|
|
||||||||
Division of Rheumatology, Department of Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095
| Abstract |
|---|
|
|
|---|
. In the present study, we show that the inhibitory function of CD8+ T cells from tolerized mice is sustained for up to 8 wk and at all times depends on expression of Foxp3. Both CD28-positive and CD28-negative CD8+ T cells contain inhibitory cells, but the expression of mRNA for Foxp3 and for TGF-
is higher and lasts longer in the CD28 subset. In vitro addition of TGF-
(in the presence of IL-2) induces Foxp3 expression in a dose-response manner. Gene inhibition or blockade with small interfering RNA of Foxp3 abrogates the ability of the CD8+ Ti to inhibit anti-DNA production and the proliferation of CD4+ Th cells. Moreover, a significant correlation between expression of Foxp3 and ability of CD8+ Ti to secrete TGF-
is observed. Therefore, CD8+ Ti in this system of tolerance are similar to CD4+CD25+ regulatory T cells in their dependence on expression of Foxp3, and there may be a bidirectional Foxp3/TGF-
autocrine loop that determines the ability of the CD8+ T cells to control autoimmunity. | Introduction |
|---|
|
|
|---|
and IL-10 (13, 14, 15). The power of these cells to prevent, delay, or suppress established autoimmunity has been demonstrated in many animal models, including experimental allergic encephalomyelitis (3, 14, 15), experimental autoimmune orchitis (4), and murine systemic lupus erythematosus (7, 8, 11, 12, 13). In the work described in this study, we studied the characteristics of one group of inhibitory T cells (Ti),3 CD8+ Ti, which we have previously shown are induced in vivo after administration to New Zealand Black/New Zealand White F1 female (BWF1) mice of a peptide based on amino acid sequences within the VH region of murine Abs to DNA. That peptide, called pConsensus (pCons), contains MHC class I- and class II-binding T cell determinants (16, 17). Administration of pCons in a tolerogenic regimen to premorbid BWF1 female mice, a model of polygenic spontaneous systemic lupus erythematosus-like disease mediated in part by pathogenic IgG Abs to dsDNA, resulted in significant delay of both autoantibody production and nephritis, and substantially prolonged survival (16). The immune mechanisms elicited by pCons in tolerized BWF1 mice are complex and include induction of hyporesponsiveness in the CD4+ Th cells (11), induction of peptide-binding pCons-reactive CD4+CD25+ T regulatory (Treg) cells that inhibit anti-DNA via cell contact with the effector cells (11), and induction of CD8+ Ti that inhibit anti-DNA production via secretion of TGF-
(8).
We have previously shown that aging BWF1 mice develop abnormalities in their CD8+ T cell compartment (2), including inability to proliferate and apoptotic rather than activation responses to TCR stimulation. In this study, we show that after tolerization with pCons, BWF1 CD8+ Ti with both CD28+ and CD28 phenotypes can suppress CD4+ T cell proliferation and anti-dsDNA IgG production. Within both the CD28+ and CD28 Ti subsets, expression of the suppression-related transcription factor Foxp3 is increased and remains elevated for at least 34 wk. Concomitantly, secretion of TGF-
increases in both subsets of CD8+ Ti. Moreover, the ability of both CD28+ and CD28 Ti to suppress in vitro can be fully inhibited by blockade of Foxp3 via small interfering RNA (siRNA) technology.
The data suggest that these CD8+ Ti are somewhat similar to CD4+CD25+ Treg in that their suppressive capacities are associated with the expression of Foxp3, which can be up-regulated by TGF-
and IL-2.
| Materials and Methods |
|---|
|
|
|---|
New Zealand Black (H-2d/d), New Zealand White (H-2z/z), and (NZB x NZW)F1 (H-2d/z) mice were bred and maintained at the University of California or purchased from The Jackson Laboratory. Mice were treated in accordance with the guidelines of the University of California Animal Research Committee, an Institution accredited by the Association for Assessment and Accreditation of Laboratory Animal Care. All experiments were conducted in female mice.
Peptides
The tolerizing peptide, pCons (FIEWNKLRFRQGLEW), is an artificial peptide designed to contain I-Ed-binding and Kd-binding T cell determinants identified in several different J558 VH regions of anti-dsDNA Ig of BWF1 mice (16, 17, 18, 19). The negative control peptides pNeg and p93 are nonstimulatory and nontolerogenic. PNeg is artificial and designed to contain an I-Ed-binding T cell determinant that is not stimulatory. P93 is a wild peptide, a 15-mer beginning at position 93 in the VH molecule of a BWF1 mAb anti-DNA. A positive control peptide, p33b, is a wild peptide from VH of a BWF1 mAb anti-DNA: it binds I-Ed and can induce proliferation in BWF1 CD4+ T cells. Peptides were synthesized at Chiron Biochemicals, purified to single peak on HPLC, and analyzed by mass spectroscopy for expected amino acid content.
Treatment of mice
For tolerance induction, 10- to 12-wk-old BWF1 mice received a single i.v. dose of 1 mg of pCons, as reported previously (8, 11). In some experiments, mice were treated with pNeg or p93 as negative controls.
Cell isolation and staining
At various times after administration of peptide, single-cell suspensions of splenocytes were prepared by passing cells through a sterile wire mesh. After lysis of RBC with ACK lysing buffer (Sigma-Aldrich), cells were centrifuged and washed before resuspension in HL-1 medium (BioWhittaker). In experiments involving whole cell populations, CD4+, B, and CD8+ T cells were isolated by positive selection on an AutoMACS system (Miltenyi Biotec) and found >95% pure by subsequent FACS analysis. In experiments studying CD28+ or CD28 CD8+ T subsets, cells were sorted into these populations by FACS or isolated via magnetic beads. Such cells maintained good viability (85% or better by FACS analysis using 7-aminoactinomycin D staining to identify dead cells) and were at least 90% pure. We have previously shown that positive and negative selection of CD8+ T cells gave similar functional and molecular results (8). Abs used to analyze the cells included anti-Thy1.2, anti-CD8, and anti-CD28 (all from BD Pharmingen).
FACS analysis
Phenotypic analysis of splenocytes from untreated and pCons-tolerized mice was performed with a FACSCalibur flow cytometer (BD Biosciences) using either CellQuest (BD Biosciences) or FCS Express software (De Novo Software). Staining with multiple combinations of Ab (indicated in the pertinent sections) was performed according to standard procedures described elsewhere (11). Staining with annexin V and with 7-aminoactinomycin D was used to distinguish cells undergoing apoptosis from dead cells. The Ab used were all purchased from BD Pharmingen.
Intracellular staining
For intracellular staining, cells were first stained for expression of cell surface markers and then fixed, permeabilized, and stained using the Cytofix/Cytoperm kit (BD Pharmingen), according to the manufacturers instructions. Intracellular TGF-
and Foxp3 were identified in cells that had been fixed and permeabilized by staining with the appropriate Abs.
Cell cultures
Methods have been described previously (8, 11). In brief, purified CD4+ T cells from young naive BWF1 females and B cells from older naive BWF1 females with high titers of anti-DNA in serum were cultured with or without addition of CD8+ T cells from naive or tolerized mice (harvested at various times from 1 to 8 wk after tolerization) in 24-well microtiter plates at 37°C in complete medium containing antibiotics and 10% FCS. To activate the CD8+ T cells from tolerized mice, pCons peptide was added to cultures at 20 µg/ml concentrations, unless otherwise stated in the figure legends. Ratios used were 10 CD4+ T cells to 1 B cell; CD8+ T cells were added at a ratio of 1 CD8+ to 1 CD4+ T cell. Cells were cocultured for 5 days in experiments for anti-DNA production, for 48 h in experiments measuring cytokine production, and for 72 h in studies measuring cell proliferation. In some experiments, CD8+ T cells were cultured with addition of TGF-
(20 ng/ml), and medium was enriched with rIL-2 (10 ng/ml) to study up-regulation of FoxP3.
Measurement of anti-DNA and cytokines in supernatants of cell cultures
IgG anti-DNA was measured in concentrated cell culture supernatants with BD OptEIA ELISA kits (BD Biosciences). Cytokine measurement in the supernatant of cultured spleen cells was done with BD OptEIA ELISA kits (BD Biosciences) for TGF-
1.
Measurement of cell proliferation
Spleen cells were isolated from BWF1 mice at various times, as described in figure legends, after a single injection of pCons. RBC were removed by RBC lysing solution (Sigma-Aldrich). B220+ B cells, CD4+, and CD8+ T cells were isolated and cultured in triplicate in 96-well plates containing varying amounts of CD8+ Ti, 1 x 105 CD4+, and 2 x 105 irradiated or nonirradiated B cells cultured in medium containing murine rIL-2 for 96 h and pulsed with 0.5 µCi/well [3H]thymidine during the last 18 h of culture. Incorporation of tritiated thymidine into DNA was assessed by liquid scintillation counting in an automated counter (Beckman Coulter). Results are expressed as mean stimulation index or mean cpm ± SE and represent the average cpm of triplicate determinations.
Real-time PCR
Quantitative real-time reverse transcription was performed using TaqMan technology on an ABI Prism 7900 HT Sequence Detection System (Applied Biosystems). TaqMan RT-PCR mix was used for the RT-PCR, following the manufacturers instructions. Reverse transcription used 50 ng of total RNA. Total RNA was isolated with TRIzol (Invitrogen Life Technologies), per manufacturers protocol. The oligonucleotide sequences used for the primers and TaqMan probes are as follows: TGF-
forward, 5'-AAACGGAAGCGCATCGAA-3'; reverse, 5'-GGGACTGGCGAGCCTTAGTT-3'; probe 6FAM, CCATCCGTGGCCAGATCCTGTCC TAMRA. Foxp3 forward, 5' TGCAGGGCAGCTAGGTACTTGTA 3'; reverse, 5' TCTCGGAGATCCCCTTTGTCT 3'; and probe 6FAM, TCCGAACAGCATCATCCTTCTTAGCATCC TAMRA. The amplification primers were at 900 nM, and the probe was at 200 nM. A passive reference dye (ROX) provided an internal standard for normalization of FAM fluorescence, correcting for fluctuations due to volume changes. For relative quantitation, a standard curve was constructed for each primer and probe set, using total RNA. RNA was isolated from spleen cells of 10- to 13-wk-old naive or tolerized mice. Spleen cells from two to three mice in each group were pooled for each experimental group; usually two or more such pools were studied from each group simultaneously. For some experiments, CD4+ and CD8+ T cells isolated by positive selection were used for normalization purposes. The possibility of genomic DNA contamination was excluded by use of no reverse-transcriptase controls in combination with ribosomal primers. GAPDH was used as endogenous control in each experimental set for normalization. A ribosomal RNA control primer and probe set was used as indicated in the figure legends.
siRNA transfection
CD8+ T cells isolated as described above were plated and cultured in 24-well plates for 24 h in complete medium containing 10% FCS. For transfection, we used the Silencer siRNA Transfection kit from Ambion, which uses lipofection for transfection of siRNA into cells. In some experiments, OptiMEM-reduced serum medium (Invitrogen Life Technologies) was used to dilute the siPORT amine. Validated siRNA of FoxP3, CCR7, p53, and GAPDH was obtained from Ambion, as well as positive and negative siRNA controls. The negative control siRNA was a scrambled sequence that bears no homology to human, mouse, or rat genomes. The transfection agent alone served as another control (siPORT amine). The agent was mixed with siRNA of Foxp3, p53, CCR7, or GAPDH (50100 nM), or controls in serum-free medium and incubated at room temperature for 30 min. Cells were transfected with siRNA complexes by overlaying siRNA dropwise onto the cells. After 810 h, medium was removed and fresh medium (12 ml) was added. Viability was assayed with trypan blue staining. After 48 h of culture, transfected CD8+ T cells were transferred to cultures of fresh BWF1 CD4+ T cells plus B cells plus pCons for measurement of suppression of anti-DNA production or for cell proliferation. Some transfected cells were lysed with cell lysing solution (Invitrogen Life Technologies), and RNA was isolated for real-time PCR, to validate knockdown of the target gene. We have previously shown that this method knocks down all expression of Foxp3 (8).
Statistical analyses
Statistical analyses were performed using Prism 4 software (GraphPad). Comparisons between two groups were performed by one-tailed Students t test or by the Mann-Whitney U test. Nonparametric testing among more than two groups was performed by one-way ANOVA. Data in each cell of data were then compared by posttest analysis using Tukeys multiple comparison test. Values of p < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
Having shown that CD8+ Ti induced by pCons express Foxp3 (8), we asked whether silencing of Foxp3 abrogates the suppression of IgG anti-DNA production that occurs when CD8+ Ti are added to cultures containing naive CD4+ T and B cells, and whether Foxp3 controls the suppressive effects of CD8+ Ti over time. Characteristics of spleen cells harvested 1 wk after tolerization are shown in Fig. 1A, with results grouped. The left group shows baseline measures of anti-DNA production by naive CD4+ T cells (Fig. 1Aa), then by naive B cells (Fig. 1Ab), with addition of naive CD8+ T cells (Fig. 1Ac), and finally suppression by addition of tolerized CD8+ T cells activated by pCons (Fig. 1Ad) (p < 0.05 compared with Fig. 1Ac by Mann-Whitney U test). In the second group there are the data for abrogation of suppression by siRNA for three genes that are up-regulated in tolerized (t)CD8+ T cells compared with normals (R. Singh, submitted for publication). Suppression was maintained if tolerized (t)CD8+ T cells before coculture were treated with siRNA for p53 (Fig. 1Ae) or CCR7 (Fig. 1Af). However, treatment with siRNA for Foxp3 (Fig. 1Ag, p < 0.05 vs Fig. 1Ad), or siRNA for Foxp3 combined with siRNA for p53 and CCR7 abrogated suppression (Fig. 1Ah, p < 0.03 compared with Fig. 1Ad). The combination of siRNA for p53 and CCR7 did not inhibit the ability of tCD8+ T cells to inhibit anti-DNA production (data not shown). In the third group, there are results of pretreating tCD8+ T cells with control siRNA, including a scrambled sequence, the polyamine transfection medium, and siRNA for GAPDH (Fig. 1A, i, j, and k). None of these controls abrogated the suppressive capacity of tCD8+ T cells. In the last group of lanes are shown the peptide dose response and the specificity data. When no peptide was in the culture (Fig. 1A, l and o), there was no suppression. At 20 µg/ml (Fig. 1Am), the peptide pCons induced suppression by the CD8+ Ti (p < 0.007 by Students t test, Fig. 1A, comparing l with m). At 100 µg/ml pCons, there was toxicity to the cells (indicated by trypan blue stain with >90% of the cells dead), and production of anti-DNA was baseline (Fig. 1An, compare with Fig. 1Aa). Finally, the p-Cons-induced tCD8+ T cells could not suppress anti-DNA production when stimulated by p33b at 20 µg/ml (Fig. 1Ap). p33b is a control wild VH peptide that binds I-Ed and can induce T cell activation in BWF1 mice. At 100 µg/ml, the peptide p33b was toxic to cells (Fig. 1Aq).
|
CD8+ Ti suppress proliferation of CD4+ Th cells, and this effect needs the expression of Foxp3
Next, we asked whether CD8+ Ti could suppress proliferation of naive CD4+ T cells, the cells usually considered to be the major target of CD8+ Ti. CD8+ T cells from naive or tolerized BWF1 mice (harvested 1 wk after tolerization) were added to cultures of naive CD4+ T plus naive irradiated B cells (as APCs) from young naive BWF1 females, and proliferation was measured 72 h later. In Fig. 2A, the dose-response curve for the ability of pCons to activate suppression by tCD8+ T cells is shown. Asterisks indicate statistically significant differences from the 500 ng/ml concentration, p < 0.05 for 10, 20, and 50 µg/ml. A total of 100 µg/ml is toxic to the cells, and 20 µg/ml was chosen as the concentration of pCons to activate tCD8+ T cells in the following experiments. Data are grouped in Fig. 2B. The left lanes (Fig. 2B, a and b) show proliferation in naive (n) cells, with nCD4 plus B cells showing the highest proliferation. The middle lanes show the effect of adding CD8+ T cells, with no significant inhibition of proliferation if cells are from naive mice (Fig. 2Bc), but significant suppression if cells are from tolerized mice activated in vitro with pCons (Fig. 2Bd, p < 0.001 compared with Fig. 2Bc by unpaired Students t test). No suppression was observed if the tolerized CD8+ T cells were incubated with either pNeg or p93 (Fig. 2Be, data combined for the two control peptides). In the final lane of this group (f), the suppression of proliferation by tCD8 is abrogated by inhibition of Foxp3. In the third group, we show the effect of tCD8+ cells on CD4+ T and B cells from tolerized mice. The tCD4+ T cells in combination with tB cells (Fig. 2Bg) show proliferation similar to that of naive CD4+ T plus B cells (Fig. 2Bb). Addition of tolerized CD8+ T cells activated by pCons suppresses proliferation (Fig. 2Bh, p < 0.05 compared with Fig. 2Bg). The ability of tCD8+ T cells to suppress proliferation in tolerized CD4 cells is abrogated by preincubation of tCD8+ cells with siRNA for Foxp3 (Fig. 2Bi).
|
We then addressed the question of inhibition of proliferation being an effect of tCD8+ cells on nCD4+ T cells, because CD8+ T have some proliferative capacity, and CD8+ T were not irradiated in previous experiments. CD4+ T cells were treated with CFSE, then added to cultures containing naive B and tCD8+ T cells or naive B and naive CD8+ T cells, which were cocultured for 72 h. Results are shown in Fig. 2D. Dilution of the CFSE (CD4 proliferation) was prevented by addition of tCD8+ T cells, but not naive CD8 (Fig. 2D). We conclude from all these data that CD4+ T cells are one target of the CD8+ T cells from tolerized mice, with their proliferation impaired in the presence of tCD8+ T cells in vitro.
The suppression mediated by CD8+ Ti is long lasting
We next explored the duration of the suppressive effect of CD8+ Ti after a single injection of pCons. We compared the suppressive capacity of CD8+ Ti in pools of spleen cells isolated 12, 34, or 68 wk after inoculation. As shown in Fig. 3, at 1 wk, suppression of proliferation of naive CD4+ B cells was found in three of four cell pools; at 34 wk in three of five; and at 68 wk in one of five. Thus, tolerance occurs in most, but not all mice after one injection, and wanes over time. Similar results were found in suppression of anti-DNA production by CD8+ Ti (data not shown).
|
in CD8+ Ti
Because the suppressive capacity of all CD8+ Ti seems to depend on Foxp3 expression in our system, we examined the expression of Foxp3 in CD28+ and CD28 subsets of CD8+ T cells studied ex vivo from spleens of tolerized mice and we explored regulation of Foxp3 by TGF-
. Results are shown in Fig. 4. In Fig. 4A, each bar shows the mean of 312 experiments, comparing fold changes of mRNA for Foxp3 in cell subsets from tolerized mice with the same subsets from naive mice. Mean fold changes varied from 1 to 7, with elevations being higher in CD28CD8+ cells compared with CD28+CD8+ cells at early time points. Foxp3 was elevated from 14 wk after a single treatment with pCons in CD28CD8+ T cells (Fig. 4A, lanes 2 and 4), and the increases returned to baseline by 68 wk (lane 6, p < 0.01 compared with lane 2). In CD28+CD8+ T cells, elevations of FoxP3 were apparent at 12 wk (lane 1), close to normal at 34 wk (lane 3), and normal at 68 wk (lane 5). At all times, Foxp3 levels were elevated; they were higher in CD28 than in CD28+ cells. In Fig. 4B, the mean ratio of relative value units for both Foxp3 and TGF-
, comparing tolerized with naive mice, is shown over time for CD28 and CD28+ subsets of CD8+ T cells (reflecting splenic CD8+ cells obtained ex vivo 1 wk after tolerization). Levels of TGF-
rose 9-fold in CD28+CD8+ cells (left panel) and 16-fold in CD28CD8+ T cells (right panel) by 12 wk after tolerization, then fell toward normal, although they did not reach baseline in CD28 cells at 68 wk. Foxp3 levels increased
2- to 3-fold in both cell subsets at 12 wk, then fell to baseline in CD28+ T cells, but continued to rise in CD28 T cells until 68 wk, when all returned to baseline. In Fig. 4C, dose response to TGF-
is shown in cultures containing naive B, naive CD4+, and tolerized CD8+ T cells (medium enriched with rIL-2) plus pCons. Results in the cultures without TGF-
are set to 1.0. RNA harvested from this cell combination showed up-regulation of Foxp3 expression after in vitro addition of TGF-
in a dose-response manner. In experiments shown in Fig. 4D, CD8+ T cells from tolerized mice were cultured with pCons in IL-2-containing medium, with or without TGF-
. Ratio of Foxp3 to GAPDH in the cells without TGF-
was set at 1.0. The addition of TGF-
increased expression of Foxp3 mRNA 15-fold in CD8+ T cells from tolerized mice (lane 2). The effects of TGF-
on the expression of Foxp3 mRNA in naive CD8+ T cells were also measured before and after incubation with TGF-
. Relative expression of Foxp3 in naive cells was 0.4 compared with tolerized cells (compare lane 3 with lane 1). Expression of Foxp3 mRNA was increased 3-fold after incubation of the naive cells with TGF-
. Thus, TGF-
increases Foxp3 expression in both tolerized and naive cells, but more dramatically in the tolerized CD8+ T cells. Finally, data shown in Fig. 4E show that the protein expression of Foxp3 is up-regulated in cells in which mRNA is up-regulated. In this study, we show the mean fluorescence intensity for labeled Foxp3 expression in cells studied by FACS, gated on CD8. Overall, the data in Fig. 4 show that TGF-
can increase the already up-regulated expression of Foxp3 mRNA in either tolerized CD8+ T cells, in both CD28+ and CD28 subsets of tCD8+ T cells, or in the mRNA from combinations of those cells with other lymphocytes.
|
(8). Although it is well known that TGF-
is one cytokine that regulates Foxp3 expression in CD4+ T cells (20, 21, 22, 23), there is little information on whether Foxp3 influences TGF-
production. In the experiments shown in Fig. 5, we asked whether Foxp3 inhibition by siRNA influenced the ability of CD8+ Ti to secrete TGF-
. In Fig. 5A, cells were cocultured as indicated on the x-axis for 48 h, and the secretion of TGF-
into the culture medium was measured by ELISA. Naive BWF1 CD4+ T cells (Fig. 5Ab) secreted TGF-
at a mean level of
1000 pg/ml. There was little secretion by CD8+ T cells from naive mice (Fig. 5Ac), but high secretion by CD8+ T cells from tolerized mice (Fig. 5A, d compared with c, p < 0.009 by one-tailed Students t test). In the group of
secretion. Secretion was high by cultures containing either nCD8 or tCD8 (Fig. 5A, e and f); however, when cultures were treated with siRNA for Foxp3 (Fig. 5Ag) secretion of TGF-
was significantly reduced (Fig. 5A, compare g with f, p < 0.009). In contrast, transfection with siRNA for p53 did not suppress TGF-
secretion (Fig. 5A, h, not significantly different from e or f). These data strongly suggest regulation of TGF-
by Foxp3 in the CD8+ T cells generated in our tolerance model. To confirm that the relation between TGF-
production and Foxp3 applied to CD8+ T cells in isolation from the other cells, CD8+ T cells from tolerized or naive mice were isolated from spleens 1 wk after tolerization, and their ability to secrete TGF-
was determined after 48-h culture. The tolerized CD8+ T cells (Fig. 5Bb) secreted
600 pg/ml TGF-
, but that secretion was suppressed significantly by pretreatment of the cells with siRNA for Foxp3 before addition to culture (Fig. 5Bc, p < 0.01 compared with Fig. 5Bb). In contrast, pretreatment of tCD8+ cells with siRNA for p53, GAPDH, or scrambled sequence did not impair TGF-
production (Fig. 5B, df). These data confirm a link between expression of Foxp3 and the ability of tCD8+ T cells to secrete TGF-
.
|
| Discussion |
|---|
|
|
|---|
This work analyzes some characteristics of the noncytotoxic CD8+ Ti that are induced by pCons, and shows that the transcription factor Foxp3 may regulate the production of TGF-
in these CD8+ Ti. Furthermore, the increased secretion of TGF-
in the CD8+ Ti can be abrogated by disabling Foxp3 via siRNA technology. We also show that these CD8+ Ti can directly suppress the proliferation of CD4+ T cells and subsequent production of anti-DNA by B cells, and that this suppressive capacity of the CD8+ Ti is long lasting (up to 8 wk in some mice).
Several investigators working in other systems, including human CD8+ T cells, have found that CD8+ Ti with a suppressive function can be preferentially associated with a CD28 phenotype (5, 6, 24). In our system, when we separated the CD8+ Ti into CD28+ and CD28 cells, we observed similar suppressive capacity and similar production of TGF-
in both the CD28+ and CD28 subpopulations (Figs. 2C and 4, A and B). Of note, however, Foxp3 mRNA expression was increased to higher levels in the CD28CD8+ T cell compartment and persisted for longer periods of time than in the CD28+CD8+ T cells (Fig. 4B). Furthermore, these kinetics were similar to those for production of TGF-
(Fig. 4B). This suggests the possibility of an influence of TGF-
on Foxp3 expression (similar to that observed in the case of Treg cells) that was higher and sustained longer in the CD28 T cells than in the CD28+ T cells in our system.
For many years it has been known that oral tolerance depends in part on the induction of CD4+ T cells that secrete TGF-
(25). In many systems, TGF-
, either secreted or membrane bound, is a key molecule for the ability of Treg or CD8+ Ti to regulate organ-specific or systemic autoimmunity (26, 27, 28). It has also been known that TGF-
, in the presence of IL-2, can induce Foxp3 expression and can convert nonregulatory CD4+CD25 T cells to Treg (21, 22, 23). Moreover, in peripheral CD4+CD25 T cells, exposure to IL-4 and IL-13 can also generate Ag-specific Foxp3+ Treg (29). In addition, tolerized APCs, including dendritic and endothelial cells (i.e., suboptimally stimulated or chemically altered), also drive the induction of Foxp3-expressing Treg cells that secrete TGF-
(5, 6). Conversely, a deficiency of the E3 ubiquitin ligase Cbl-b, which plays a role in regulating T cell signaling through CD28, can prevent the TGF-
-mediated induction of Foxp3+ in the Treg (via reduced Smad 2 phosphorylation) (30). In our system of immune tolerance, it is likely that TGF-
secretion is not the only factor that suppresses autoreactivity, because CD4+ T cells that give help to B cells also secrete abundant quantities of that cytokine (Fig. 5A).
Foxp3 is a member of the forkhead/winged helix family that functions as a transcriptional repressor (31, 32). Mice with mutations in the Foxp3 gene or with a genetic deficiency of Foxp3 develop lymphoproliferation and autoimmunity, probably because of a lack of Treg cells (32, 33, 34, 35, 36). In humans, mutations of the FoxP3 gene also cause defective Treg function and autoimmune manifestations (37, 38, 39). Although the role of Foxp3 in the mechanisms of suppression has been an object of intense investigation in Treg cells (9, 10, 20, 21, 22), recently it has been recognized that Foxp3 expression can also occur in CD8+ T cells. Up-regulation of Foxp3 in CD8+ Ti has been described both in rodents and in humans (5, 6, 40, 41). In our studies, the expression of Foxp3 and its apparent regulation by TGF-
in CD8+ Ti are remarkably similar to that observed in CD4+ Treg cells. There are molecular themes that characterize suppressor cells with different surface and cytoplasmic phenotypes. Major molecular markers of Treg cells, such as Foxp3, glucorticoid-induced TNFR-related protein CTLA-4, OX40, CD103, 41BB, and TNFR2, can also be found in CD8+CD28 Ti (which, like the pCons-induced CD8+ Ti, are Ag specific and suppress via secretion of cytokines) (41). In our system, we have only examined Foxp3 in the CD8+ Ti; studies of the other molecules are in progress. Our data show a central role of Foxp3 (which can be up-regulated by TGF-
). Foxp3 may also regulate the production of TGF-
in the CD8+ Ti, a novel finding to the best of our knowledge. Current studies are now investigating whether Foxp3 may create an autocrine loop for the regulation of TGF-
mRNA expression, to ultimately establish the basis of the molecular interactions, which allow Foxp3 to influence production of TGF-
.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants AI 46776 (to B.H.H.) and AI63515 and AR53239 (to A.L.), awards from Skirball (to B.H.H. and A.L.), the Tina C. Foundation (to B.H.H. and R.P.S.), and gifts from the Horchow Family Foundation and Jeanne Rappaport. ![]()
2 Address correspondence and reprint requests to Dr. Bevra H. Hahn, Division of Rheumatology, University of California, 1000 Veteran Avenue, Los Angeles, CA 90095. E-mail address: bhahn{at}mednet.ucla.edu ![]()
3 Abbreviations used in this paper: Ti, inhibitory T cell; nCD, naive CD; pCons, pConsensus; siRNA, small interfering RNA; tCD, tolerized CD; Treg, T regulatory. ![]()
Received for publication September 20, 2006. Accepted for publication March 1, 2007.
| References |
|---|
|
|
|---|
-secreting CD8+ T cell suppressors. J. Immunol. 175: 7728-7737.
-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155: 1151-1164. [Abstract]
. Proc. Natl. Acad. Sci. USA 103: 8810-8815.
-mediated suppression by CD4+CD25+ T cells is facilitated by CTLA-4 signaling. J. Immunol. 177: 2331-2339.
regulates the CD4+CD25+ T-cell pool and the expression of Foxp3 in vivo. Int. Immunol. 16: 1241-1249.
induces Foxp3+ T-regulatory cells from CD4+CD25 precursors. Am. J. Transplant. 4: 1614-1627. [Medline]
. J. Immunol. 174: 1446-1455.
requires CTLA-4 early after T cell activation to induce FoxP3 and generate adaptive CD4+CD25+ regulatory cells. J. Immunol. 176: 3321-3329.
express FoxP3 and mediate linked suppression of primary immune responses and cardiac allograft rejection. Int. Immunol. 18: 1549-1562.
-producing T cells infiltrating the growing tumor: influence of tumor environment on the induction of CD4+ and CD8+ regulatory T cells. J. Immunol. 177: 896-904.
-chain-binding cytokines, IL-4 and IL-13, induce forkhead box P3-expressing CD25+CD4+ regulatory T cells from CD25CD4+ precursors. J. Immunol. 175: 6107-6116.
sensitivity in vitro and in vivo. J. Immunol. 176: 1316-1320. This article has been cited by other articles:
![]() |
R. P. Singh, A. La Cava, and B. H. Hahn pConsensus Peptide Induces Tolerogenic CD8+ T Cells in Lupus-Prone (NZB x NZW)F1 Mice by Differentially Regulating Foxp3 and PD1 Molecules J. Immunol., February 15, 2008; 180(4): 2069 - 2080. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||