATP (41.6 µCi/nM), 5 mM MgCl2, 0.333 mg/ml L-
-phosphatidylinositol, and 20 mM HEPES (pH 7.1). The reactions were terminated after 15 min. Phospholipids were extracted in chloroform and separated by thin layer chromatography. Phospholipid reaction products were analyzed on a Molecular Dynamics PhosphorImager System.
Western blot analysis
Western blot analysis was performed as we have described previously (18). In brief, PerM
were isolated on plastic, treated as indicated, and lysed in ice-cold homogenization buffer. Lanes were loaded at 250 µg/lane. Proteins were resolved by SDS-PAGE under reducing conditions and then electrotransferred to nitrocellulose membrane. Immunoreactive proteins were visualized using the indicated primary Abs and ECL+ reagents followed by autoradiography and densitometry.
p38 kinase assay
PerM
were on plastic, treated as indicated, and lysed in ice-cold homogenization buffer. Lysates were clarified and p38 was immunoprecipitated overnight at 4°C. After p38 immunoprecipitates were washed twice in kinase buffer, and the p38 kinase activity was determined by nonradioactive p38 MAPK assay kit (9820; Cell Signaling Technology) per manufacturers directions. In brief, ATF2 was used as a p38 substrate and visualized by Western blot analysis with a phospho-ATF2 Ab.
Statistical analysis
Data are presented as mean ± SEM. Each mouse was considered a separate n. Where indicated, experimental data were analyzed by the Students t test for comparison of means or by single-factor ANOVA using Microsoft Excel. Statistical significance was denoted at p < 0.05.
| Results |
|---|
|
|
|---|
from db/db mice have increased LPS-induced TNF-
secretion
We have previously shown that IL-1
/IL-1RA balance in response to innate immune challenge is dysregulated in the db/db mouse model of T2D (6). To determine whether TNF-
production in response to LPS was increased in db/db mice, peritoneal fluid and serum from obese diabetic (db/db) and nonobese (db/+) (heterozygous control) mice was examined for TNF-
by ELISA before and after administration of i.p. LPS. Fig. 1A demonstrates that after 2 h LPS treatment peritoneal TNF-
was 3.6-fold (551.41 ± 119.04 vs 165.62 ± 75.55 pg/ml) greater in db/db mice than in control mice. No significant difference in TNF-
was seen in untreated db/db mice over control (94.49 ± 90.40 vs 19.02 ± 14.70 pg/ml). Fig. 1B shows that after 2 h LPS treatment serum TNF-
was 4.3-fold (380.99 ± 38.34 vs 87.50 ± 38.34 pg/mg protein) greater in db/db mice than in control mice. No significant difference in TNF-
was seen in untreated db/db mice over control (0 vs 3.99 ± 3.99 pg/mg protein). Fig. 1C shows that i.p. LPS increased splenic production of TNF-
mRNA by nearly 2-fold after 4 h (763.10 ± 69.94 vs 476.34 ± 51.73) in db/db mice as compared with db/+ mice. Fig. 1D demonstrates that PerM
from db/db mice produce similar amounts of TNF-
mRNA as db/+ mice after LPS treatment over 8 h. Because LPS mediates its effects through the TLR4/MD2 complex in conjunction with the coaccessory molecule CD14, flow cytometry was used to examine these molecules in PerM
from db/db and db/+ mice. Fig. 1, EH, demonstrate that there was no difference between db/db and db/+ mice in the percent of PerM
expressing TLR4/MD2 (54.87 ± 2.68 vs 53.83 ± 4.10) or CD14 (78.57 ± 6.57 vs 69.50 ± 0.38) and no difference in the median fluorescence of TLR4/MD2 (26.26 ± 5.11 vs 23.41 ± 2.80) or CD14 (47.07 ± 7.72 vs 56.80 ± 13.37) expressed per cell. Finally, Table I shows blood glucose for db/+ and db/db mice administered i.p. LPS at 0, 2, 4, and 8 h post-LPS. Taken together, these findings indicate that db/db mice elaborate more TNF-
than db/+ mice when exposed to LPS and that this is not due to increased cell surface expression of the LPS signaling components TLR4/MD2 and CD14.
|
|
secretion in isolated resident PerM
As we have shown, a dramatic difference exists between fasting blood glucose in db/db and db/+ mice (115 ± 19 vs 400 ± 15 mg/dL, respectively (6)). Fig. 2A demonstrates that, when resident PerM
from db/db and db/+ mice were isolated and stimulated ex vivo with LPS, TNF-
production was greater in db/db PerM
(1 ng of LPS, 438.3 ± 57.2 vs 1445.8 ± 229.7 pg of TNF-
/mg protein; 10 ng of LPS, 512.6 ± 31.2 vs 1516.2 ± 253.4 pg of TNF-
/mg protein; 100 ng of LPS, 519.9 ± 115.0 vs 1747.7 ± 106.4 pg of TNF-
/mg protein). To determine whether high glucose conditions could induce PerM
from nondiabetic animals to increase LPS-dependent TNF-
production, PerM
from db/+ mice were isolated and incubated in either high glucose (4 g/L) or low glucose (1 g/L) conditions for 12 h. Fig. 2B shows that LPS-dependent TNF-
production was increased 2-fold (1687.83 ± 277.24 vs 878.91 ± 131.24 pg of TNF-
/mg protein) in high glucose conditions. Fig. 2C shows that high glucose conditions did not significantly increase TNF-
mRNA (293.87 ± 37.14 vs 259.63 ± 45.89). When db/db mouse PerM
were incubated as above in low and high glucose medium no impact on LPS-dependent TNF-
production was observed (data not shown). Taken together, these findings indicate that isolated PerM
from db/db mice exposed to LPS elaborate more TNF-
than db/+ mice and that high glucose conditions can induce the db/db phenotype in db/+ PerM
.
|
from db/db mice
PI3K activity has been shown to lead to cytokine production downstream of TLR4 (22) and functions at the early phases of TLR signaling (23). Fig. 3, A and B, show that ex vivo LPS-stimulated (10 ng/ml, 30 min) p85 and pY associated PI3K activity is significantly increased (p85, 213.9 ± 38.2 vs 356.6 ± 48.5; pY, 151.3 ± 34.3 vs 353.0 ± 28.7) in PerM
from db/db when compared with db/+ mice. As control, there was no affect of LPS stimulation on amount of p85 (Fig. 3C) nor was the p85 amount different in db/db and db/+ mice. Taken together, these data indicate that LPS increases p85- and pY-associated PI3K activity more in db/db than db/+ PerM
.
|
from db/db mice
ERK1/2 (24, 25, 26, 27) and p38 kinase (28, 29) have been shown necessary to LPS-induced TNF-
production and both of these MAPK family members are activated by LPS (30, 31). To examine the ability of LPS to activate ERK1/2 and p38 in db/db mice, LPS-induced phosphorylation of ERK1/2 and p38 kinase in resident PerM
was determined by Western analysis. Fig. 4 demonstrates that after 15 min, LPS induced a significant increase in the phosphorylation of ERK1/2 (Fig. 4A) and p38 (Fig. 4B) in db/db when compared with db/+ mice (ERK1/2, 121.79 ± 0.49 vs 92.24 ± 8.73; p38, 143.70 ± 4.18 vs 62.03 ± 14.11). LPS also increased slightly ERK1/2 activity in db/+ mice at 30 min (0 min = 78.53 ± 8.21, 30 min = 192.85 ± 45.32) (Fig. 4A). A larger increase in phosphorylation was seen with p38 in db/+ mice (0 min = 227.97 ± 34.21, 15 min 391.56 ± 50.61, 30 min = 380.46 ± 33.67) (Fig. 4B). LPS did not alter amount of ERK1/2 (Fig. 4A) or p38 (Fig. 4B) nor did expression of ERK1/2 or p38 differ in db/db or db/+ mice. Taken together, these data indicate that LPS-induced ERK1/2 and p38 phosphorylation (activity) is greater in PerM
from db/db as compared with db/+ mice.
|
production in db/db PerM
is caused by enhanced p38 kinase activity
In Figs. 3 and 4, we have shown that three kinases (PI3K, ERK1/2, p38 kinase) are potentially responsible for the increased TNF-
production seen in db/db mice in response to LPS. To determine which of these kinases was relevant to enhanced LPS-induced TNF-
production in T2D, inhibitor studies were performed. Fig. 5A demonstrates that the PI3K inhibitor wortmannin or LY294002 did not block LPS-induced production of TNF-
in PerM
isolated from db/db or db/+ mice and that inhibition of PI3K showed a trend toward an increase in LPS-induced TNF-
. Fig. 5B showed that the ERK1/2 inhibitor PD90859 decreased LPS-induced TNF-
production in PerM
isolated from db/+ mice (206.10 ± 51.20 vs 82.64 ± 42.33) but not in PerM
isolated db/db mice (457.23 ± 67.72 vs 374.54 ± 62.55). Fig. 5C demonstrates that the p38 kinase inhibitor SB202190 inhibited LPS-induced production of TNF-
in PerM
isolated from both db/db (1345.53 ± 223.14 vs 211.64 ± 116.07) and db/+ mice (744.99 ± 216.92 vs 232.92 ± 167.01). Finally, Fig. 5D shows that there is a marked difference in the kinase activity of LPS-activated p38 kinase in PerM
from db/db mice as compared with db/+ mice with kinase activity barely detectable in db/+ mice under the conditions used. Taken together, these findings indicate that p38 kinase is required for LPS-induced TNF-
production in PerM
from db/db and db/+ mice and that greater LPS-induced p38 kinase activity causes greater TNF-
production in PerM
from db/db mice when compared with db/+ mice.
|
| Discussion |
|---|
|
|
|---|
Fig. 1, A and B, shows that LPS injected into the peritoneum of db/db mice leads, in 2 h, to a 3- and 4-fold higher concentration of TNF-
in peritoneal fluid and serum, respectively, than that seen in nondiabetic control animals. This release of TNF-
is coupled to an increase in TNF-
message in the spleen that peaks at 4 h. These results are not supportive of Faggioni et al. (38) who failed to show an increase in serum TNF-
after LPS. In our experiments, serum was collected 2 h post-LPS (vs 90 min for Faggioni et al. (38)) and we used male mice (vs female mice for Faggioni et al. (38)). Our results support those of Naguib et al. (39) who showed that s.c. injection of Porphyromonas gingivalis into the scalp of db/db mice increased soft-tissue TNF-
mRNA. Our results, however, differed from theirs in several significant ways. First, we demonstrated an actual increase in TNF-
protein, which they did not measure, and our time course of increase for both TNF-
protein and message was much shorter. Naguib et al. (39) showed prolonged expression of TNF-
mRNA at 3 days postbacterial administration. At day 1 postadministration, no difference in TNF-
message was seen. In addition, we found that TNF-
message expression returned to baseline by 8 h post-LPS administration in both db/db and control mice. A likely explanation besides the fact that Naguib et al. (39) used live bacteria and we used purified LPS is that LPS derived from P. gingivalis appears to be a TLR2 agonist (40) as opposed to the E. coli-derived LPS that we used, which is predominantly a TLR4 agonist (41). Our results also differ from those of Wen et al. (42), who found an increased basal expression of TNF-
mRNA in macrophages isolated from db/db mice as compared with db/+ mice. This difference, however, is likely due to their use of 4% thioglycolate-elicited PerM
. Thioglycolate is a RAGE receptor agonist and activation of RAGE receptors in macrophages induces TNF-
production (43).
To explore the mechanism of augmented LPS-dependent TNF-
elaboration in T2D resident PerM
, expression of TLR/MD2 complex and CD14 was examined. Fig. 1, EH, demonstrates that resident PerM
from db/db mice do not show a significance difference in surface receptors relevant to LPS recognition when compared with macrophages derived from nondiabetic animals. To rule out the possibility that there was not an undefined peritoneal factor that increased LPS action in db/db mice, like increased concentration of LPS-binding protein, or that significantly greater numbers of macrophages may exist in db/db mouse peritoneum, resident PerM
were isolated and tested for responsivity to LPS ex vivo. Fig. 2A shows that isolated PerM
from db/db mice produce 3-fold greater TNF-
in response to LPS than PerM
isolated from nondiabetic mice. These findings expand our previous work that demonstrated that LPS-dependent production of the proinflammatory cytokine IL-1
is increased in T2D (6). Other investigators have shown conflicting results. Araya et al. (44) found that macrophages isolated from type 1 diabetic patients had diminished or insignificant cytokine production in response to LPS. An important difference between our current findings and that of Araya et al. (44) is that their study examined the LPS-induced cytokine profile in type 1 diabetes and measured it in whole blood, whereas we examined regional TNF-
production (peritoneum or spleen) and macrophage-specific elaboration of TNF-
in a mouse model of T2D. El-Mahmoundy et al. (45) measured LPS-induced TNF-
in both cultured PerM
and serum in a rat model of T2D. They showed no significant impact of LPS on TNF-
production. An additional, critical, difference in our work as compared with the aforementioned studies is that we demonstrated that control resident PerM
exposed to a high glucose environment have a similar phenotype as resident PerM
isolated from db/db mice. Fig. 2B shows that PerM
recovered from db/+ mice and then treated for 12 h in medium containing 4 g/L glucose elaborated nearly 2.5-fold more TNF-
in response to LPS than PerM
exposed to euglycemic conditions. In contrast, PerM
from db/db mice treated in similar high and low glucose conditions were not impacted. Fig. 2C shows that high and low glucose conditions did not impact TNF-
mRNA production in control or LPS conditions. These findings are consistent with those of Fig. 1D which show that PerM
from db/db mice stimulated in vivo with LPS have the same TNF-
mRNA expression profile as db/+ mice. In addition, these findings support those of Kotlyarov et al. (46) who showed that LPS-induced TNF-
production was dependent on posttranscriptional modifications regulated by MAPKAP kinase 2, a kinase directly downstream of p38 kinase, and not to changes in mRNA expression and stability. In the spleen, however, there is an apparent difference in TNF-
mRNA expression at 4 h with db/db mice being greater than db/+ mice (Fig. 1C).
Insulin-dependent activation of PI3K is reduced in T2D (47). PI3K and TLR signaling share several downstream signaling components (22, 23, 48), however, the role of PI3K in TLR4 signaling, such as LPS is controversial. Several papers (49, 50) show that inhibition of PI3K leads to an increase in LPS-induced proinflammatory cytokines such TNF-
and tissue factor in monocytes and blood, suggesting that PI3K could be an endogenous inhibitor of LPS-induced cytokines. However, Ojaniemi et al. (22) did show that TLR4 activation of IL-1
was dependent on PI3K activity. We have previously shown that insulin-induced PI3K activity associated with IRS2 in PerM
from db/db mice was reduced. To determine whether T2D altered LPS-dependent activation of PI3K, PI3K activity was examined. Fig. 3 shows that isolated resident PerM
from db/db mice have increased p85- and pY-associated PI3K activity in response to LPS. This finding was unexpected due to the results we have previously shown with IRS2-associated PI3K activity. Expected results were that tyrosine-dependent intracellular signaling events in T2D would be blunted as a result of T2D-associated serine phosphorylation of tyrosine kinase substrates causing substrate ubiquitination/proteasomal degradation and/or "steric" hindrance between tyrosine kinase and substrate (8). Consequently, this up-regulation of LPS-induced PI3K activity was seen as the likely cause of the increased LPS-dependent TNF-
production observed in Fig. 3. Fig. 5A showed, however, that inhibition of PI3K activity with either wortmannin or LY294002 had no impact on LPS-dependent TNF-
elaboration in control or db/db mouse PerM
. The lack of involvement of PI3K in LPS-induced TNF-
production has been shown by Ojaniemi et al. (22) as noted above, but Guha et al. (49) showed a counterregulator role for PI3K in LPS-induction of TNF-
.
MAPKs are important to LPS-dependent production of TNF-
(24, 25, 26, 27, 51). Fig. 4A shows that LPS-dependent activation of ERK1/2 was increased at 15 min in resident PerM
isolated from db/db mice as compared with db/+ mice. Db/+ mice had a small increase in ERK1/2 activation at 30 min post-LPS. Interestingly, inhibition of ERK1/2 with PD98059 reduced LPS-dependent TNF-
production in db/+ PerM
but not in db/db PerM
. The results in db/+ PerM
support those found by Van der Bruggen et al. (27), which showed that LPS-induced ERK1/2 phosphorylation transiently and to a small degree 20 min post-LPS. Van der Bruggen et al. (27) and Shi et al. (26) also showed that PD98059 significantly inhibited LPS-induced TNF-
production in human monocytes and RAW 264.7s cells, respectively. In nondiabetic cells, ERK1/2 appears necessary for the induction and activation of Egr-1, and blockade of ERK1/2 with PD98059 inhibits expression of Egr-1 and TNF-
production (25). Our data show that in T2D this ERK1/2 dependence is lessened.
As well as activating ERK1/2, LPS activates p38 kinase (30, 31, 52, 53). Fig. 4B demonstrates that resident PerM
from db/db have greater LPS-induced p38 kinase activation than PerM
isolated from db/+ mice. Importantly, inhibition of p38 kinase with SB202910 completely blocks LPS-dependent TNF-
production (Fig. 5C). It has been shown in a variety of cell types including rat aorta (54, 55), human kidney (56), and human skeletal muscle (57) that diabetes increases p38 kinase expression. In PerM
, we did not observe such an increase (Fig. 4B). Studies have also shown that phospho-p38 is increased in diabetes. Igarashi et al. (55) found that in rat aortic smooth muscle cells, high glucose conditions caused elevated phospho-p38. In a mouse model of type 1 and type 2 diabetes, kidney levels of phospho-p38 were increased (56), as were basal levels of phospho-p38 sampled from skeletal muscle from T2D patients (57). Fig. 4B shows that basal levels of phospho-p38 were similar in PerM
from db/db and db/+ animals and Fig. 5D demonstrates that p38 activity was undetectable unless LPS was used an activator. Fig. 5D also shows that LPS-dependent p38 kinase activity was markedly greater in db/db mice as compared with db/+ mice. Therefore, the apparent cause of increased LPS-dependent TNF-
production in the db/db mouse model of T2D is augmented LPS-induced p38 kinase activity.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from the National Institutes of Health (DK64862 (to G.G.F.) and Postdoctoral Fellowship DK59802 (to J.C.O.)) and University of Illinois Agricultural Experiment Station (to G.G.F.). ![]()
2 Address correspondence and reprint requests Dr. Gregory G. Freund, Department of Pathology, College of Medicine, University of Illinois, 506 South Mathews Avenue, Urbana, IL 61801. E-mail address: freun{at}uiuc.edu ![]()
3 Abbreviations used in this paper: T2D, type 2 diabetes; IRS, insulin receptor substrate; IL-1RA, IL-1R antagonist; PerM
, peritoneal macrophage; pY, phosphotyrosine. ![]()
Received for publication August 1, 2006. Accepted for publication October 24, 2006.
| References |
|---|
|
|
|---|
and blood cytokine production in type 2 diabetes. Life Sci. 67: 291-300. [Medline]
-mediated innate immunity is amplified in the db/db mouse model of type 2 diabetes. J. Immunol. 174: 4991-4997.
signaling in septic shock. Shock 24: 206-209. [Medline]
receptor 2 level in lean nondiabetic offspring of type 2 diabetic subjects. Diabetes Care 25: 1824-1828. 
T method. Methods 25: 402[Medline]
. Cell. Signal. 16: 271-280. [Medline]
expression by inducing Elk-1 phosphorylation and Egr-1 expression. Blood 98: 1429-1439.
production via Egr-1. Am. J. Physiol. 282: C1205-C1211.
production by human monocytes involves the raf-1/MEK1-MEK2/ERK1-ERK2 pathway. Infect. Immun. 67: 3824-3829.
and -
. Diabetes 54: 85-91.
and interleukin-1
in lipopolysaccharide-induced hypoglycemia in mice. Clin. Diagn. Lab. Immunol. 9: 1307-1312. [Medline]
, IL-1
, IL-6 and PGE2 secretion in whole blood from type 1 diabetes mellitus patients with or without aggressive periodontitis. Eur. Cytokine Netw. 14: 128-133. [Medline]
biosynthesis. Nat. Cell Biol. 1: 94-97. [Medline]This article has been cited by other articles:
![]() |
A. Kiely, A. Robinson, N. H McClenaghan, P. R Flatt, and P. Newsholme Toll-like receptor agonist induced changes in clonal rat BRIN-BD11 {beta}-cell insulin secretion and signal transduction J. Endocrinol., September 1, 2009; 202(3): 365 - 373. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Sherry, S. S. Kim, and G. G. Freund Accelerated Recovery from Acute Hypoxia in Obese Mice Is Due to Obesity-Associated Up-Regulation of Interleukin-1 Receptor Antagonist Endocrinology, June 1, 2009; 150(6): 2660 - 2667. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Huang, D. J. Moore, R. J. Ketchum, C. S. Nunemaker, B. Kovatchev, A. L. McCall, and K. L. Brayman Resolving the Conundrum of Islet Transplantation by Linking Metabolic Dysregulation, Inflammation, and Immune Regulation Endocr. Rev., August 1, 2008; 29(5): 603 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. O'Connor, C. L. Sherry, C. B. Guest, and G. G. Freund Type 2 Diabetes Impairs Insulin Receptor Substrate-2-Mediated Phosphatidylinositol 3-Kinase Activity in Primary Macrophages to Induce a State of Cytokine Resistance to IL-4 in Association with Overexpression of Suppressor of Cytokine Signaling-3 J. Immunol., June 1, 2007; 178(11): 6886 - 6893. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |