|
|
||||||||
Partners AIDS Research Center, Infectious Disease Unit, Massachusetts General Hospital and Division of AIDS, Harvard Medical School, Boston, MA 02129
| Abstract |
|---|
|
|
|---|
, or TNF-
, but was critically dependent on the direct contact of NK cells with plasmacytoid dendritic cells or CD14+ monocytes, indicating an important level of NK cell cross-talk and regulation by accessory cells during TLR-mediated activation. Coincubation of monocyte/plasmacytoid dendritic cells, NK cells, and ssRNA40 potentiated NK cell IFN-
secretion in response to MHC-devoid target cells. Studies using NK cells derived from individuals with chronic HIV-1 infection demonstrated a reduction of NK cell responsiveness following stimulation with TLR ligands in viremic HIV-1 infection. These data demonstrate that HIV-1-derived TLR ligands can contribute to the immune activation of NK cells and may play an important role in HIV-1-associated immunopathogenesis and NK cell dysfunction observed during acute and chronic viremic HIV-1 infection. | Introduction |
|---|
|
|
|---|
NK cells have a number of receptors on their surface that are used to survey the periphery for aberrant cells, and the majority of the ligands for these receptors are MHC and/or MHC homologs (13, 14, 15). In addition, pattern recognition receptors, and in particular TLR, have been recently shown to be expressed on NK cells (16, 17, 18), and these receptors may allow NK cells to respond to pathogen-associated molecular patterns (19, 20). Several mammalian TLRs have been identified to date that are involved in the recognition of foreign molecules as diverse as proteins, glycoproteins, lipids, and nucleic acids (19, 21). At least four of these TLRs have been implicated in the innate immune response to viruses; TLR3 can recognize short stretches of dsDNA/RNA (22) and TLR9 CpG motifs in ssDNA (23). Furthermore, TLR7 and TLR8 have been implicated in the recognition of uridine-rich ssRNA (19, 24), including more recently the detection of ssRNA derived from HIV-1 long terminal repeat (LTR) by DCs (25, 26, 27).
Given the activation of NK cells observed during acute and chronic viremic HIV-1 infection, we were interested in characterizing the potential role of HIV-1-derived ssRNA in mediating activation through TLR. In this study, we show that HIV-1 viremia is an important determinant of the level of NK cell activation, because significantly more NK cells were activated in viremic HIV-1-infected subjects than in subjects with undetectable viral loads. Furthermore, NK cells were significantly activated in vitro by established TLR7/8 ligands (3M001, 3M002, and 3M011) and ssRNA derived from HIV-1. This activation was dependent on direct contact with plasmacytoid DCs (pDCs) or CD14+ monocytes and resulted in an increased capacity of NK cells to respond to MHC devoid target cells. These data suggest that immune activation of NK cells during viremic HIV-1 infection is mediated in part by HIV-1-derived TLR ligands and may contribute to the immune pathogenesis observed in acute and chronic HIV-1 infection.
| Materials and Methods |
|---|
|
|
|---|
A total of 62 subjects was recruited for this study, including 22 healthy HIV-1-negative control subjects, 20 viremic HIV-1-infected subjects with an average viral load of 83,300 copies HIV-1 RNA/ml (range 780 to >750,000 copies/ml) and an average CD4 count of 371 cells/mm3 (range 93582), and 20 HIV-1-infected aviremic subjects on HAART with undetectable viral loads (<50 copies) with an average CD4 count of 324 cells/mm3 (range 156914). The Massachusetts General Hospital Institutional Review Board approved the study, and each subject gave informed consent for participation in the study.
Cell culture
PBMC were isolated by Ficoll-Hypaque density centrifugation of whole blood (Sigma-Aldrich). Purified NK cells were obtained by negative selection using a tetrameric Ab complex mediating cell enrichment from whole blood (RosetteSep; StemCell Technologies). DC enrichment and CD14+ monocyte enrichment were performed by MACS using CD14+-enrichment beads, a DC-enrichment mixture (including beads labeled with BDCA-14), and CD123 allophycocyanin (BD Biosciences), followed by allophycocyanin-depletion beads (Miltenyi Biotec). The purity of sorted populations was assessed by flow cytometry using CD3, CD56, CD16, CD14, CD123 (BD Biosciences), BDCA-1, BDCA-2, BDCA-3, and BDCA-4 (Miltenyi Biotec) Abs and ranged from 89 to 99.4%.
RT-PCR
The expression of mRNA in NK cells for TLR110 was determined by RT-PCR. RNA was generated from PBMC and purified NK cells (98.4% purity) using the RNAeasy kit (Qiagen). RNA was reverse transcribed using the Superscript III kit (Invitrogen Life Technologies). TLR expression was then evaluated using previously described primers using 1 µl of cDNA in a total volume of 50 µl containing 1 mM MgCl2, 10 mM dNTP, 2 U of TaqDNA polymerase, and 10 µM each primer in 10x PCR buffer. The PCR program consisted of 10 min at 95°C, followed by 30 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s, with a final extension time of 72°C for 10 min.
Western blot analysis
TLR8 protein expression was determined in pure NK cells by Western blot and was compared with TLR8-transfected 293T cells, Ramos cells, and untransfected 293T cells. Cells were then washed twice in cold PBS and lysed using Laemmli buffer (Bio-Rad). The expression of TLR8 (AbCam) was normalized to the level of GAPDH (Santa Cruz Biotechnology) staining, and was then compared among individual samples.
Quantification of NK cell activation by flow cytometry
The frequency of activated NK cells was assessed by the quantification of CD69+ NK cells following stimulation. Thus, PBMC, pure NK cells, PBMCs depleted of various subsets of APCs, or NK cells with APCs (as indicated) were resuspended at 106 cells/ml in RPMI 1640 (Sigma-Aldrich) containing 10% FBS (Atlanta Biologicals), 2 mM L-glutamine (Mediatech), and 50 IU/ml penicillin (Mediatech). Cells were then either stained directly ex vivo (Fig. 1) or stimulated with 3M001 (classified as a TLR7 ligand), 3M002 (classified as a TLR8 ligand with some TLR7 activity (28)), 3M011 (classified as both a TLR7/8 ligand) (all at 10 µM, provided by 3M), RNA-40 (GCCCGUCUGUUGUGUGACUC) (25), or the A-to-U-replaced RNA-41 (GCCCGACAGAAGAGAGACAC) (25) linked to N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (Dotap) for 6 h. Medium alone served as the negative control. To assess the role of IL-12, TNF-
, and IFN-
in reconstituting the ability of NK cells to respond to TLR stimulation, IL-12 was added to pure NK cells at 5 ng/ml, TNF-
was added at 0.05 ng/ml, whereas IFN-
was added to pure NK cells at 12,50050,000 U/ml, in the presence or absence of TLR ligands. For the Transwell assay, NK cells were layered on the bottom of the well, whereas monocytes were placed on the top compartment of the same well, and the stimulant was added to the medium to flow freely between compartments, as described previously (29). All stimulations were conducted for 6 h at 37°C in 5% CO2. The cells were then stained with CD3 PE Cy5.5, CD56 PE Cy7, CD16 allophycocyanin Cy7, and CD69 FITC (BD Biosciences) for 30 min. Samples were then fixed in 1% paraformaldehyde (Sigma-Aldrich) until four-color flow cytometric analysis was performed on an LSRII instrument (BD Biosciences). Two hundred thousand to 106 events were acquired and analyzed using FlowJo software.
|
The frequency of cytokine-secreting NK cells was quantified by multiparameter intracellular cytokine staining. One million cells were stimulated with ssRNA40-Dotap, ssRNA41-Dotap, or Dotap alone in the presence or absence of MHC-devoid K562 cells (American Type Culture Collection), at an E:T ratio of 10:1. Medium alone served as the negative control, and PMA (2.5 µg/ml) and ionomycin (0.5 µg/ml) served as a positive control. Brefeldin A (Sigma-Aldrich) was added at a final concentration of 5 µg/ml and incubated overnight for 18 h at 37°C in 5% CO2. PBMCs were stained for surface markers CD56 PE Cy7, CD16 allophycocyanin Cy7 (BD Biosciences), and CD3 PE Cy5.5 (Caltag Laboratories) for 30 min. Samples were then fixed and permeabilized, according to manufacturers directions (Caltag Laboratories), and stained for intracellular IFN-
FITC for an additional 30 min. After washing, cells were resuspended in 1% paraformaldehyde (Sigma-Aldrich) until acquisition was performed on an LSRII (BD Biosciences).
Statistical analysis
All experiments represent the mean of at least three experiments and SDs. Unpaired two-tailed Students t tests were used to assess differences between the activation of NK cells stimulated with various ligands. Values of p < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
Viremic HIV-1 infection is associated with a persistent activation of the immune system, including several cell subsets (30, 31, 32, 33, 34). In line with these observations, we show that more NK cells were activated in both viremic and aviremic HIV-1-infected subjects compared with uninfected controls (Fig. 1A). Significantly more NK cells from subjects with ongoing viral replication expressed CD69 than NK cells from HIV-1-infected subjects with undetectable viral loads due to effective antiretroviral therapy, or HIV-1-negative controls (p = 0.007 and p < 0.001, respectively; Fig. 1A). Furthermore, the proportion of CD69+ NK cells correlated with plasma viral loads in subjects with ongoing viral replication (p = 0.008, r = 0.6; Fig. 1B). Thus, these data indicate that significantly more NK cells are activated in the presence of high copy numbers of HIV-1 RNA in vivo.
NK cells are activated by ssRNA derived from HIV-1
It has been suggested that NK cells can become activated following stimulation with TLR ligands (18, 35, 36, 37, 38), and it was recently reported that a uridine-rich ssRNA sequence derived from the LTR region of HIV-1 can serve as a TLR7/8 ligand and activate DCs (25). Thus, we were intrigued to assess whether NK cells can be activated by TLR ligands, including TLR7/8 ligands derived from HIV-1. PBMC from 22 HIV-1-negative study subjects were stimulated with ligands for TLR7/8 (3M001, 3M002, 3M011; provided by 3M). Stimulation with 3M002 resulted in a dramatic activation of NK cells, as exemplified by CD69 expression on 22.5% of NK cells following stimulation for 6 h in a representative subject shown in Fig. 2A. A median of 24.3% (range 16.132.4%) of NK cells responded to stimulation with 3M002 by up-regulating CD69 in the 22 subjects studied (Fig. 2B). Similarly, activation of NK cells was observed following the addition of a TLR7-classified ligand (3M001) (21.05%, range 14.128.3%) and a TLR7/8-classified ligand (3M011) (30.4%, range 18.436.7%), demonstrating the ability of NK cells to respond to TLR7/8 ligands when bulk PBMC were stimulated.
|
Purified NK cells express TLRs
Given the robust NK cell activation attained with the incubation of both HIV-1-derived ssRNA40 and TLR7/8 ligands, we determined the expression pattern of TLR mRNA in purified NK cells, using previously described primers (17, 37, 39). Initial studies using bulk PBMC demonstrated that TLR110 mRNAs could be reliably amplified (Fig. 3A). Similarly, all TLR mRNAs except for TLR7 were amplified from NK cells purified to 98.4% purity (Fig. 3B). The lack of TLR7 amplification in the purified NK cells indicates low to undetectable expression of this gene; however, TLR7 was clearly visible in the cDNA prepared from autologous whole PBMC (Fig. 3A). This observation concurs with what had been reported previously by Hornung et al. (17), and is in line with the differential expression of TLR7 and TLR8 described for several other cell subsets, including monocytes, B cells, and pDCs (17).
|
NK cells respond to HIV-1 ssRNA40 in the presence of pDCs and/or monocytes
Some studies have suggested that NK cells can be directly activated by TLR3 and TLR9 ligands (16, 18), whereas activation through other TLR may require help from accessory cells (16). We were therefore interested in gauging whether NK cells could be activated directly by HIV-1 ssRNA40 via TLR8. Purified NK cells (93.397.7% purity for all experiments) did not up-regulate CD69 following stimulation with ssRNA40/Dotap, comparable to the unstimulated control (Fig. 4A). Similarly, whereas NK cells from whole PBMC responded strongly to stimulation with 3M002, NK cell activation was dramatically lost in the absence of APCs (Fig. 4A). Similarly, 3M-classified TLR7 (3M001) and the TLR7/TLR8 (3M011) ligands were also not able to activate NK cells directly in the absence of accessory cells (data not shown). These data demonstrate that NK cells require the help of DCs and/or monocytes to respond to a variety of TLR7/8 ligands.
|
NK cells require direct cell-to-cell contact with pDCs and monocytes to respond to ssRNA40
APCs secrete a large number of immunomodulators that can result in the activation of various cell subsets. Three of these critical modulators are the cytokines IL-12 (40), TNF-
(41, 42), and IFN-
(5, 41). Incubation of NK cells with IL-12, TNF-
, and IFN-
has been shown to result in the activation and enhancement of the cytolytic potential of NK cells (43, 44, 45). To determine whether IL-12, TNF-
, and/or IFN-
secretion by pDCs or monocytes in response to ssRNA40 stimulation through TLR7/8 mediated the activation of NK cells, we incubated purified NK cells with 3M002, ssRNA40/Dotap, ssRNA41/Dotap, Dotap alone, or medium alone in the presence or absence of IL-12, TNF-
, and/or IFN-
, and compared this with the NK cell activation in bulk PBMC. In parallel, we also added neutralizing Abs to these three cytokines to whole PBMC before activation to address whether the neutralization of these modulators was sufficient to inhibit NK cell activation following stimulation with ssRNA40 or 3M002. Purified NK cells were not activated in the presence of exogenous IFN-
or TNF-
alone, and only slightly up-regulated CD69 following stimulation with IL-12, but did not regain the ability to respond to stimulation with TLR7/8 ligands compared with NK cells in whole PBMC (Fig. 4C). Conversely, PBMC incubated with neutralizing Abs directed at the three cytokines demonstrated little to no modulation in the ability of NK cells to become activated in bulk PBMCs, despite a slight reduction in the proportion of activated NK cells in the presence of neutralizing Abs directed at IFN-
(Fig. 4C). Furthermore, based on data from Gerosa et al. (42), it is possible that NK cells require the concurrent stimulus from different combinations of these three cytokines or from all three at the same time. We therefore stimulated purified NK cells with combinations of the cytokines or all three, and did not see any significant modulation in the ability of NK cells to become activated in the absence of APCs (Fig. 4C). Yet we did observe a slight reduction in the ability of NK cells to become activated in whole PBMC in any combination containing neutralizing Abs to IFN-
(data not shown and Fig. 4C). These data suggest that whereas IFN-
appears to contribute partially to the activation of NK cells, the addition of these three cytokines to purified NK cells was not sufficient for the activation of NK cells by ssRNA40, suggesting that a more complex interaction is required to fully activate NK cells.
APCs, and monocytes in particular, provide signals to numerous subsets of cells during both the innate and adaptive immune response, some of which are receptor mediated (46) and others contact independent (47). To investigate whether the activation of NK cells by TLR7/8 ligands is dependent on contact between NK cells and pDCs or monocytes, we stimulated NK cells and autologous pDCs or monocytes with various TLR ligands in a Transwell assay. In this assay, the two cell subsets were separated by a membrane, so that TLR ligands and any secreted immunomodulators can traverse from one side of the membrane to the other. Physical separation of NK cells and pDCs or monocytes, in six separate individuals, abolished the stimulation of NK cells with ssRNA40/Dotap and 3M002 (p < 0.001 for both comparisons; Fig. 4D). The up-regulation of NKG2D ligands on the surface of target cells or APCs has been proposed as one mechanism by which NK cells become activated following engagement of target cells (48); however, we did not observe any change in the expression of NKG2D on NK cells or its ligands on pDCs or monocytes (data not shown). These data provide clear evidence that direct interaction is required between NK cells and pDCs or monocytes, but does not involve NKG2D in the experimental system used in this study, to achieve activation of this cell subset by HIV-1-derived TLR ligands and 3M002. Further studies are warranted to characterize the receptors involved in the NK-accessory cell (pDCs and monocytes) cross-talk following stimulation with TLR ligands.
Activation of NK cells with ssRNA derived from HIV-1 results in enhanced cytokine secretion
NK cells are able to secrete significant quantities of antiviral cytokines, such as IFN-
, in response to stimulation with MHC-devoid target cells (2, 49). Thus, we were interested in assessing whether NK cell activation by HIV-1-derived ssRNA (ssRNA40) could alter the ability of NK cells to respond to MHC-devoid K562 cells. PBMC were stimulated for 18 h with ssRNA40-Dotap, ssRNA41-Dotap, or Dotap alone in the presence or absence of K562 cells. Representative primary flow data demonstrate that significant proportions of NK cells secreted IFN-
following stimulation with ssRNA40-Dotap (7.49%) and K562 cells alone (8%) (Fig. 5A). Significantly more NK cells secreted IFN-
following stimulation with both ssRNA40-Dotap and K562 cells combined (24%; Fig. 5A). Overall, the proportion of NK cells that secreted IFN-
following stimulation with K562 cells was nearly 3-fold greater in the presence of ssRNA40 than with K562 cells or ssRNA40 alone (p = 0.002 and 0.008, respectively; Fig. 5B). Furthermore, the addition of chloroquine, an inhibitor of endosomal TLR signaling (27), abrogated the ability of NK cells to produce IFN-
following stimulation with RNA40-Dotap and RNA40-Dotap and K562, but not K562 cells alone (data not shown), further supporting the notion that NK cell activation mediated by TLR7/8 ligands leads to enhanced cytokine secretion. These data demonstrate that stimulation of NK cells with HIV-1-derived ssRNA sensitizes NK cells to respond to MHC-devoid target cells and amplifies the cytokine response.
|
To assess the ability of NK cells derived from HIV-1-infected subjects to respond to stimulation with TLR7/8 ligands, including ssRNA derived from HIV-1, we stimulated whole Ficoll-enriched PBMC from subjects with chronic viremic and aviremic HIV-1 infection with Dotap alone, 3M002, Dotap-ssRNA40, Dotap-ssRNA41, and PMA/ionomycin, and compared these data with unstimulated controls. Interestingly, NK cells derived from HIV-1-infected subjects responded poorly to TLR stimulation as compared with NK cells derived from HIV-1-negative controls (p < 0.001 for both 3M002 and ssRNA40) (Fig. 6). Furthermore, subjects with viremic HIV-1 infection exhibited a more pronounced defect in the ability of NK cells to respond to stimulation with 3M002 or ssRNA40 than subjects that had successfully suppressed viremia on HAART in the aviremic population (p < 0.05 for both 3M002 and ssRNA40) (Fig. 6). Although NK cell activation following stimulation with TLR7/8 ligands in subjects that had undetectable viral loads was still higher than in viremic subjects (p = 0.002 and p = 0.0005 for 3M002 and ssRNA40, respectively), NK cell activation in this population was still significantly lower than that observed in HIV-1-negative controls (p = 0.01 and p = 0.007 for 3M002 and ssRNA40, respectively). Furthermore, the reduction observed in NK cell stimulation by TLR ligands was much more dramatic than the reduced capacity of NK cells to respond to mitogenic stimulation with PMA/ionomycin. These data suggest that in the setting of chronic viral replication, NK cells appear to be less readily stimulated by TLR7/8 ligands than NK cells from uninfected controls.
|
| Discussion |
|---|
|
|
|---|
NK cells express a number of different receptors that allow them to recognize tumor cells or virally infected cells. In concordance with previous studies (17), we demonstrate in this study that the mRNAs of most TLRs, except TLR7, can be detected in purified NK cells. In contrast to the lack of TLR7 mRNA detection in our study, a previous study reported TLR7 mRNA expression in NK cells (16). However, specific and sensitive quantitative PCR performed on highly purified NK cells demonstrated very low to undetectable levels of these transcripts (17). The discrepancy between these results may be due to differences in the sensitivity of the RT-PCR protocol used, although TLR7 mRNA was consistently detected in bulk PBMC using our protocol. Despite the expression of TLR8 mRNA, and also TLR8 protein, purified NK cells were not able to respond directly to TLR7/8 ligands, including ssRNA derived from HIV-1 LTR, that had been previously shown to activate human and murine DCs via TLR7/8 (25), but required the presence of pDCs or monocytes to be activated. This observation is in line with recent work in the malaria model demonstrating that monocytes are required for the full activation of NK cells by malaria-infected RBCs through TLR9 (16, 35) and has been previously suggested for the TLR7/8 ligand, R848, as well (16). In addition to what has been observed in the malaria model, data presented in this study suggest that pDCs also provide an activating signal to NK cells following stimulation with ssRNA40 from the HIV-1 LTR. These data suggest either that direct contact between NK cells and monocytes or pDCs, and not IFN-
, TNF-
, or IL-12 alone, provides a crucial costimulatory signal needed to amplify the initial TLR signal on NK cells or that TLR on NK cells are not functional and that TLR ligands exert their action entirely through accessory cells, resulting in a secondary activation of NK cells.
In various viral infections, it has been shown that NK cells are activated and proliferate during the acute response to infection (3). In line with this, significant activation and expansion of NK cells are observed during the acute phase of HIV-1 infection, with up to 40% of peripheral lymphocytes being part of the NK cell population (6). Although the precise stimulus required to initiate this early NK cell activation during viral infections is unknown, several recent studies have indicated a critical role of TLRs in the recognition of viruses by cells of the innate immune system (36). In this study, we demonstrate that ssRNA derived from HIV-1 can result in the activation of NK cells, and requires the presence of accessory cells, providing a potential mechanism accounting for the early activation of NK cells in acute infection. The activation of NK cells and their secretion of cytokines in response to HIV-1 ssRNA during acute HIV-1 infection may contribute both to the elimination of virally infected cells and the boosting of the ensuing adaptive immune response, as previously described for several other viral infections (3, 49, 57).
Although this activation of NK cells by HIV-1 ssRNA may contribute to the early response to the infection by the innate immune system, chronic stimulation by HIV-1-derived TLR ligands may be an important factor in HIV-1 immune pathogenesis. It has been shown that NK cell numbers and function change dramatically in the presence of persistent viral replication in chronic HIV-1 infection (6, 10), and in this study we demonstrate that the degree of activation of NK cells is directly associated with the level of HIV-1 viremia in vivo. The direct role of HIV-1 in inducing NK cell activation is further supported by the normalization of NK cell activity concurrently with the reduction in viral load following the introduction of antiretroviral therapy. Furthermore, the ability of NK cells to respond to TLR-mediated activation was significantly reduced in individuals with viremic chronic infection compared with infected individuals with suppressed viremia and HIV-1-negative controls. Thus, protracted exposure to virus, and to virus-derived TLR ligands, may lead to functional exhaustion of NK cells and reduced responsiveness to TLR-mediated activation in chronic HIV-1 infection. However, it is still unclear whether this diminished capacity to respond to stimulation with TLR7/8 ligands is due to defects that occur within the NK cell compartment (6, 10) or due to the impairment and loss of monocytes and DCs (58, 59) with progressive HIV-1 infection. Taken together, TLR-mediated stimulation of the NK cells may represent a double-edged sword, as follows: early in infection, TLR stimulation can help to activate NK cells in response to infection, enhance their ability to secret cytokines, and trigger their proliferative expansion, whereas persistent stimulation during chronic HIV-1 infection may lead to activation-induced deregulations in the NK cell compartment.
In conclusion, in this study, we present data supporting a model in which the activation of NK cells, observed in viremic HIV-1 infection, is caused by stimulation of this cell subset by uridine-rich sections of ssRNA derived from HIV-1. These data propose a mechanism for the activation of NK cells by compounds of HIV-1 at the earliest time in infection using pattern recognition molecules, such as TLR, to alarm and activate these early cytolytic effector cells. In contrast, protracted exposure to virus-derived TLR ligands may have a detrimental long-term effect leading to activation-induced NK cell dysregulation and contribute to immune pathogenesis.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Harvard Medical Center for AIDS Research and National Institutes of Health (R01 A1067031). ![]()
2 Address correspondence and reprint requests to Dr. Marcus Altfeld, Partners AIDS Research Center, Massachusetts General Hospital and Division of AIDS, Harvard Medical School, Boston, MA 02129. E-mail address: maltfeld{at}partners.org ![]()
3 Abbreviations used in this paper: DC, dendritic cell; LTR, long terminal repeat; mDC, myeloid DC; pDC, plasmacytoid DC; Dotap, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate. ![]()
Received for publication June 26, 2006. Accepted for publication March 14, 2007.
| References |
|---|
|
|
|---|
secretion in suppressed HIV-infected patients despite mature NK cell recovery: evidence for a defective reconstitution of innate immunity. J. Immunol. 168: 5764-5770.
production. J. Immunol. 175: 1636-1642.
B by Toll-like receptor 3. Nature 413: 732-738. [Medline]
B in the lung involves alveolar macrophages and Toll-like receptor 4-dependent pathways. J. Infect. Dis. 186: 1199-1206. [Medline]
release and initiation of immune responses in vivo. J. Immunol. 175: 6723-6732. 
, IL-12, and IL-15 regulation of NK cell responses to viral infection. J. Immunol. 169: 4279-4287. This article has been cited by other articles:
![]() |
E. L. J. M. Smits, P. Ponsaerts, Z. N. Berneman, and V. F. I. Van Tendeloo The Use of TLR7 and TLR8 Ligands for the Enhancement of Cancer Immunotherapy Oncologist, August 1, 2008; 13(8): 859 - 875. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iannello, O. Debbeche, S. Samarani, and A. Ahmad Antiviral NK cell responses in HIV infection: I. NK cell receptor genes as determinants of HIV resistance and progression to AIDS J. Leukoc. Biol., July 1, 2008; 84(1): 1 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iannello, O. Debbeche, S. Samarani, and A. Ahmad Antiviral NK cell responses in HIV infection: II. viral strategies for evasion and lessons for immunotherapy and vaccination J. Leukoc. Biol., July 1, 2008; 84(1): 27 - 49. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |