The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 178: 7658-7666.
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alter, G.
Right arrow Articles by Altfeld, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alter, G.
Right arrow Articles by Altfeld, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH

Single-Stranded RNA Derived from HIV-1 Serves as a Potent Activator of NK Cells1

Galit Alter, Todd J. Suscovich, Nickolas Teigen, Angela Meier, Hendrik Streeck, Christian Brander and Marcus Altfeld2

Partners AIDS Research Center, Infectious Disease Unit, Massachusetts General Hospital and Division of AIDS, Harvard Medical School, Boston, MA 02129


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Persistent immune activation is a hallmark of chronic viremic HIV-1 infection. Activation of cells of the innate immune system, such as NK cells, occurs rapidly upon infection, and is sustained throughout the course of the disease. However, the precise underlying mechanism accounting for the persistent HIV-1-induced activation of NK cells is poorly understood. In this study, we assessed the role of uridine-rich ssRNA derived from the HIV-1 long terminal repeat (ssRNA40) on activation of NK cells via TLR7/8. Although dramatic activation of NK cells was observed following stimulation of PBMC with ssRNA40, negligible activation was observed following stimulation of purified NK cells despite their expression of TLR8 mRNA and protein. The functional activation of NK cells by this HIV-1-encoded TLR7/8 ligand could not be reconstituted with exogenous IL-12, IFN-{alpha}, or TNF-{alpha}, but was critically dependent on the direct contact of NK cells with plasmacytoid dendritic cells or CD14+ monocytes, indicating an important level of NK cell cross-talk and regulation by accessory cells during TLR-mediated activation. Coincubation of monocyte/plasmacytoid dendritic cells, NK cells, and ssRNA40 potentiated NK cell IFN-{gamma} secretion in response to MHC-devoid target cells. Studies using NK cells derived from individuals with chronic HIV-1 infection demonstrated a reduction of NK cell responsiveness following stimulation with TLR ligands in viremic HIV-1 infection. These data demonstrate that HIV-1-derived TLR ligands can contribute to the immune activation of NK cells and may play an important role in HIV-1-associated immunopathogenesis and NK cell dysfunction observed during acute and chronic viremic HIV-1 infection.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Natural killer cells are large granular lymphocytes that are critical in the innate immune response to viral infections and malignancies (1, 2, 3), and NK cell deficiencies can result in early childhood mortality following infection with herpes viruses (4). NK cells are furthermore capable of secreting a number of cytokines and chemokines early in viral infections that are critical in the initiation of an effective adaptive immune response (5). It has been reported that significant changes occur within the NK cell compartment during HIV-1 infection (6, 7, 8, 9), including perturbations in the distribution and function of NK cells, accumulation of anergic NK cells (6, 10), and an impairment of NK-dendritic cell (DC)3 cross-talk (11). Furthermore, NK cells are activated in HIV-1-infected individuals more than in matched seronegative controls (12). However, the underlying mechanisms that contribute to this elevated level of immune activation in viremic HIV-1 infection are still unclear.

NK cells have a number of receptors on their surface that are used to survey the periphery for aberrant cells, and the majority of the ligands for these receptors are MHC and/or MHC homologs (13, 14, 15). In addition, pattern recognition receptors, and in particular TLR, have been recently shown to be expressed on NK cells (16, 17, 18), and these receptors may allow NK cells to respond to pathogen-associated molecular patterns (19, 20). Several mammalian TLRs have been identified to date that are involved in the recognition of foreign molecules as diverse as proteins, glycoproteins, lipids, and nucleic acids (19, 21). At least four of these TLRs have been implicated in the innate immune response to viruses; TLR3 can recognize short stretches of dsDNA/RNA (22) and TLR9 CpG motifs in ssDNA (23). Furthermore, TLR7 and TLR8 have been implicated in the recognition of uridine-rich ssRNA (19, 24), including more recently the detection of ssRNA derived from HIV-1 long terminal repeat (LTR) by DCs (25, 26, 27).

Given the activation of NK cells observed during acute and chronic viremic HIV-1 infection, we were interested in characterizing the potential role of HIV-1-derived ssRNA in mediating activation through TLR. In this study, we show that HIV-1 viremia is an important determinant of the level of NK cell activation, because significantly more NK cells were activated in viremic HIV-1-infected subjects than in subjects with undetectable viral loads. Furthermore, NK cells were significantly activated in vitro by established TLR7/8 ligands (3M001, 3M002, and 3M011) and ssRNA derived from HIV-1. This activation was dependent on direct contact with plasmacytoid DCs (pDCs) or CD14+ monocytes and resulted in an increased capacity of NK cells to respond to MHC devoid target cells. These data suggest that immune activation of NK cells during viremic HIV-1 infection is mediated in part by HIV-1-derived TLR ligands and may contribute to the immune pathogenesis observed in acute and chronic HIV-1 infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Study subjects

A total of 62 subjects was recruited for this study, including 22 healthy HIV-1-negative control subjects, 20 viremic HIV-1-infected subjects with an average viral load of 83,300 copies HIV-1 RNA/ml (range 780 to >750,000 copies/ml) and an average CD4 count of 371 cells/mm3 (range 93–582), and 20 HIV-1-infected aviremic subjects on HAART with undetectable viral loads (<50 copies) with an average CD4 count of 324 cells/mm3 (range 156–914). The Massachusetts General Hospital Institutional Review Board approved the study, and each subject gave informed consent for participation in the study.

Cell culture

PBMC were isolated by Ficoll-Hypaque density centrifugation of whole blood (Sigma-Aldrich). Purified NK cells were obtained by negative selection using a tetrameric Ab complex mediating cell enrichment from whole blood (RosetteSep; StemCell Technologies). DC enrichment and CD14+ monocyte enrichment were performed by MACS using CD14+-enrichment beads, a DC-enrichment mixture (including beads labeled with BDCA-1–4), and CD123 allophycocyanin (BD Biosciences), followed by allophycocyanin-depletion beads (Miltenyi Biotec). The purity of sorted populations was assessed by flow cytometry using CD3, CD56, CD16, CD14, CD123 (BD Biosciences), BDCA-1, BDCA-2, BDCA-3, and BDCA-4 (Miltenyi Biotec) Abs and ranged from 89 to 99.4%.

RT-PCR

The expression of mRNA in NK cells for TLR1–10 was determined by RT-PCR. RNA was generated from PBMC and purified NK cells (98.4% purity) using the RNAeasy kit (Qiagen). RNA was reverse transcribed using the Superscript III kit (Invitrogen Life Technologies). TLR expression was then evaluated using previously described primers using 1 µl of cDNA in a total volume of 50 µl containing 1 mM MgCl2, 10 mM dNTP, 2 U of TaqDNA polymerase, and 10 µM each primer in 10x PCR buffer. The PCR program consisted of 10 min at 95°C, followed by 30 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s, with a final extension time of 72°C for 10 min.

Western blot analysis

TLR8 protein expression was determined in pure NK cells by Western blot and was compared with TLR8-transfected 293T cells, Ramos cells, and untransfected 293T cells. Cells were then washed twice in cold PBS and lysed using Laemmli buffer (Bio-Rad). The expression of TLR8 (AbCam) was normalized to the level of GAPDH (Santa Cruz Biotechnology) staining, and was then compared among individual samples.

Quantification of NK cell activation by flow cytometry

The frequency of activated NK cells was assessed by the quantification of CD69+ NK cells following stimulation. Thus, PBMC, pure NK cells, PBMCs depleted of various subsets of APCs, or NK cells with APCs (as indicated) were resuspended at 106 cells/ml in RPMI 1640 (Sigma-Aldrich) containing 10% FBS (Atlanta Biologicals), 2 mM L-glutamine (Mediatech), and 50 IU/ml penicillin (Mediatech). Cells were then either stained directly ex vivo (Fig. 1) or stimulated with 3M001 (classified as a TLR7 ligand), 3M002 (classified as a TLR8 ligand with some TLR7 activity (28)), 3M011 (classified as both a TLR7/8 ligand) (all at 10 µM, provided by 3M), RNA-40 (GCCCGUCUGUUGUGUGACUC) (25), or the A-to-U-replaced RNA-41 (GCCCGACAGAAGAGAGACAC) (25) linked to N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (Dotap) for 6 h. Medium alone served as the negative control. To assess the role of IL-12, TNF-{alpha}, and IFN-{alpha} in reconstituting the ability of NK cells to respond to TLR stimulation, IL-12 was added to pure NK cells at 5 ng/ml, TNF-{alpha} was added at 0.05 ng/ml, whereas IFN-{alpha} was added to pure NK cells at 12,500–50,000 U/ml, in the presence or absence of TLR ligands. For the Transwell assay, NK cells were layered on the bottom of the well, whereas monocytes were placed on the top compartment of the same well, and the stimulant was added to the medium to flow freely between compartments, as described previously (29). All stimulations were conducted for 6 h at 37°C in 5% CO2. The cells were then stained with CD3 PE Cy5.5, CD56 PE Cy7, CD16 allophycocyanin Cy7, and CD69 FITC (BD Biosciences) for 30 min. Samples were then fixed in 1% paraformaldehyde (Sigma-Aldrich) until four-color flow cytometric analysis was performed on an LSRII instrument (BD Biosciences). Two hundred thousand to 106 events were acquired and analyzed using FlowJo software.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 1. Significant activation of NK cells in HIV-1-infected subjects with viremic infection. A, The dot plot represents the ex vivo proportion of NK cells expressing CD69 on their surface in viremic ({blacksquare}), aviremic ({blacktriangleup}), and HIV-infected subjects ({blacktriangledown}). B, The graph demonstrates the relationship between the percentage of CD69+ NK cells and the level of HIV-1 replication.

 
Intracellular cytokine staining

The frequency of cytokine-secreting NK cells was quantified by multiparameter intracellular cytokine staining. One million cells were stimulated with ssRNA40-Dotap, ssRNA41-Dotap, or Dotap alone in the presence or absence of MHC-devoid K562 cells (American Type Culture Collection), at an E:T ratio of 10:1. Medium alone served as the negative control, and PMA (2.5 µg/ml) and ionomycin (0.5 µg/ml) served as a positive control. Brefeldin A (Sigma-Aldrich) was added at a final concentration of 5 µg/ml and incubated overnight for 18 h at 37°C in 5% CO2. PBMCs were stained for surface markers CD56 PE Cy7, CD16 allophycocyanin Cy7 (BD Biosciences), and CD3 PE Cy5.5 (Caltag Laboratories) for 30 min. Samples were then fixed and permeabilized, according to manufacturer’s directions (Caltag Laboratories), and stained for intracellular IFN-{gamma} FITC for an additional 30 min. After washing, cells were resuspended in 1% paraformaldehyde (Sigma-Aldrich) until acquisition was performed on an LSRII (BD Biosciences).

Statistical analysis

All experiments represent the mean of at least three experiments and SDs. Unpaired two-tailed Student’s t tests were used to assess differences between the activation of NK cells stimulated with various ligands. Values of p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Increased number of activated NK cells in viremic HIV-1 infection

Viremic HIV-1 infection is associated with a persistent activation of the immune system, including several cell subsets (30, 31, 32, 33, 34). In line with these observations, we show that more NK cells were activated in both viremic and aviremic HIV-1-infected subjects compared with uninfected controls (Fig. 1A). Significantly more NK cells from subjects with ongoing viral replication expressed CD69 than NK cells from HIV-1-infected subjects with undetectable viral loads due to effective antiretroviral therapy, or HIV-1-negative controls (p = 0.007 and p < 0.001, respectively; Fig. 1A). Furthermore, the proportion of CD69+ NK cells correlated with plasma viral loads in subjects with ongoing viral replication (p = 0.008, r = 0.6; Fig. 1B). Thus, these data indicate that significantly more NK cells are activated in the presence of high copy numbers of HIV-1 RNA in vivo.

NK cells are activated by ssRNA derived from HIV-1

It has been suggested that NK cells can become activated following stimulation with TLR ligands (18, 35, 36, 37, 38), and it was recently reported that a uridine-rich ssRNA sequence derived from the LTR region of HIV-1 can serve as a TLR7/8 ligand and activate DCs (25). Thus, we were intrigued to assess whether NK cells can be activated by TLR ligands, including TLR7/8 ligands derived from HIV-1. PBMC from 22 HIV-1-negative study subjects were stimulated with ligands for TLR7/8 (3M001, 3M002, 3M011; provided by 3M). Stimulation with 3M002 resulted in a dramatic activation of NK cells, as exemplified by CD69 expression on 22.5% of NK cells following stimulation for 6 h in a representative subject shown in Fig. 2A. A median of 24.3% (range 16.1–32.4%) of NK cells responded to stimulation with 3M002 by up-regulating CD69 in the 22 subjects studied (Fig. 2B). Similarly, activation of NK cells was observed following the addition of a TLR7-classified ligand (3M001) (21.05%, range 14.1–28.3%) and a TLR7/8-classified ligand (3M011) (30.4%, range 18.4–36.7%), demonstrating the ability of NK cells to respond to TLR7/8 ligands when bulk PBMC were stimulated.


Figure 2
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 2. NK cells respond to stimulation with ssRNA40 and 3M002. A, Represents the primary flow cytometry data of the expression of CD69 on the surface of CD3CD56+/– NK cells following stimulation with TLR ligands for 6 h for a single individual. B, Depicts the average NK cell response to stimulation with various ligands in a total of 22 individuals. §, Indicates ligands that were only tested in a total of nine subjects. *, p < 0.05 compared with the unstimulated control.

 
To further explore the ability of NK cells to respond to stimulation with ssRNA derived from HIV-1, we incubated PBMC from HIV-1-negative subjects with the recently described TLR7/8 ligand ssRNA40, a uridine-rich RNA sequence derived from HIV-1 LTR, either alone or complexed with Dotap, a monocationic liposomal transfection reagent facilitating the cellular uptake of RNA. Furthermore, because TLR7/8 have been shown to detect regions of ssRNA containing high concentrations of uridines, we used a corresponding ssRNA sequence in which all uridines were replaced by adenines (ssRNA41) to control for TLR7/8 sp. act., as described previously (25). NK cells were slightly stimulated by ssRNA40 alone, but were strongly activated by ssRNA40 in conjunction with Dotap (Fig. 2A). Overall, a median of 28.8% (range 25.1–31.2%) of NK cells for the 22 subjects tested expressed CD69 following stimulation with RNA40/Dotap (Fig. 2B). In contrast, NK cells were not activated by Dotap alone, ssRNA41 alone, or ssRNA41/Dotap (Fig. 2). Thus, NK cells are able to respond to the TLR7 and/or TLR8 ligands, including 3M001, 3M002, and 3M011, and HIV-1-derived uridine-rich ssRNA (ssRNA40), when bulk PBMC were stimulated.

Purified NK cells express TLRs

Given the robust NK cell activation attained with the incubation of both HIV-1-derived ssRNA40 and TLR7/8 ligands, we determined the expression pattern of TLR mRNA in purified NK cells, using previously described primers (17, 37, 39). Initial studies using bulk PBMC demonstrated that TLR1–10 mRNAs could be reliably amplified (Fig. 3A). Similarly, all TLR mRNAs except for TLR7 were amplified from NK cells purified to 98.4% purity (Fig. 3B). The lack of TLR7 amplification in the purified NK cells indicates low to undetectable expression of this gene; however, TLR7 was clearly visible in the cDNA prepared from autologous whole PBMC (Fig. 3A). This observation concurs with what had been reported previously by Hornung et al. (17), and is in line with the differential expression of TLR7 and TLR8 described for several other cell subsets, including monocytes, B cells, and pDCs (17).


Figure 3
View larger version (46K):
[in this window]
[in a new window]

 
FIGURE 3. NK cells express TLR mRNA and TLR8 protein. The electrophoresis gel represents the expression pattern of TLR cDNA in A, PBMC and B, pure CD3CD56+/– NK cell population. PCR products for TLR (wells 1–10), GAPDH (well 11), and no template control (well 12) are shown for both populations of cells. Bands for all TLR are detectable in PBMC, but PCR products for only TLR1–6 and TLR8–10 are represented in purified NK cells. C, Western blot analysis of protein extracts from Ramos (B cells), whole PBMC, 293T-TLR8, 293T, and pure NK cells from subject 1 (NK1) and subject 2 (NK2). Blots were stained with anti-TLR8-specific Abs.

 
We subsequently determined whether TLR8 mRNA expression resulted in the expression of TLR8 protein in NK cells. Western blot analysis demonstrated the presence of the TLR8 protein in the lysates of a B cell line (Ramos), whole PBMC, and a TLR8-transfected 293t cell line, as well as in purified NK cells derived from two study subjects (NK1 and NK2; Fig. 3C). In contrast, no TLR8 protein was detected in nontransfected 293t cells. Taken together, purified NK cells express both TLR8 mRNA and TLR8 protein, conferring the potential for this cell subset to respond directly to TLR8 ligands, such as ssRNA derived from HIV-1.

NK cells respond to HIV-1 ssRNA40 in the presence of pDCs and/or monocytes

Some studies have suggested that NK cells can be directly activated by TLR3 and TLR9 ligands (16, 18), whereas activation through other TLR may require help from accessory cells (16). We were therefore interested in gauging whether NK cells could be activated directly by HIV-1 ssRNA40 via TLR8. Purified NK cells (93.3–97.7% purity for all experiments) did not up-regulate CD69 following stimulation with ssRNA40/Dotap, comparable to the unstimulated control (Fig. 4A). Similarly, whereas NK cells from whole PBMC responded strongly to stimulation with 3M002, NK cell activation was dramatically lost in the absence of APCs (Fig. 4A). Similarly, 3M-classified TLR7 (3M001) and the TLR7/TLR8 (3M011) ligands were also not able to activate NK cells directly in the absence of accessory cells (data not shown). These data demonstrate that NK cells require the help of DCs and/or monocytes to respond to a variety of TLR7/8 ligands.


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 4. NK cells are activated by TLR7/8 ligands in a contact-dependent manner with pDCs or monocytes. A, The bar graph represents the activation of NK cells in whole PBMC ({blacksquare}), purified NK cells ({square}), or PBMC depleted of DCs and monocytes (Figure 4), quantified by the percentage of CD3CD56+/–CD16+/– NK cells expressing CD69 in a total of six subjects. B, The bar graph shows the ability of NK cells to respond to stimulation in whole PBMC, purified NK cells, PBMC depleted of mDCs, purified NK cells plus mDCs, PBMC depleted of pDCs, purified NK cells plus autologous pDCs, PBMCs depleted of CD14+ monocytes, or purified NK cells plus autologous CD14+ monocytes at a 5:1 ratio in at least six separate individuals. C, The graph illustrates the ability of NK cells to respond to stimulation in whole PBMC, purified NK cells, and purified NK cells with exogenous IL-12, TNF-{alpha}, and/or IFN-{alpha} in six individuals. D, The graph shows the level of NK cell activation following stimulation of PBMC, purified NK cells, purified NK cells and autologous pDCs or CD14+ monocytes separated in a Transwell. Cells were stimulated with medium alone (light gray), Dotap alone ({blacksquare}), 3M002 (dark gray), ssRNA40-Dotap ({square}), and ssRNA41-Dotap (Figure 4). *, p < 0.05 compared with values in whole PBMC determined by ANOVA with a posthoc Tukey’s test.

 
To further distinguish which subset of accessory cells was responsible for providing the help necessary for NK cell activation by ssRNA40 via TLR7/8, PBMC were depleted of myeloid DCs (mDCs), pDCs, or CD14+ monocytes, respectively, and then stimulated with TLR7/8 ligands. The ability of NK cells to respond to stimulation with either 3M002 or ssRNA40/Dotap was not impacted by the removal of mDCs or pDCs (Fig. 4B). However, the addition of pDCs to purified NK cells resulted in the partial reconstitution of NK cell activation, whereas the addition of mDCs did not (Fig. 4B). Furthermore, the ability of NK cells to respond to stimulation with 3M002 and ssRN40/Dotap was greatly reduced following the depletion of CD14+ monocytes (p < 0.01 for both comparisons; Fig. 4B). To further confirm the requirement of monocytes for NK cell stimulation by TLR7/8 ligands, autologous monocytes were added back to purified NK cells, resulting in an almost complete recovery in the response to 3M002 (14.8%, range 8.1–21.5%), and a full recovery of the response to ssRNA40/Dotap (23.2%, range 21.4–25.0%) observed in PBMC. Taken together, these experiments demonstrate a complex regulation of NK cell activation by TLR7/8 ligands, whereby pDCs may be critical, but not exclusively responsible for the activation of NK cells, which is critically dependent on the presence of CD14+ monocytes.

NK cells require direct cell-to-cell contact with pDCs and monocytes to respond to ssRNA40

APCs secrete a large number of immunomodulators that can result in the activation of various cell subsets. Three of these critical modulators are the cytokines IL-12 (40), TNF-{alpha} (41, 42), and IFN-{alpha} (5, 41). Incubation of NK cells with IL-12, TNF-{alpha}, and IFN-{alpha} has been shown to result in the activation and enhancement of the cytolytic potential of NK cells (43, 44, 45). To determine whether IL-12, TNF-{alpha}, and/or IFN-{alpha} secretion by pDCs or monocytes in response to ssRNA40 stimulation through TLR7/8 mediated the activation of NK cells, we incubated purified NK cells with 3M002, ssRNA40/Dotap, ssRNA41/Dotap, Dotap alone, or medium alone in the presence or absence of IL-12, TNF-{alpha}, and/or IFN-{alpha}, and compared this with the NK cell activation in bulk PBMC. In parallel, we also added neutralizing Abs to these three cytokines to whole PBMC before activation to address whether the neutralization of these modulators was sufficient to inhibit NK cell activation following stimulation with ssRNA40 or 3M002. Purified NK cells were not activated in the presence of exogenous IFN-{alpha} or TNF-{alpha} alone, and only slightly up-regulated CD69 following stimulation with IL-12, but did not regain the ability to respond to stimulation with TLR7/8 ligands compared with NK cells in whole PBMC (Fig. 4C). Conversely, PBMC incubated with neutralizing Abs directed at the three cytokines demonstrated little to no modulation in the ability of NK cells to become activated in bulk PBMCs, despite a slight reduction in the proportion of activated NK cells in the presence of neutralizing Abs directed at IFN-{alpha} (Fig. 4C). Furthermore, based on data from Gerosa et al. (42), it is possible that NK cells require the concurrent stimulus from different combinations of these three cytokines or from all three at the same time. We therefore stimulated purified NK cells with combinations of the cytokines or all three, and did not see any significant modulation in the ability of NK cells to become activated in the absence of APCs (Fig. 4C). Yet we did observe a slight reduction in the ability of NK cells to become activated in whole PBMC in any combination containing neutralizing Abs to IFN-{alpha} (data not shown and Fig. 4C). These data suggest that whereas IFN-{alpha} appears to contribute partially to the activation of NK cells, the addition of these three cytokines to purified NK cells was not sufficient for the activation of NK cells by ssRNA40, suggesting that a more complex interaction is required to fully activate NK cells.

APCs, and monocytes in particular, provide signals to numerous subsets of cells during both the innate and adaptive immune response, some of which are receptor mediated (46) and others contact independent (47). To investigate whether the activation of NK cells by TLR7/8 ligands is dependent on contact between NK cells and pDCs or monocytes, we stimulated NK cells and autologous pDCs or monocytes with various TLR ligands in a Transwell assay. In this assay, the two cell subsets were separated by a membrane, so that TLR ligands and any secreted immunomodulators can traverse from one side of the membrane to the other. Physical separation of NK cells and pDCs or monocytes, in six separate individuals, abolished the stimulation of NK cells with ssRNA40/Dotap and 3M002 (p < 0.001 for both comparisons; Fig. 4D). The up-regulation of NKG2D ligands on the surface of target cells or APCs has been proposed as one mechanism by which NK cells become activated following engagement of target cells (48); however, we did not observe any change in the expression of NKG2D on NK cells or its ligands on pDCs or monocytes (data not shown). These data provide clear evidence that direct interaction is required between NK cells and pDCs or monocytes, but does not involve NKG2D in the experimental system used in this study, to achieve activation of this cell subset by HIV-1-derived TLR ligands and 3M002. Further studies are warranted to characterize the receptors involved in the NK-accessory cell (pDCs and monocytes) cross-talk following stimulation with TLR ligands.

Activation of NK cells with ssRNA derived from HIV-1 results in enhanced cytokine secretion

NK cells are able to secrete significant quantities of antiviral cytokines, such as IFN-{gamma}, in response to stimulation with MHC-devoid target cells (2, 49). Thus, we were interested in assessing whether NK cell activation by HIV-1-derived ssRNA (ssRNA40) could alter the ability of NK cells to respond to MHC-devoid K562 cells. PBMC were stimulated for 18 h with ssRNA40-Dotap, ssRNA41-Dotap, or Dotap alone in the presence or absence of K562 cells. Representative primary flow data demonstrate that significant proportions of NK cells secreted IFN-{gamma} following stimulation with ssRNA40-Dotap (7.49%) and K562 cells alone (8%) (Fig. 5A). Significantly more NK cells secreted IFN-{gamma} following stimulation with both ssRNA40-Dotap and K562 cells combined (24%; Fig. 5A). Overall, the proportion of NK cells that secreted IFN-{gamma} following stimulation with K562 cells was nearly 3-fold greater in the presence of ssRNA40 than with K562 cells or ssRNA40 alone (p = 0.002 and 0.008, respectively; Fig. 5B). Furthermore, the addition of chloroquine, an inhibitor of endosomal TLR signaling (27), abrogated the ability of NK cells to produce IFN-{gamma} following stimulation with RNA40-Dotap and RNA40-Dotap and K562, but not K562 cells alone (data not shown), further supporting the notion that NK cell activation mediated by TLR7/8 ligands leads to enhanced cytokine secretion. These data demonstrate that stimulation of NK cells with HIV-1-derived ssRNA sensitizes NK cells to respond to MHC-devoid target cells and amplifies the cytokine response.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 5. Activation of NK cells by ssRNA40 leads to enhanced IFN-{gamma} secretion. A, Primary flow cytometry data illustrate the pattern of IFN-{gamma} secretion by NK cells following 18 h of stimulation. B, The dot plot represents the cumulative IFN-{gamma} secretion of NK cells following stimulation in nine separate individuals.

 
NK cells from HIV-1-infected subjects respond poorly to stimulation with TLR ligands

To assess the ability of NK cells derived from HIV-1-infected subjects to respond to stimulation with TLR7/8 ligands, including ssRNA derived from HIV-1, we stimulated whole Ficoll-enriched PBMC from subjects with chronic viremic and aviremic HIV-1 infection with Dotap alone, 3M002, Dotap-ssRNA40, Dotap-ssRNA41, and PMA/ionomycin, and compared these data with unstimulated controls. Interestingly, NK cells derived from HIV-1-infected subjects responded poorly to TLR stimulation as compared with NK cells derived from HIV-1-negative controls (p < 0.001 for both 3M002 and ssRNA40) (Fig. 6). Furthermore, subjects with viremic HIV-1 infection exhibited a more pronounced defect in the ability of NK cells to respond to stimulation with 3M002 or ssRNA40 than subjects that had successfully suppressed viremia on HAART in the aviremic population (p < 0.05 for both 3M002 and ssRNA40) (Fig. 6). Although NK cell activation following stimulation with TLR7/8 ligands in subjects that had undetectable viral loads was still higher than in viremic subjects (p = 0.002 and p = 0.0005 for 3M002 and ssRNA40, respectively), NK cell activation in this population was still significantly lower than that observed in HIV-1-negative controls (p = 0.01 and p = 0.007 for 3M002 and ssRNA40, respectively). Furthermore, the reduction observed in NK cell stimulation by TLR ligands was much more dramatic than the reduced capacity of NK cells to respond to mitogenic stimulation with PMA/ionomycin. These data suggest that in the setting of chronic viral replication, NK cells appear to be less readily stimulated by TLR7/8 ligands than NK cells from uninfected controls.


Figure 6
View larger version (11K):
[in this window]
[in a new window]

 
FIGURE 6. NK cells from HIV-1-infected subjects are refractory to stimulation with TLR7/8 ligands. The graph represents the proportion of NK cells that up-regulated CD69 following a 6-h stimulation of Ficoll-purified PBMC with Dotap, 3M002, ssRNA40-Dotap, ssRNA41-Dotap, PMA/ionomycin, or medium alone in subjects that were HIV-1 negative (1), HIV-1-infected viremic (2), or HIV-1-infected aviremic (3).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Chronic viremic HIV-1 infection is characterized by persistent immune activation (30) and the functional impairment of several lymphocyte populations (50, 51, 52), including NK cells (9, 10, 12, 53, 54, 55). The perturbations observed in the NK cell compartment during chronic HIV-1 infection include the overall increased activation of NK cells, the early loss of CD3CD56bright NK cells, the accumulation of anergic CD3CD56CD16+ NK cells (6, 10), and the impairment of their cytotoxic capacity (6, 9, 10, 56) and cross-talk with DCs (11). The mechanisms underlying these numeric and functional NK cell perturbations observed during viremic HIV-1 infection are not understood. However, suppression of HIV-1 viremia by antiretroviral therapy results in at least a partial reconstitution of NK cell numbers and function (6, 9, 55). Recently, it has been demonstrated that ssRNA derived from HIV-1 LTR can activate DCs via TLR7/8 (2, 25). In this study, we show that NK cells express TLR8 and demonstrate the activation and sensitization of NK cells to MHC-devoid target cells using HIV-1-derived RNA as well as other TLR7/8 ligands in the presence of pDCs and monocytes. These studies have important implications for the understanding of the mechanisms underlying NK cell functional activation during HIV-1 infection.

NK cells express a number of different receptors that allow them to recognize tumor cells or virally infected cells. In concordance with previous studies (17), we demonstrate in this study that the mRNAs of most TLRs, except TLR7, can be detected in purified NK cells. In contrast to the lack of TLR7 mRNA detection in our study, a previous study reported TLR7 mRNA expression in NK cells (16). However, specific and sensitive quantitative PCR performed on highly purified NK cells demonstrated very low to undetectable levels of these transcripts (17). The discrepancy between these results may be due to differences in the sensitivity of the RT-PCR protocol used, although TLR7 mRNA was consistently detected in bulk PBMC using our protocol. Despite the expression of TLR8 mRNA, and also TLR8 protein, purified NK cells were not able to respond directly to TLR7/8 ligands, including ssRNA derived from HIV-1 LTR, that had been previously shown to activate human and murine DCs via TLR7/8 (25), but required the presence of pDCs or monocytes to be activated. This observation is in line with recent work in the malaria model demonstrating that monocytes are required for the full activation of NK cells by malaria-infected RBCs through TLR9 (16, 35) and has been previously suggested for the TLR7/8 ligand, R848, as well (16). In addition to what has been observed in the malaria model, data presented in this study suggest that pDCs also provide an activating signal to NK cells following stimulation with ssRNA40 from the HIV-1 LTR. These data suggest either that direct contact between NK cells and monocytes or pDCs, and not IFN-{alpha}, TNF-{alpha}, or IL-12 alone, provides a crucial costimulatory signal needed to amplify the initial TLR signal on NK cells or that TLR on NK cells are not functional and that TLR ligands exert their action entirely through accessory cells, resulting in a secondary activation of NK cells.

In various viral infections, it has been shown that NK cells are activated and proliferate during the acute response to infection (3). In line with this, significant activation and expansion of NK cells are observed during the acute phase of HIV-1 infection, with up to 40% of peripheral lymphocytes being part of the NK cell population (6). Although the precise stimulus required to initiate this early NK cell activation during viral infections is unknown, several recent studies have indicated a critical role of TLRs in the recognition of viruses by cells of the innate immune system (36). In this study, we demonstrate that ssRNA derived from HIV-1 can result in the activation of NK cells, and requires the presence of accessory cells, providing a potential mechanism accounting for the early activation of NK cells in acute infection. The activation of NK cells and their secretion of cytokines in response to HIV-1 ssRNA during acute HIV-1 infection may contribute both to the elimination of virally infected cells and the boosting of the ensuing adaptive immune response, as previously described for several other viral infections (3, 49, 57).

Although this activation of NK cells by HIV-1 ssRNA may contribute to the early response to the infection by the innate immune system, chronic stimulation by HIV-1-derived TLR ligands may be an important factor in HIV-1 immune pathogenesis. It has been shown that NK cell numbers and function change dramatically in the presence of persistent viral replication in chronic HIV-1 infection (6, 10), and in this study we demonstrate that the degree of activation of NK cells is directly associated with the level of HIV-1 viremia in vivo. The direct role of HIV-1 in inducing NK cell activation is further supported by the normalization of NK cell activity concurrently with the reduction in viral load following the introduction of antiretroviral therapy. Furthermore, the ability of NK cells to respond to TLR-mediated activation was significantly reduced in individuals with viremic chronic infection compared with infected individuals with suppressed viremia and HIV-1-negative controls. Thus, protracted exposure to virus, and to virus-derived TLR ligands, may lead to functional exhaustion of NK cells and reduced responsiveness to TLR-mediated activation in chronic HIV-1 infection. However, it is still unclear whether this diminished capacity to respond to stimulation with TLR7/8 ligands is due to defects that occur within the NK cell compartment (6, 10) or due to the impairment and loss of monocytes and DCs (58, 59) with progressive HIV-1 infection. Taken together, TLR-mediated stimulation of the NK cells may represent a double-edged sword, as follows: early in infection, TLR stimulation can help to activate NK cells in response to infection, enhance their ability to secret cytokines, and trigger their proliferative expansion, whereas persistent stimulation during chronic HIV-1 infection may lead to activation-induced deregulations in the NK cell compartment.

In conclusion, in this study, we present data supporting a model in which the activation of NK cells, observed in viremic HIV-1 infection, is caused by stimulation of this cell subset by uridine-rich sections of ssRNA derived from HIV-1. These data propose a mechanism for the activation of NK cells by compounds of HIV-1 at the earliest time in infection using pattern recognition molecules, such as TLR, to alarm and activate these early cytolytic effector cells. In contrast, protracted exposure to virus-derived TLR ligands may have a detrimental long-term effect leading to activation-induced NK cell dysregulation and contribute to immune pathogenesis.


    Acknowledgments
 
We thank 3M for providing us with the compounds 3M001, 3M002, and 3M011.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Harvard Medical Center for AIDS Research and National Institutes of Health (R01 A1067031). Back

2 Address correspondence and reprint requests to Dr. Marcus Altfeld, Partners AIDS Research Center, Massachusetts General Hospital and Division of AIDS, Harvard Medical School, Boston, MA 02129. E-mail address: maltfeld{at}partners.org Back

3 Abbreviations used in this paper: DC, dendritic cell; LTR, long terminal repeat; mDC, myeloid DC; pDC, plasmacytoid DC; Dotap, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate. Back

Received for publication June 26, 2006. Accepted for publication March 14, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Cooper, M. A., T. A. Fehniger, M. A. Caligiuri. 2001. The biology of human natural killer-cell subsets. Trends Immunol. 22: 633-640. [Medline]
  2. Moretta, A., C. Bottino, M. C. Mingari, R. Biassoni, L. Moretta. 2002. What is a natural killer cell?. Nat. Immunol. 3: 6-8. [Medline]
  3. Biron, C. A., L. R. Turgiss, R. M. Welsh. 1983. Increase in NK cell number and turnover rate during acute viral infection. J. Immunol. 131: 1539-1545. [Abstract]
  4. Etzioni, A., C. Eidenschenk, R. Katz, R. Beck, J. L. Casanova, S. Pollack. 2005. Fatal varicella associated with selective natural killer cell deficiency. J. Pediatr. 146: 423-425. [Medline]
  5. Biron, C. A.. 1999. Initial and innate responses to viral infections: pattern setting in immunity or disease. Curr. Opin. Microbiol. 2: 374-381. [Medline]
  6. Alter, G., N. Teigen, B. T. Davis, M. M. Addo, T. J. Suscovich, M. T. Waring, H. N. Streeck, M. N. Johnston, K. D. Staller, M. T. Zaman, et al 2005. Sequential deregulation of NK cell subset distribution and function starting in acute HIV-1 infection. Blood 106: 3366-3369. [Abstract/Free Full Text]
  7. Hu, P. F., L. E. Hultin, P. Hultin, M. A. Hausner, K. Hirji, A. Jewett, B. Bonavida, R. Detels, J. V. Giorgi. 1995. Natural killer cell immunodeficiency in HIV disease is manifest by profoundly decreased numbers of CD16+CD56+ cells and expansion of a population of CD16dimCD56 cells with low lytic activity. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 10: 331-340. [Medline]
  8. Plaeger-Marshall, S., C. A. Spina, J. V. Giorgi, R. Mitsuyasu, P. Wolfe, M. Gottlieb, G. Beall. 1987. Alterations in cytotoxic and phenotypic subsets of natural killer cells in acquired immune deficiency syndrome (AIDS). J. Clin. Immunol. 7: 16-23. [Medline]
  9. Azzoni, L., E. Papasavvas, J. Chehimi, J. R. Kostman, K. Mounzer, J. Ondercin, B. Perussia, L. J. Montaner. 2002. Sustained impairment of IFN-{gamma} secretion in suppressed HIV-infected patients despite mature NK cell recovery: evidence for a defective reconstitution of innate immunity. J. Immunol. 168: 5764-5770. [Abstract/Free Full Text]
  10. Mavilio, D., G. Lombardo, J. Benjamin, D. Kim, D. Follman, E. Marcenaro, M. A. O’Shea, A. Kinter, C. Kovacs, A. Moretta, A. S. Fauci. 2005. Characterization of CD56/CD16+ natural killer (NK) cells: a highly dysfunctional NK subset expanded in HIV-infected viremic individuals. Proc. Natl. Acad. Sci. USA 102: 2886-2891. [Abstract/Free Full Text]
  11. Mavilio, D., G. Lombardo, A. Kinter, M. Fogli, A. La Sala, S. Ortolano, A. Farschi, D. Follman, R. Gregg, C. Kovacs, et al 2006. Characterization of the defective interaction between a subset of natural killer cells and dendritic cells in HIV-1 infection. J. Exp. Med. 203: 2339-2350. [Abstract/Free Full Text]
  12. Fogli, M., P. Costa, G. Murdaca, M. Setti, M. C. Mingari, L. Moretta, A. Moretta, A. De Maria. 2004. Significant NK cell activation associated with decreased cytolytic function in peripheral blood of HIV-1-infected patients. Eur. J. Immunol. 34: 2313-2321. [Medline]
  13. Moretta, L., C. Bottino, D. Pende, M. C. Mingari, R. Biassoni, A. Moretta. 2002. Human natural killer cells: their origin, receptors and function. Eur. J. Immunol. 32: 1205-1211. [Medline]
  14. Biassoni, R., C. Cantoni, D. Marras, J. Giron-Michel, M. Falco, L. Moretta, N. Dimasi. 2003. Human natural killer cell receptors: insights into their molecular function and structure. J. Cell. Mol. Med. 7: 376-387. [Medline]
  15. Biassoni, R., C. Cantoni, D. Pende, S. Sivori, S. Parolini, M. Vitale, C. Bottino, A. Moretta. 2001. Human natural killer cell receptors and co-receptors. Immunol. Rev. 181: 203-214. [Medline]
  16. Hart, O. M., V. Athie-Morales, G. M. O’Connor, C. M. Gardiner. 2005. TLR7/8-mediated activation of human NK cells results in accessory cell-dependent IFN-{gamma} production. J. Immunol. 175: 1636-1642. [Abstract/Free Full Text]
  17. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, G. Hartmann. 2002. Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168: 4531-4537. [Abstract/Free Full Text]
  18. Sivori, S., M. Falco, M. Della Chiesa, S. Carlomagno, M. Vitale, L. Moretta, A. Moretta. 2004. CpG and double-stranded RNA trigger human NK cells by Toll-like receptors: induction of cytokine release and cytotoxicity against tumors and dendritic cells. Proc. Natl. Acad. Sci. USA 101: 10116-10121. [Abstract/Free Full Text]
  19. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21: 335-376. [Medline]
  20. Beutler, B.. 2004. Inferences, questions and possibilities in Toll-like receptor signalling. Nature 430: 257-263. [Medline]
  21. Kopp, E., R. Medzhitov. 2003. Recognition of microbial infection by Toll-like receptors. Curr. Opin. Immunol. 15: 396-401. [Medline]
  22. Takeshita, F., C. A. Leifer, I. Gursel, K. J. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167: 3555-3558. [Abstract/Free Full Text]
  23. Alexopoulou, L., A. C. Holt, R. Medzhitov, R. A. Flavell. 2001. Recognition of double-stranded RNA and activation of NF-{kappa}B by Toll-like receptor 3. Nature 413: 732-738. [Medline]
  24. Haeberle, H. A., R. Takizawa, A. Casola, A. R. Brasier, H. J. Dieterich, N. Van Rooijen, Z. Gatalica, R. P. Garofalo. 2002. Respiratory syncytial virus-induced activation of nuclear factor-{kappa}B in the lung involves alveolar macrophages and Toll-like receptor 4-dependent pathways. J. Infect. Dis. 186: 1199-1206. [Medline]
  25. Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, S. Bauer. 2004. Species-specific recognition of single-stranded RNA via Toll-like receptor 7 and 8. Science 303: 1526-1529. [Abstract/Free Full Text]
  26. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, C. Reis e Sousa. 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303: 1529-1531. [Abstract/Free Full Text]
  27. Beignon, A. S., K. McKenna, M. Skoberne, O. Manches, I. Dasilva, D. G. Kavanagh, M. Larsson, R. J. Gorelick, J. D. Lifson, N. Bhardwaj. 2005. Endocytosis of HIV-1 activates plasmacytoid dendritic cells via Toll-like receptor-viral RNA interactions. J. Clin. Invest. 115: 3265-3275. [Medline]
  28. Gorden, K. B., K. S. Gorski, S. J. Gibson, R. M. Kedl, W. C. Kieper, X. Qiu, M. A. Tomai, S. S. Alkan, J. P. Vasilakos. 2005. Synthetic TLR agonists reveal functional differences between human TLR7 and TLR8. J. Immunol. 174: 1259-1268. [Abstract/Free Full Text]
  29. Yang, O. O., S. A. Kalams, A. Trocha, H. Cao, A. Luster, R. P. Johnson, B. D. Walker. 1997. Suppression of human immunodeficiency virus type 1 replication by CD8+ cells: evidence for HLA class I-restricted triggering of cytolytic and noncytolytic mechanisms. J. Virol. 71: 3120-3128. [Abstract]
  30. Giorgi, J. V., Z. Liu, L. E. Hultin, W. G. Cumberland, K. Hennessey, R. Detels. 1993. Elevated levels of CD38+ CD8+ T cells in HIV infection add to the prognostic value of low CD4+ T cell levels: results of 6 years of follow-up: The Los Angeles Center, Multicenter AIDS Cohort Study. J. Acquir. Immune Defic. Syndr. 6: 904-912. [Medline]
  31. Deeks, S. G., B. D. Walker. 2004. The immune response to AIDS virus infection: good, bad, or both?. J. Clin. Invest. 113: 808-810. [Medline]
  32. Hunt, P. W., J. N. Martin, E. Sinclair, B. Bredt, E. Hagos, H. Lampiris, S. G. Deeks. 2003. T cell activation is associated with lower CD4+ T cell gains in human immunodeficiency virus-infected patients with sustained viral suppression during antiretroviral therapy. J. Infect. Dis. 187: 1534-1543. [Medline]
  33. Silvestri, G., D. L. Sodora, R. A. Koup, M. Paiardini, S. P. O’Neil, H. M. McClure, S. I. Staprans, M. B. Feinberg. 2003. Nonpathogenic SIV infection of sooty mangabeys is characterized by limited bystander immunopathology despite chronic high-level viremia. Immunity 18: 441-452. [Medline]
  34. Silvestri, G., A. Fedanov, S. Germon, N. Kozyr, W. J. Kaiser, D. A. Garber, H. McClure, M. B. Feinberg, S. I. Staprans. 2005. Divergent host responses during primary simian immunodeficiency virus SIVsm infection of natural sooty mangabey and nonnatural rhesus macaque hosts. J. Virol. 79: 4043-4054. [Abstract/Free Full Text]
  35. Baratin, M., S. Roetynck, C. Lepolard, C. Falk, S. Sawadogo, S. Uematsu, S. Akira, B. Ryffel, J. G. Tiraby, L. Alexopoulou, et al 2005. Natural killer cell and macrophage cooperation in MyD88-dependent innate responses to Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 102: 14747-14752. [Abstract/Free Full Text]
  36. Delale, T., A. Paquin, C. Asselin-Paturel, M. Dalod, G. Brizard, E. E. Bates, P. Kastner, S. Chan, S. Akira, A. Vicari, et al 2005. MyD88-dependent and -independent murine cytomegalovirus sensing for IFN-{alpha} release and initiation of immune responses in vivo. J. Immunol. 175: 6723-6732. [Abstract/Free Full Text]
  37. Saikh, K. U., J. S. Lee, T. L. Kissner, B. Dyas, R. G. Ulrich. 2003. Toll-like receptor and cytokine expression patterns of CD56+ T cells are similar to natural killer cells in response to infection with Venezuelan equine encephalitis virus replicons. J. Infect. Dis. 188: 1562-1570. [Medline]
  38. Krug, A., A. R. French, W. Barchet, J. A. Fischer, A. Dzionek, J. T. Pingel, M. M. Orihuela, S. Akira, W. M. Yokoyama, M. Colonna. 2004. TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function. Immunity 21: 107-119. [Medline]
  39. Hayashi, F., T. K. Means, A. D. Luster. 2003. Toll-like receptors stimulate human neutrophil function. Blood 102: 2660-2669. [Abstract/Free Full Text]
  40. Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3: 133-146. [Medline]
  41. Gerosa, F., B. Baldani-Guerra, C. Nisii, V. Marchesini, G. Carra, G. Trinchieri. 2002. Reciprocal activating interaction between natural killer cells and dendritic cells. J. Exp. Med. 195: 327-333. [Abstract/Free Full Text]
  42. Gerosa, F., A. Gobbi, P. Zorzi, S. Burg, F. Briere, G. Carra, G. Trinchieri. 2005. The reciprocal interaction of NK cells with plasmacytoid or myeloid dendritic cells profoundly affects innate resistance functions. J. Immunol. 174: 727-734. [Abstract/Free Full Text]
  43. Trinchieri, G., M. Wysocka, A. D’Andrea, M. Rengaraju, M. Aste-Amezaga, M. Kubin, N. M. Valiante, J. Chehimi. 1992. Natural killer cell stimulatory factor (NKSF) or interleukin-12 is a key regulator of immune response and inflammation. Prog. Growth Factor Res. 4: 355-368. [Medline]
  44. Chehimi, J., S. E. Starr, I. Frank, M. Rengaraju, S. J. Jackson, C. Llanes, M. Kobayashi, B. Perussia, D. Young, E. Nickbarg, et al 1992. Natural killer (NK) cell stimulatory factor increases the cytotoxic activity of NK cells from both healthy donors and human immunodeficiency virus-infected patients. J. Exp. Med. 175: 789-796. [Abstract/Free Full Text]
  45. Nguyen, K. B., T. P. Salazar-Mather, M. Y. Dalod, J. B. Van Deusen, X. Q. Wei, F. Y. Liew, M. A. Caligiuri, J. E. Durbin, C. A. Biron. 2002. Coordinated and distinct roles for IFN-{alpha}beta, IL-12, and IL-15 regulation of NK cell responses to viral infection. J. Immunol. 169: 4279-4287. [Abstract/Free Full Text]
  46. Greenwald, R. J., G. J. Freeman, A. H. Sharpe. 2005. The B7 family revisited. Annu. Rev. Immunol. 23: 515-548. [Medline]
  47. Andrews, D. M., C. E. Andoniou, A. A. Scalzo, S. L. van Dommelen, M. E. Wallace, M. J. Smyth, M. A. Degli-Esposti. 2005. Cross-talk between dendritic cells and natural killer cells in viral infection. Mol. Immunol. 42: 547-555. [Medline]
  48. Cerwenka, A., L. L. Lanier. 2001. Ligands for natural killer cell receptors: redundancy or specificity. Immunol. Rev. 181: 158-169. [Medline]
  49. Bukowski, J. F., R. M. Welsh. 1986. The role of natural killer cells and interferon in resistance to acute infection of mice with herpes simplex virus type 1. J. Immunol. 136: 3481-3485. [Abstract]
  50. Kawamura, T., H. Gatanaga, D. L. Borris, M. Connors, H. Mitsuya, A. Blauvelt. 2003. Decreased stimulation of CD4+ T cell proliferation and IL-2 production by highly enriched populations of HIV-infected dendritic cells. J. Immunol. 170: 4260-4266. [Abstract/Free Full Text]
  51. Malaspina, A., S. Moir, S. Kottilil, C. W. Hallahan, L. A. Ehler, S. Liu, M. A. Planta, T. W. Chun, A. S. Fauci. 2003. Deleterious effect of HIV-1 plasma viremia on B cell costimulatory function. J. Immunol. 170: 5965-5972. [Abstract/Free Full Text]
  52. Lichterfeld, M., D. E. Kaufmann, X. G. Yu, S. K. Mui, M. M. Addo, M. N. Johnston, D. Cohen, G. K. Robbins, E. Pae, G. Alter, et al 2004. Loss of HIV-1-specific CD8+ T cell proliferation after acute HIV-1 infection and restoration by vaccine-induced HIV-1-specific CD4+ T cells. J. Exp. Med. 200: 701-712. [Abstract/Free Full Text]
  53. De Maria, A., M. Fogli, P. Costa, G. Murdaca, F. Puppo, D. Mavilio, A. Moretta, L. Moretta. 2003. The impaired NK cell cytolytic function in viremic HIV-1 infection is associated with a reduced surface expression of natural cytotoxicity receptors (NKp46, NKp30 and NKp44). Eur. J. Immunol. 33: 2410-2418. [Medline]
  54. Kottilil, S., T. W. Chun, S. Moir, S. Liu, M. McLaughlin, C. W. Hallahan, F. Maldarelli, L. Corey, A. S. Fauci. 2003. Innate immunity in human immunodeficiency virus infection: effect of viremia on natural killer cell function. J. Infect. Dis. 187: 1038-1045. [Medline]
  55. Mavilio, D., J. Benjamin, M. Daucher, G. Lombardo, S. Kottilil, M. A. Planta, E. Marcenaro, C. Bottino, L. Moretta, A. Moretta, A. S. Fauci. 2003. Natural killer cells in HIV-1 infection: dichotomous effects of viremia on inhibitory and activating receptors and their functional correlates. Proc. Natl. Acad. Sci. USA 100: 15011-15016. [Abstract/Free Full Text]
  56. Parato, K. G., A. Kumar, A. D. Badley, J. L. Sanchez-Dardon, K. A. Chambers, C. D. Young, W. T. Lim, S. Kravcik, D. W. Cameron, J. B. Angel. 2002. Normalization of natural killer cell function and phenotype with effective anti-HIV therapy and the role of IL-10. AIDS 16: 1251-1256. [Medline]
  57. Bukowski, J. F., B. A. Woda, S. Habu, K. Okumura, R. M. Welsh. 1983. Natural killer cell depletion enhances virus synthesis and virus-induced hepatitis in vivo. J. Immunol. 131: 1531-1538. [Abstract]
  58. Knight, S. C., W. Elsley, H. Wang. 1997. Mechanisms of loss of functional dendritic cells in HIV-1 infection. J. Leukocyte Biol. 62: 78-81. [Abstract]
  59. Bagnara, G. P., G. Zauli, M. Giovannini, M. C. Re, G. Furlini, M. La Placa. 1990. Early loss of circulating hemopoietic progenitors in HIV-1-infected subjects. Exp. Hematol. 18: 426-430. [Medline]



This article has been cited by other articles:


Home page
The OncologistHome page
E. L. J. M. Smits, P. Ponsaerts, Z. N. Berneman, and V. F. I. Van Tendeloo
The Use of TLR7 and TLR8 Ligands for the Enhancement of Cancer Immunotherapy
Oncologist, August 1, 2008; 13(8): 859 - 875.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Iannello, O. Debbeche, S. Samarani, and A. Ahmad
Antiviral NK cell responses in HIV infection: I. NK cell receptor genes as determinants of HIV resistance and progression to AIDS
J. Leukoc. Biol., July 1, 2008; 84(1): 1 - 26.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Iannello, O. Debbeche, S. Samarani, and A. Ahmad
Antiviral NK cell responses in HIV infection: II. viral strategies for evasion and lessons for immunotherapy and vaccination
J. Leukoc. Biol., July 1, 2008; 84(1): 27 - 49.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alter, G.
Right arrow Articles by Altfeld, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alter, G.
Right arrow Articles by Altfeld, M.
Right arrowPubmed/NCBI databases
*