The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 178: 7649-7657.
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Singh, R. P.
Right arrow Articles by Hahn, B. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Singh, R. P.
Right arrow Articles by Hahn, B. H.

CD8+ T Cell-Mediated Suppression of Autoimmunity in a Murine Lupus Model of Peptide-Induced Immune Tolerance Depends on Foxp3 Expression1

Ram Pyare Singh, Antonio La Cava, Maida Wong, Fanny Ebling and Bevra H. Hahn2

Division of Rheumatology, Department of Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Systemic lupus erythematosus is an autoimmune disease caused by autoantibodies, including IgG anti-DNA. New Zealand Black/New Zealand White F1 female mice, a model of spontaneous polygenic systemic lupus erythematosus, tolerized with an artificial peptide (pConsensus) based on anti-DNA IgG sequences containing MHC class I and class II T cell determinants, develop regulatory CD4+CD25+ T cells and CD8+ inhibitory T cells (CD8+ Ti), both of which suppress autoantibody production. CD8+ Ti inhibit primarily via secretion of TGF-beta. In the present study, we show that the inhibitory function of CD8+ T cells from tolerized mice is sustained for up to 8 wk and at all times depends on expression of Foxp3. Both CD28-positive and CD28-negative CD8+ T cells contain inhibitory cells, but the expression of mRNA for Foxp3 and for TGF-beta is higher and lasts longer in the CD28 subset. In vitro addition of TGF-beta (in the presence of IL-2) induces Foxp3 expression in a dose-response manner. Gene inhibition or blockade with small interfering RNA of Foxp3 abrogates the ability of the CD8+ Ti to inhibit anti-DNA production and the proliferation of CD4+ Th cells. Moreover, a significant correlation between expression of Foxp3 and ability of CD8+ Ti to secrete TGF-beta is observed. Therefore, CD8+ Ti in this system of tolerance are similar to CD4+CD25+ regulatory T cells in their dependence on expression of Foxp3, and there may be a bidirectional Foxp3/TGF-beta autocrine loop that determines the ability of the CD8+ T cells to control autoimmunity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The discovery of T cells that can suppress autoimmunity (1) suggested that induction of such cells might be used to control diseases mediated by pathogenic T cells or by Th cell interactions with B cells that produce pathogenic autoantibodies. Multiple T cell types that mediate suppression have been described. They include CD8+ T cells that are not cytotoxic (2, 3, 4, 5, 6, 7, 8), CD4+CD25+ regulatory T cells that suppress Th cells via cell contact (1, 9, 10, 11, 12), and CD4+ T cells that suppress via secretion of cytokines, including TGF-beta and IL-10 (13, 14, 15). The power of these cells to prevent, delay, or suppress established autoimmunity has been demonstrated in many animal models, including experimental allergic encephalomyelitis (3, 14, 15), experimental autoimmune orchitis (4), and murine systemic lupus erythematosus (7, 8, 11, 12, 13). In the work described in this study, we studied the characteristics of one group of inhibitory T cells (Ti),3 CD8+ Ti, which we have previously shown are induced in vivo after administration to New Zealand Black/New Zealand White F1 female (BWF1) mice of a peptide based on amino acid sequences within the VH region of murine Abs to DNA. That peptide, called pConsensus (pCons), contains MHC class I- and class II-binding T cell determinants (16, 17). Administration of pCons in a tolerogenic regimen to premorbid BWF1 female mice, a model of polygenic spontaneous systemic lupus erythematosus-like disease mediated in part by pathogenic IgG Abs to dsDNA, resulted in significant delay of both autoantibody production and nephritis, and substantially prolonged survival (16). The immune mechanisms elicited by pCons in tolerized BWF1 mice are complex and include induction of hyporesponsiveness in the CD4+ Th cells (11), induction of peptide-binding pCons-reactive CD4+CD25+ T regulatory (Treg) cells that inhibit anti-DNA via cell contact with the effector cells (11), and induction of CD8+ Ti that inhibit anti-DNA production via secretion of TGF-beta (8).

We have previously shown that aging BWF1 mice develop abnormalities in their CD8+ T cell compartment (2), including inability to proliferate and apoptotic rather than activation responses to TCR stimulation. In this study, we show that after tolerization with pCons, BWF1 CD8+ Ti with both CD28+ and CD28 phenotypes can suppress CD4+ T cell proliferation and anti-dsDNA IgG production. Within both the CD28+ and CD28 Ti subsets, expression of the suppression-related transcription factor Foxp3 is increased and remains elevated for at least 3–4 wk. Concomitantly, secretion of TGF-beta increases in both subsets of CD8+ Ti. Moreover, the ability of both CD28+ and CD28 Ti to suppress in vitro can be fully inhibited by blockade of Foxp3 via small interfering RNA (siRNA) technology.

The data suggest that these CD8+ Ti are somewhat similar to CD4+CD25+ Treg in that their suppressive capacities are associated with the expression of Foxp3, which can be up-regulated by TGF-beta and IL-2.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

New Zealand Black (H-2d/d), New Zealand White (H-2z/z), and (NZB x NZW)F1 (H-2d/z) mice were bred and maintained at the University of California or purchased from The Jackson Laboratory. Mice were treated in accordance with the guidelines of the University of California Animal Research Committee, an Institution accredited by the Association for Assessment and Accreditation of Laboratory Animal Care. All experiments were conducted in female mice.

Peptides

The tolerizing peptide, pCons (FIEWNKLRFRQGLEW), is an artificial peptide designed to contain I-Ed-binding and Kd-binding T cell determinants identified in several different J558 VH regions of anti-dsDNA Ig of BWF1 mice (16, 17, 18, 19). The negative control peptides pNeg and p93 are nonstimulatory and nontolerogenic. PNeg is artificial and designed to contain an I-Ed-binding T cell determinant that is not stimulatory. P93 is a wild peptide, a 15-mer beginning at position 93 in the VH molecule of a BWF1 mAb anti-DNA. A positive control peptide, p33b, is a wild peptide from VH of a BWF1 mAb anti-DNA: it binds I-Ed and can induce proliferation in BWF1 CD4+ T cells. Peptides were synthesized at Chiron Biochemicals, purified to single peak on HPLC, and analyzed by mass spectroscopy for expected amino acid content.

Treatment of mice

For tolerance induction, 10- to 12-wk-old BWF1 mice received a single i.v. dose of 1 mg of pCons, as reported previously (8, 11). In some experiments, mice were treated with pNeg or p93 as negative controls.

Cell isolation and staining

At various times after administration of peptide, single-cell suspensions of splenocytes were prepared by passing cells through a sterile wire mesh. After lysis of RBC with ACK lysing buffer (Sigma-Aldrich), cells were centrifuged and washed before resuspension in HL-1 medium (BioWhittaker). In experiments involving whole cell populations, CD4+, B, and CD8+ T cells were isolated by positive selection on an AutoMACS system (Miltenyi Biotec) and found >95% pure by subsequent FACS analysis. In experiments studying CD28+ or CD28 CD8+ T subsets, cells were sorted into these populations by FACS or isolated via magnetic beads. Such cells maintained good viability (85% or better by FACS analysis using 7-aminoactinomycin D staining to identify dead cells) and were at least 90% pure. We have previously shown that positive and negative selection of CD8+ T cells gave similar functional and molecular results (8). Abs used to analyze the cells included anti-Thy1.2, anti-CD8, and anti-CD28 (all from BD Pharmingen).

FACS analysis

Phenotypic analysis of splenocytes from untreated and pCons-tolerized mice was performed with a FACSCalibur flow cytometer (BD Biosciences) using either CellQuest (BD Biosciences) or FCS Express software (De Novo Software). Staining with multiple combinations of Ab (indicated in the pertinent sections) was performed according to standard procedures described elsewhere (11). Staining with annexin V and with 7-aminoactinomycin D was used to distinguish cells undergoing apoptosis from dead cells. The Ab used were all purchased from BD Pharmingen.

Intracellular staining

For intracellular staining, cells were first stained for expression of cell surface markers and then fixed, permeabilized, and stained using the Cytofix/Cytoperm kit (BD Pharmingen), according to the manufacturer’s instructions. Intracellular TGF-beta and Foxp3 were identified in cells that had been fixed and permeabilized by staining with the appropriate Abs.

Cell cultures

Methods have been described previously (8, 11). In brief, purified CD4+ T cells from young naive BWF1 females and B cells from older naive BWF1 females with high titers of anti-DNA in serum were cultured with or without addition of CD8+ T cells from naive or tolerized mice (harvested at various times from 1 to 8 wk after tolerization) in 24-well microtiter plates at 37°C in complete medium containing antibiotics and 10% FCS. To activate the CD8+ T cells from tolerized mice, pCons peptide was added to cultures at 20 µg/ml concentrations, unless otherwise stated in the figure legends. Ratios used were 10 CD4+ T cells to 1 B cell; CD8+ T cells were added at a ratio of 1 CD8+ to 1 CD4+ T cell. Cells were cocultured for 5 days in experiments for anti-DNA production, for 48 h in experiments measuring cytokine production, and for 72 h in studies measuring cell proliferation. In some experiments, CD8+ T cells were cultured with addition of TGF-beta (20 ng/ml), and medium was enriched with rIL-2 (10 ng/ml) to study up-regulation of FoxP3.

Measurement of anti-DNA and cytokines in supernatants of cell cultures

IgG anti-DNA was measured in concentrated cell culture supernatants with BD OptEIA ELISA kits (BD Biosciences). Cytokine measurement in the supernatant of cultured spleen cells was done with BD OptEIA ELISA kits (BD Biosciences) for TGF-beta1.

Measurement of cell proliferation

Spleen cells were isolated from BWF1 mice at various times, as described in figure legends, after a single injection of pCons. RBC were removed by RBC lysing solution (Sigma-Aldrich). B220+ B cells, CD4+, and CD8+ T cells were isolated and cultured in triplicate in 96-well plates containing varying amounts of CD8+ Ti, 1 x 105 CD4+, and 2 x 105 irradiated or nonirradiated B cells cultured in medium containing murine rIL-2 for 96 h and pulsed with 0.5 µCi/well [3H]thymidine during the last 18 h of culture. Incorporation of tritiated thymidine into DNA was assessed by liquid scintillation counting in an automated counter (Beckman Coulter). Results are expressed as mean stimulation index or mean cpm ± SE and represent the average cpm of triplicate determinations.

Real-time PCR

Quantitative real-time reverse transcription was performed using TaqMan technology on an ABI Prism 7900 HT Sequence Detection System (Applied Biosystems). TaqMan RT-PCR mix was used for the RT-PCR, following the manufacturer’s instructions. Reverse transcription used 50 ng of total RNA. Total RNA was isolated with TRIzol (Invitrogen Life Technologies), per manufacturer’s protocol. The oligonucleotide sequences used for the primers and TaqMan probes are as follows: TGF-beta forward, 5'-AAACGGAAGCGCATCGAA-3'; reverse, 5'-GGGACTGGCGAGCCTTAGTT-3'; probe 6FAM, CCATCCGTGGCCAGATCCTGTCC TAMRA. Foxp3 forward, 5' TGCAGGGCAGCTAGGTACTTGTA 3'; reverse, 5' TCTCGGAGATCCCCTTTGTCT 3'; and probe 6FAM, TCCGAACAGCATCATCCTTCTTAGCATCC TAMRA. The amplification primers were at 900 nM, and the probe was at 200 nM. A passive reference dye (ROX) provided an internal standard for normalization of FAM fluorescence, correcting for fluctuations due to volume changes. For relative quantitation, a standard curve was constructed for each primer and probe set, using total RNA. RNA was isolated from spleen cells of 10- to 13-wk-old naive or tolerized mice. Spleen cells from two to three mice in each group were pooled for each experimental group; usually two or more such pools were studied from each group simultaneously. For some experiments, CD4+ and CD8+ T cells isolated by positive selection were used for normalization purposes. The possibility of genomic DNA contamination was excluded by use of no reverse-transcriptase controls in combination with ribosomal primers. GAPDH was used as endogenous control in each experimental set for normalization. A ribosomal RNA control primer and probe set was used as indicated in the figure legends.

siRNA transfection

CD8+ T cells isolated as described above were plated and cultured in 24-well plates for 24 h in complete medium containing 10% FCS. For transfection, we used the Silencer siRNA Transfection kit from Ambion, which uses lipofection for transfection of siRNA into cells. In some experiments, OptiMEM-reduced serum medium (Invitrogen Life Technologies) was used to dilute the siPORT amine. Validated siRNA of FoxP3, CCR7, p53, and GAPDH was obtained from Ambion, as well as positive and negative siRNA controls. The negative control siRNA was a scrambled sequence that bears no homology to human, mouse, or rat genomes. The transfection agent alone served as another control (siPORT amine). The agent was mixed with siRNA of Foxp3, p53, CCR7, or GAPDH (50–100 nM), or controls in serum-free medium and incubated at room temperature for 30 min. Cells were transfected with siRNA complexes by overlaying siRNA dropwise onto the cells. After 8–10 h, medium was removed and fresh medium (1–2 ml) was added. Viability was assayed with trypan blue staining. After 48 h of culture, transfected CD8+ T cells were transferred to cultures of fresh BWF1 CD4+ T cells plus B cells plus pCons for measurement of suppression of anti-DNA production or for cell proliferation. Some transfected cells were lysed with cell lysing solution (Invitrogen Life Technologies), and RNA was isolated for real-time PCR, to validate knockdown of the target gene. We have previously shown that this method knocks down all expression of Foxp3 (8).

Statistical analyses

Statistical analyses were performed using Prism 4 software (GraphPad). Comparisons between two groups were performed by one-tailed Student’s t test or by the Mann-Whitney U test. Nonparametric testing among more than two groups was performed by one-way ANOVA. Data in each cell of data were then compared by posttest analysis using Tukey’s multiple comparison test. Values of p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Blockade of Foxp3 abrogates the suppression of anti-DNA IgG production, and this effect lasts several weeks

Having shown that CD8+ Ti induced by pCons express Foxp3 (8), we asked whether silencing of Foxp3 abrogates the suppression of IgG anti-DNA production that occurs when CD8+ Ti are added to cultures containing naive CD4+ T and B cells, and whether Foxp3 controls the suppressive effects of CD8+ Ti over time. Characteristics of spleen cells harvested 1 wk after tolerization are shown in Fig. 1A, with results grouped. The left group shows baseline measures of anti-DNA production by naive CD4+ T cells (Fig. 1Aa), then by naive B cells (Fig. 1Ab), with addition of naive CD8+ T cells (Fig. 1Ac), and finally suppression by addition of tolerized CD8+ T cells activated by pCons (Fig. 1Ad) (p < 0.05 compared with Fig. 1Ac by Mann-Whitney U test). In the second group there are the data for abrogation of suppression by siRNA for three genes that are up-regulated in tolerized (t)CD8+ T cells compared with normals (R. Singh, submitted for publication). Suppression was maintained if tolerized (t)CD8+ T cells before coculture were treated with siRNA for p53 (Fig. 1Ae) or CCR7 (Fig. 1Af). However, treatment with siRNA for Foxp3 (Fig. 1Ag, p < 0.05 vs Fig. 1Ad), or siRNA for Foxp3 combined with siRNA for p53 and CCR7 abrogated suppression (Fig. 1Ah, p < 0.03 compared with Fig. 1Ad). The combination of siRNA for p53 and CCR7 did not inhibit the ability of tCD8+ T cells to inhibit anti-DNA production (data not shown). In the third group, there are results of pretreating tCD8+ T cells with control siRNA, including a scrambled sequence, the polyamine transfection medium, and siRNA for GAPDH (Fig. 1A, i, j, and k). None of these controls abrogated the suppressive capacity of tCD8+ T cells. In the last group of lanes are shown the peptide dose response and the specificity data. When no peptide was in the culture (Fig. 1A, l and o), there was no suppression. At 20 µg/ml (Fig. 1Am), the peptide pCons induced suppression by the CD8+ Ti (p < 0.007 by Student’s t test, Fig. 1A, comparing l with m). At 100 µg/ml pCons, there was toxicity to the cells (indicated by trypan blue stain with >90% of the cells dead), and production of anti-DNA was baseline (Fig. 1An, compare with Fig. 1Aa). Finally, the p-Cons-induced tCD8+ T cells could not suppress anti-DNA production when stimulated by p33b at 20 µg/ml (Fig. 1Ap). p33b is a control wild VH peptide that binds I-Ed and can induce T cell activation in BWF1 mice. At 100 µg/ml, the peptide p33b was toxic to cells (Fig. 1Aq).


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 1. A, Suppression of anti-DNA production by tCD8 cells harvested 1 wk after administration of pCons; abrogation of that suppression by treatment of tCD8 with siRNA for Foxp3, and dose-response curve for pCons peptide. Positively isolated splenic naive B, naive CD4+ T, and naive or tolerized CD8+ T populations were cocultured at 1:1 ratios of CD8 to CD4 and 10:1 ratios of CD4 to B cells, in the presence of pCons. After 5 days, anti-DNA was measured in concentrated supernatants by ELISA. OD were converted to units by defining a positive BWF1 serum control as 100 U and a negative control as 10 U. Data shown are means ± SEM of five experiments. The first group shows suppression of anti-DNA by tCD8. Aa, Shows anti-DNA production by isolated naive CD4+ T cells; Ab, shows production by isolated naive (n) B cells. Cocultures of nCD4+ T, nB, and nCD8+ T cells (nCD8) from naive mice are shown in Ac, and anti-DNA production is high (p < 0.01, comparing Ac with Ab; Tukey’s posttest). Ad, Shows significant suppression of anti-DNA production when the CD8+ T cells are from mice tolerized 1 wk earlier with pCons (tCD8; p < 0.05 comparing Ad with Ac). In A, e and f, suppression by the tCD8+ cells is not abrogated by incubating them with siRNA for p53 (Ae) or siRNA for CCR7 (Af). Neither Ae nor Af is significantly different from Ad. In contrast, pretreatment of tCD8 with siRNA for Foxp3 (Ag) or a combination of siRNA for Foxp3, p53, and CCR7 (Ah) increased anti-DNA production, indicating significant difference from Ae (p < 0.05 by Tukey’s posttest). In the third group of lanes (i–k), we show the siRNA controls as follows: tCD8 were preincubated with scrambled siRNA, the polyamine transfection medium, and siRNA for GAPDH. Suppression was present in all of these cultures. These data suggest that Foxp3 activity is necessary for most of the suppressive capacity of the tCD8+ T cells. The fourth group (l–n) shows the dose response for pCons added to cultures of nCD4+nB+tCD8. Addition of 20 µg/ml pCons activated the suppressive capacity of the cells (5% of cells failed to exclude trypan blue); 100 µg of pCons was toxic to cells, indicated by >90% of cells failing to exclude trypan blue and low anti-DNA production (n). The fifth row of lanes shows absence of a dose response to a control peptide p33b, which is a wild peptide from the VH of a mAb anti-DNA that binds I-Ed and can induce BWF1 T cells to proliferate (A, o–q). There was no suppression of anti-DNA production when tCD8 were incubated with 0 or 20 µg/ml p33B instead of with pCons. Again, 100 µg/ml peptide was toxic to cells. ANOVA analysis of all bars showed highly significant differences, p < 0.001. B, Suppression of anti-DNA by tCD8+ T cells is still demonstrable at 3–4 wk after tolerization. Mean ± SEM of five experiments in each group is shown. Presentation is similar to that in A. tCD8 were harvested from spleens of mice treated once 3–4 wk earlier with pCons, and those cells were added to cocultures with naive CD4 and naive B cells (except where nCD8 or no CD8 were added; B, a–d). The first group are controls and show that CD4 plus B made the highest anti-DNA (Bc), with addition of nCD8 producing nonsignificant suppression of anti-DNA production. In contrast, adding tCD8+ T cells activated by pCons in the culture suppressed anti-DNA production significantly (compare Be and Bc, p < 0.03 by unpaired Student’s t test). In the second set of lanes are shown the effects of preincubating tCD8 cells with siRNA for various molecules. There is no effect on suppression with siRNA for p53 and CCR7 (B, f and g), but siRNA for Foxp3 abrogates the suppressive capacity of the CD8+ T cells (compare Bh and Bi with Be, p < 0.05 for each). In the last group on the right are shown control siRNA for GAPDH and scrambled sequence of GAPDH (B, j and k), which do not affect suppression (compare with Be; differences not significant). ANOVA analysis of all the lanes shown in this graphic indicates significant differences as follows: p < 0.006.

 
In Fig. 1B, a similar experiment is performed with CD8+ Ti harvested 3–4 wk after tolerization with pCons. The bars are grouped as in Fig. 1A. Suppression is present when tCD8+ T cells activated by pCons are added (Fig. 1B, e compared with c, p < 0.03). Suppression is again abrogated by silencing of Foxp3 (Fig. 1B, compare h with e or f, p < 0.01), but not silencing of p53 or CCR7 (Fig. 1B, f and g compared with e). Again, siRNA for Foxp3 in combination with other siRNA abrogated the ability of the tCD8 Ti to suppress anti-DNA production (Fig. 1B, i vs e or f, p < 0.05). Control siRNA are shown in the last lanes.

CD8+ Ti suppress proliferation of CD4+ Th cells, and this effect needs the expression of Foxp3

Next, we asked whether CD8+ Ti could suppress proliferation of naive CD4+ T cells, the cells usually considered to be the major target of CD8+ Ti. CD8+ T cells from naive or tolerized BWF1 mice (harvested 1 wk after tolerization) were added to cultures of naive CD4+ T plus naive irradiated B cells (as APCs) from young naive BWF1 females, and proliferation was measured 72 h later. In Fig. 2A, the dose-response curve for the ability of pCons to activate suppression by tCD8+ T cells is shown. Asterisks indicate statistically significant differences from the 500 ng/ml concentration, p < 0.05 for 10, 20, and 50 µg/ml. A total of 100 µg/ml is toxic to the cells, and 20 µg/ml was chosen as the concentration of pCons to activate tCD8+ T cells in the following experiments. Data are grouped in Fig. 2B. The left lanes (Fig. 2B, a and b) show proliferation in naive (n) cells, with nCD4 plus B cells showing the highest proliferation. The middle lanes show the effect of adding CD8+ T cells, with no significant inhibition of proliferation if cells are from naive mice (Fig. 2Bc), but significant suppression if cells are from tolerized mice activated in vitro with pCons (Fig. 2Bd, p < 0.001 compared with Fig. 2Bc by unpaired Student’s t test). No suppression was observed if the tolerized CD8+ T cells were incubated with either pNeg or p93 (Fig. 2Be, data combined for the two control peptides). In the final lane of this group (f), the suppression of proliferation by tCD8 is abrogated by inhibition of Foxp3. In the third group, we show the effect of tCD8+ cells on CD4+ T and B cells from tolerized mice. The tCD4+ T cells in combination with tB cells (Fig. 2Bg) show proliferation similar to that of naive CD4+ T plus B cells (Fig. 2Bb). Addition of tolerized CD8+ T cells activated by pCons suppresses proliferation (Fig. 2Bh, p < 0.05 compared with Fig. 2Bg). The ability of tCD8+ T cells to suppress proliferation in tolerized CD4 cells is abrogated by preincubation of tCD8+ cells with siRNA for Foxp3 (Fig. 2Bi).


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 2. A, A dose-response curve for pCons is shown, indicating the need to activate tCD8+ T cells with pCons in order for them to suppress proliferation of CD4+ T plus B cells. Naive CD4+ T and B cells were isolated from spleens and coincubated with tCD8+ T cells in the presence of various concentrations of pCons (shown per ml of total volume). The cpm is shown on the y-axis. There was good proliferation with insignificant quantities of pCons (500 ng/ml, lane 1), and increased suppression at 10–50 µg/ml. Lanes with asterisk are significantly different from lane 1, p < 0.05, by Tukey’s posttest. At 100 µg/ml, the peptide was toxic to cells, with >90% failing to exclude trypan blue. We chose 20 µg/ml for all the subsequent experiments. B, Suppression of proliferation of CD4+ B cells by addition of tolerized CD8+ T cell activated by pCons in the culture medium, but not by naive CD8+ T cells. CD4+ T and irradiated B cells from naive BWF1 females were cocultured with CD8+ T cells from naive or tolerized mice (spleen cells harvested 1 wk after tolerization) plus pCons. Proliferation was measured at 72 h by addition of tritiated thymidine. Results are presented as stimulation indices, setting proliferation in B cells as a stimulation index of 1.0. Mean ± SD are shown for 3–12 experiments for each lane. The negative control lane (Ba) contains B cells alone. Bb, Shows maximal stimulation in cultures of naive CD4+T plus naive irradiated B. In the next group, addition of CD8+ cells incubated with various peptides is shown. Addition of nCD8 (Bc) does not suppress proliferation, whereas addition of pCons-activated tCD8+ suppresses proliferation significantly (compare Bd with Bb, p < 0.01). In contrast, addition of tCD8 coincubated with nonstimulatory control VH peptides (pNeg and p93; Be) does not abrogate proliferation significantly, indicating specificity of the tCD8 for pCons. Preincubation of tCD8+ cells with siRNA for Foxp3 abrogates suppression (compare Bf with Bd, p < 0.05). In the last group, we measure the effect of tCD8 on CD4 and B cells that are also derived from tolerized mice, harvested 1 wk after dosing. Proliferation of tCD4 plus B was similar to that of naive cells (compare Bg with Bb: differences not significant). However, once again the addition of tCD8 suppressed proliferation significantly (compare Bh with Bg, p < 0.02), but preincubation of those tCD8 cells with siRNA for Foxp3 abrogated their suppressive capacity (compare Bi with Bh, p < 0. 05). C, Role of CD28+ and CD28 CD8+ T cells in suppression of CD4+ B cells. The first group of lanes are controls, indicating the ability of tCD8 activated by pCons to suppress proliferation of CD4+ T cells plus irradiated B cells (compare Cb with Ca). The second group shows the capacity of CD8+ T cells positively or negatively isolated for CD28 expression. Naive CD28+CD8+ T cells did not suppress proliferation significantly (compare Cc with Ca; p = NS). However, CD28+CD8+ T cells from tolerized mice could suppress (Cd), as could CD28CD8+ T cells from either naive or tolerized mice (C, d and f). C, d–f, Differ from Ca, p < 0.02–0.05 by Tukey’s comparison of lanes and paired Student’s t tests (Ca vs Cb and Cd, p < 0.005; Ca vs Ce, p < 0.01; Ca vs Cf, p < 0.03). Data shown are mean ± SEM of four experiments. D, CD8+ T cells of pCons-tolerized mice suppress proliferation of CD4+ T cells in vitro. Magnetic bead-sorted CD4+ T cells from naive animals were labeled with CFSE before coculture in the presence of 20 µg/ml pCons peptide, unlabeled B cells, and CD8 T cells from pCons-tolerized mice (right panel) or CD8 T cells from matched untreated controls (left panel). The ratio of CD8 to CD4 to B cell was 10:5:1. After 3 days in culture, cells were harvested and analyzed by flow cytometry for CFSE dilution. Data are representative of two similar experiments.

 
Fig. 2C shows the ability of tCD8+ T cells isolated into CD28+ or CD28 subsets to suppress proliferation of naive CD4 plus irradiated naive B cells. The left lanes show the controls, again indicating the ability of tCD8+ activated by pCons to suppress proliferation (Fig. 2C, compare b with a). If the CD8+ are isolated into CD28+ cells from naive mice, they do not suppress proliferation (Fig. 2Cc). If the CD28+ CD8+ T cells are from tolerized mice, they suppress (Fig. 2Cd, p < 0.05 compared with Fig. 2Ca). Naive CD28 cells can suppress (Fig. 2Ce, p < 0.01 compared with Fig. 2Ca), as can CD28CD8+ T cells from tolerized mice (Fig. 2Cf, p < 0.05 compared with Fig. 2Ca).

We then addressed the question of inhibition of proliferation being an effect of tCD8+ cells on nCD4+ T cells, because CD8+ T have some proliferative capacity, and CD8+ T were not irradiated in previous experiments. CD4+ T cells were treated with CFSE, then added to cultures containing naive B and tCD8+ T cells or naive B and naive CD8+ T cells, which were cocultured for 72 h. Results are shown in Fig. 2D. Dilution of the CFSE (CD4 proliferation) was prevented by addition of tCD8+ T cells, but not naive CD8 (Fig. 2D). We conclude from all these data that CD4+ T cells are one target of the CD8+ T cells from tolerized mice, with their proliferation impaired in the presence of tCD8+ T cells in vitro.

The suppression mediated by CD8+ Ti is long lasting

We next explored the duration of the suppressive effect of CD8+ Ti after a single injection of pCons. We compared the suppressive capacity of CD8+ Ti in pools of spleen cells isolated 1–2, 3–4, or 6–8 wk after inoculation. As shown in Fig. 3, at 1 wk, suppression of proliferation of naive CD4+ B cells was found in three of four cell pools; at 3–4 wk in three of five; and at 6–8 wk in one of five. Thus, tolerance occurs in most, but not all mice after one injection, and wanes over time. Similar results were found in suppression of anti-DNA production by CD8+ Ti (data not shown).


Figure 3
View larger version (9K):
[in this window]
[in a new window]

 
FIGURE 3. Loss of ability of CD8+ T cells from tolerized mice to suppress proliferation of naive T plus B cells from syngeneic mice over time. Each point is one experiment showing the percentage of suppression of proliferation of cultures containing naive CD4 plus naive B cells plus tCD8. Each experiment was conducted in triplicate, and the means of those triplicates are shown. Data show percentage of suppression in individual experiments using CD8+ T cells isolated with AUTOMACS from spleen cells pooled from two to three mice at the times shown after tolerization. Zero suppression is cpm of cultures containing nCD4 plus naive B plus naive CD8+ T cells.

 
Correlation between Foxp3 and TGF-beta in CD8+ Ti

Because the suppressive capacity of all CD8+ Ti seems to depend on Foxp3 expression in our system, we examined the expression of Foxp3 in CD28+ and CD28 subsets of CD8+ T cells studied ex vivo from spleens of tolerized mice and we explored regulation of Foxp3 by TGF-beta. Results are shown in Fig. 4. In Fig. 4A, each bar shows the mean of 3–12 experiments, comparing fold changes of mRNA for Foxp3 in cell subsets from tolerized mice with the same subsets from naive mice. Mean fold changes varied from 1 to 7, with elevations being higher in CD28CD8+ cells compared with CD28+CD8+ cells at early time points. Foxp3 was elevated from 1–4 wk after a single treatment with pCons in CD28CD8+ T cells (Fig. 4A, lanes 2 and 4), and the increases returned to baseline by 6–8 wk (lane 6, p < 0.01 compared with lane 2). In CD28+CD8+ T cells, elevations of FoxP3 were apparent at 1–2 wk (lane 1), close to normal at 3–4 wk (lane 3), and normal at 6–8 wk (lane 5). At all times, Foxp3 levels were elevated; they were higher in CD28 than in CD28+ cells. In Fig. 4B, the mean ratio of relative value units for both Foxp3 and TGF-beta, comparing tolerized with naive mice, is shown over time for CD28 and CD28+ subsets of CD8+ T cells (reflecting splenic CD8+ cells obtained ex vivo 1 wk after tolerization). Levels of TGF-beta rose 9-fold in CD28+CD8+ cells (left panel) and 16-fold in CD28CD8+ T cells (right panel) by 1–2 wk after tolerization, then fell toward normal, although they did not reach baseline in CD28 cells at 6–8 wk. Foxp3 levels increased ~2- to 3-fold in both cell subsets at 1–2 wk, then fell to baseline in CD28+ T cells, but continued to rise in CD28 T cells until 6–8 wk, when all returned to baseline. In Fig. 4C, dose response to TGF-beta is shown in cultures containing naive B, naive CD4+, and tolerized CD8+ T cells (medium enriched with rIL-2) plus pCons. Results in the cultures without TGF-beta are set to 1.0. RNA harvested from this cell combination showed up-regulation of Foxp3 expression after in vitro addition of TGF-beta in a dose-response manner. In experiments shown in Fig. 4D, CD8+ T cells from tolerized mice were cultured with pCons in IL-2-containing medium, with or without TGF-beta. Ratio of Foxp3 to GAPDH in the cells without TGF-beta was set at 1.0. The addition of TGF-beta increased expression of Foxp3 mRNA 15-fold in CD8+ T cells from tolerized mice (lane 2). The effects of TGF-beta on the expression of Foxp3 mRNA in naive CD8+ T cells were also measured before and after incubation with TGF-beta. Relative expression of Foxp3 in naive cells was 0.4 compared with tolerized cells (compare lane 3 with lane 1). Expression of Foxp3 mRNA was increased 3-fold after incubation of the naive cells with TGF-beta. Thus, TGF-beta increases Foxp3 expression in both tolerized and naive cells, but more dramatically in the tolerized CD8+ T cells. Finally, data shown in Fig. 4E show that the protein expression of Foxp3 is up-regulated in cells in which mRNA is up-regulated. In this study, we show the mean fluorescence intensity for labeled Foxp3 expression in cells studied by FACS, gated on CD8. Overall, the data in Fig. 4 show that TGF-beta can increase the already up-regulated expression of Foxp3 mRNA in either tolerized CD8+ T cells, in both CD28+ and CD28 subsets of tCD8+ T cells, or in the mRNA from combinations of those cells with other lymphocytes.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
FIGURE 4. A, Expression of mRNA encoding Foxp3 over time in tCD8+CD28+ T and tCD8+CD28 T cells. Results are expressed as mean ± SEM of fold changes comparing relative values of Foxp3 in cells from tolerized mice with relative values in the same cell subset in naive mice. Relative value units (RVU) were calculated as ratio of Foxp3 to the GAPDH housekeeping gene. Differences between CD28+ and CD28 cells are significantly different at both 1–2 wk (p = 0.009 by Mann-Whitney U test) and 3–4 wk (p < 0.05). Differences are significant between CD28+CD8+ T cells at 1–2 wk and at 6–8 wk (p = 0.05) and between CD28CD8+ cells at 2–3 wk and at 6 wk. Mean of 3–12 experiments in each group is shown. B, The time course of expression of mRNA encoding Foxp3 and TGF-beta over 8 wk after tolerization is shown. The panel on the left shows mRNA for TGF-beta and Foxp3 over time in CD28+CD8+ T cells from tolerized mice. The panel on the right shows the same for CD28CD8+ T cells from tolerized mice. Cells were isolated from spleen at the times specified on the x-axis and studied for mRNA expression without additional culture. Note that both TGF-beta and Foxp3 expression were higher in CD28 than CD28+ CD8+ cells, but that they were elevated at 1–2 wk compared with baseline in both sets of cells. Data points are mean of two to three experiments at each time point, comparing fold increases in mRNA expression in tolerized with those in naive freshly isolated peripheral CD8+ T cells. C, TGF-beta induces Foxp3 expression in a dose-response manner in cultures containing CD8+ T cells from mice tolerized 1 wk earlier coincubated with naive T cells and naive B cells. CD8+ T cells (1 x 106) were cultured for 3 days with and without rTGF-beta (20–40 ng/ml, as indicated on the x-axis) in complete medium with 10% FCS and rIL-2 (10 ng/ml) and with antibiotics. After 3 days, RNA was isolated for real-time PCR analysis. Cells were pooled together from three spleens. Foxp3 mRNA values were normalized to housekeeping gene GAPDH. Data are representative of one of three experiments with similar results. D, TGF-beta induces Foxp3 expression in CD8+ T cells cultured without other cells. Culture conditions as in A. Data are representative of one of three experiments with similar results. The two lanes on the left show increase of Foxp3 mRNA expression when tolerized CD8+ T cells are cultured with TGF-beta. The two lanes on the right show the small increase in Foxp3 that occurs when the CD8+ T cells are from naive mice. Lane 1 vs 2, p < 0.05 by unpaired Student’s t test. E, Protein expression of Foxp3 is increased in tolerized vs naive CD8+ T cells after culture with TGF-beta. The mean fluorescence intensity is shown for Foxp3 in CD8+ T cells isolated from tolerized mice (line on the right) or CD8+ T cells from naive mice (line on the left).

 
Previously, we have shown that the suppression of anti-DNA production by tCD8+ Ti in this pCons BWF1 mouse system depends on secretion of TGF-beta (8). Although it is well known that TGF-beta is one cytokine that regulates Foxp3 expression in CD4+ T cells (20, 21, 22, 23), there is little information on whether Foxp3 influences TGF-beta production. In the experiments shown in Fig. 5, we asked whether Foxp3 inhibition by siRNA influenced the ability of CD8+ Ti to secrete TGF-beta. In Fig. 5A, cells were cocultured as indicated on the x-axis for 48 h, and the secretion of TGF-beta into the culture medium was measured by ELISA. Naive BWF1 CD4+ T cells (Fig. 5Ab) secreted TGF-beta at a mean level of ~1000 pg/ml. There was little secretion by CD8+ T cells from naive mice (Fig. 5Ac), but high secretion by CD8+ T cells from tolerized mice (Fig. 5A, d compared with c, p < 0.009 by one-tailed Student’s t test). In the group of Formula , CD8+ T cells were cocultured with CD4+ T and B from naive mice, then assayed 48 h later for TGF-beta secretion. Secretion was high by cultures containing either nCD8 or tCD8 (Fig. 5A, e and f); however, when cultures were treated with siRNA for Foxp3 (Fig. 5Ag) secretion of TGF-beta was significantly reduced (Fig. 5A, compare g with f, p < 0.009). In contrast, transfection with siRNA for p53 did not suppress TGF-beta secretion (Fig. 5A, h, not significantly different from e or f). These data strongly suggest regulation of TGF-beta by Foxp3 in the CD8+ T cells generated in our tolerance model. To confirm that the relation between TGF-beta production and Foxp3 applied to CD8+ T cells in isolation from the other cells, CD8+ T cells from tolerized or naive mice were isolated from spleens 1 wk after tolerization, and their ability to secrete TGF-beta was determined after 48-h culture. The tolerized CD8+ T cells (Fig. 5Bb) secreted ~600 pg/ml TGF-beta, but that secretion was suppressed significantly by pretreatment of the cells with siRNA for Foxp3 before addition to culture (Fig. 5Bc, p < 0.01 compared with Fig. 5Bb). In contrast, pretreatment of tCD8+ cells with siRNA for p53, GAPDH, or scrambled sequence did not impair TGF-beta production (Fig. 5B, d–f). These data confirm a link between expression of Foxp3 and the ability of tCD8+ T cells to secrete TGF-beta.


Figure 5
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 5. A, Dependence of TGF-beta secretion on Foxp3. Secretion into medium of TGF-beta1 was measured by ELISA (y-axis) and reported as pg/ml. Bars indicate the mean of six experiments with cells alone (A, a–d) or cocultured with other cell subsets as indicated on the x-axis (A, e–h). Data are reported as mean concentrations of TGF-beta (y-axis) in supernatants harvested after 48 h of culture. Note that TGF-beta production is greater in tCD8 than in nCD8 (compare Ad with Ac) and that preincubation of tCD8 with siRNA for Foxp3 suppresses TGF-beta production (compare Ag with Af, p < 0.01). Analysis of all groups by ANOVA showed p < 0.001. Comparisons of lanes that were significantly different were Aa vs Ab, p < 0.01; Ab vs Ac, p < 0.09; Ac vs Ad, p < 0.01; Af vs Ag, p < 0.01. B, Suppression by siRNA Foxp3 of production of TGF-beta by tCD8+ T cells. In these experiments, CD8+ T cells were isolated from spleens of naive or tolerized mice and cultured with pCons for 48 h, at which time supernatants were harvested and concentrated for measurement of TGF-beta secretion. Data show mean ± SEM of two to six experiments for each bar. Tolerized CD8+ T cells made more TGF-beta than did naive cells (compare Bb with Ba). Production of TGF-beta was suppressed by preincubation of the CD8+ T cells with siRNA for Foxp3, but not to p53, GAPDH, or scrambled sequence. ANOVA analysis, p < 0.007.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Induction of immune tolerance in vivo is a complex phenomenon that involves multiple different cells and soluble factors. Peripheral tolerance to autoantigens can result from several mechanisms, including ignorance, deletion of T or B cells, anergy of T cells, cytokine shift, BCR editing, and, last but not least, induction of regulatory/suppressor cells. In our system of tolerization with pCons, anergy of Th cells and induction of regulatory/Ti appear to occur concomitantly (8, 11).

This work analyzes some characteristics of the noncytotoxic CD8+ Ti that are induced by pCons, and shows that the transcription factor Foxp3 may regulate the production of TGF-beta in these CD8+ Ti. Furthermore, the increased secretion of TGF-beta in the CD8+ Ti can be abrogated by disabling Foxp3 via siRNA technology. We also show that these CD8+ Ti can directly suppress the proliferation of CD4+ T cells and subsequent production of anti-DNA by B cells, and that this suppressive capacity of the CD8+ Ti is long lasting (up to 8 wk in some mice).

Several investigators working in other systems, including human CD8+ T cells, have found that CD8+ Ti with a suppressive function can be preferentially associated with a CD28 phenotype (5, 6, 24). In our system, when we separated the CD8+ Ti into CD28+ and CD28 cells, we observed similar suppressive capacity and similar production of TGF-beta in both the CD28+ and CD28 subpopulations (Figs. 2C and 4, A and B). Of note, however, Foxp3 mRNA expression was increased to higher levels in the CD28CD8+ T cell compartment and persisted for longer periods of time than in the CD28+CD8+ T cells (Fig. 4B). Furthermore, these kinetics were similar to those for production of TGF-beta (Fig. 4B). This suggests the possibility of an influence of TGF-beta on Foxp3 expression (similar to that observed in the case of Treg cells) that was higher and sustained longer in the CD28 T cells than in the CD28+ T cells in our system.

For many years it has been known that oral tolerance depends in part on the induction of CD4+ T cells that secrete TGF-beta (25). In many systems, TGF-beta, either secreted or membrane bound, is a key molecule for the ability of Treg or CD8+ Ti to regulate organ-specific or systemic autoimmunity (26, 27, 28). It has also been known that TGF-beta, in the presence of IL-2, can induce Foxp3 expression and can convert nonregulatory CD4+CD25 T cells to Treg (21, 22, 23). Moreover, in peripheral CD4+CD25 T cells, exposure to IL-4 and IL-13 can also generate Ag-specific Foxp3+ Treg (29). In addition, tolerized APCs, including dendritic and endothelial cells (i.e., suboptimally stimulated or chemically altered), also drive the induction of Foxp3-expressing Treg cells that secrete TGF-beta (5, 6). Conversely, a deficiency of the E3 ubiquitin ligase Cbl-b, which plays a role in regulating T cell signaling through CD28, can prevent the TGF-beta-mediated induction of Foxp3+ in the Treg (via reduced Smad 2 phosphorylation) (30). In our system of immune tolerance, it is likely that TGF-beta secretion is not the only factor that suppresses autoreactivity, because CD4+ T cells that give help to B cells also secrete abundant quantities of that cytokine (Fig. 5A).

Foxp3 is a member of the forkhead/winged helix family that functions as a transcriptional repressor (31, 32). Mice with mutations in the Foxp3 gene or with a genetic deficiency of Foxp3 develop lymphoproliferation and autoimmunity, probably because of a lack of Treg cells (32, 33, 34, 35, 36). In humans, mutations of the FoxP3 gene also cause defective Treg function and autoimmune manifestations (37, 38, 39). Although the role of Foxp3 in the mechanisms of suppression has been an object of intense investigation in Treg cells (9, 10, 20, 21, 22), recently it has been recognized that Foxp3 expression can also occur in CD8+ T cells. Up-regulation of Foxp3 in CD8+ Ti has been described both in rodents and in humans (5, 6, 40, 41). In our studies, the expression of Foxp3 and its apparent regulation by TGF-beta in CD8+ Ti are remarkably similar to that observed in CD4+ Treg cells. There are molecular themes that characterize suppressor cells with different surface and cytoplasmic phenotypes. Major molecular markers of Treg cells, such as Foxp3, glucorticoid-induced TNFR-related protein CTLA-4, OX40, CD103, 41BB, and TNFR2, can also be found in CD8+CD28 Ti (which, like the pCons-induced CD8+ Ti, are Ag specific and suppress via secretion of cytokines) (41). In our system, we have only examined Foxp3 in the CD8+ Ti; studies of the other molecules are in progress. Our data show a central role of Foxp3 (which can be up-regulated by TGF-beta). Foxp3 may also regulate the production of TGF-beta in the CD8+ Ti, a novel finding to the best of our knowledge. Current studies are now investigating whether Foxp3 may create an autocrine loop for the regulation of TGF-beta mRNA expression, to ultimately establish the basis of the molecular interactions, which allow Foxp3 to influence production of TGF-beta.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AI 46776 (to B.H.H.) and AI63515 and AR53239 (to A.L.), awards from Skirball (to B.H.H. and A.L.), the Tina C. Foundation (to B.H.H. and R.P.S.), and gifts from the Horchow Family Foundation and Jeanne Rappaport. Back

2 Address correspondence and reprint requests to Dr. Bevra H. Hahn, Division of Rheumatology, University of California, 1000 Veteran Avenue, Los Angeles, CA 90095. E-mail address: bhahn{at}mednet.ucla.edu Back

3 Abbreviations used in this paper: Ti, inhibitory T cell; nCD, naive CD; pCons, pConsensus; siRNA, small interfering RNA; tCD, tolerized CD; Treg, T regulatory. Back

Received for publication September 20, 2006. Accepted for publication March 1, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Shimazi, J., S. Yamatzaki, S. Sakaguchi. 1999. Induction of tumor immunity by removing CD25+CD4+T cells: a common basis between tumor immunity and autoimmunity. J. Immunol. 163: 5211-5218. [Abstract/Free Full Text]
  2. Karpouzas, G. A., A. La Cava, F. M. Ebling, R. R. Singh, B. H. Hahn. 2004. Differences between CD8+ T cells in lupus-prone (NZB x NZW)F1 mice and healthy (BALB/c x NZW)F1 mice may influence autoimmunity in the lupus model. Eur. J. Immunol. 34: 2489-2499. [Medline]
  3. Najafian, N., T. Chitnis, A. D. Salama, B. Zhu, C. Benou, X. Yuan, M. R. Clarkson, M. H. Sayegh, S. J. Khoury. 2003. Regulatory functions of CD8+CD28 T cells in an autoimmune disease model. J. Clin. Invest. 112: 1037-1048. [Medline]
  4. Mukasa, A., C. Hiramine, K. Hojo. 1994. Generation and characterization of a continuous line of CD8+ suppressively regulatory T lymphocytes which down-regulates experimental autoimmune orchitis (EAO) in mice. Clin. Exp. Immunol. 96: 138-145. [Medline]
  5. Manavalan, J. S., S. Kim-Schulze, L. Scotto, A. J. Naiyer, G. Vlad, P. C. Colombo, C. Marboe, D. Mancini, R. Cortesini, N. Suciu-Foca. 2004. Alloantigen specific CD8+CD28FOXP3+ T suppressor cells induce ILT3+ILT4+ tolerogenic endothelial cells, inhibiting alloreactivity. Int. Immunol. 16: 1055-1068. [Abstract/Free Full Text]
  6. Liu, J., Z. Liu, P. Witkowski, G. Vlad, J. S. Manavalan, L. Scotto, S. Kim-Schulze, R. Cortesini, M. A. Hardy, N. Suciu-Foca. 2004. Rat CD8+FOXP3+ T suppressor cells mediate tolerance to allogeneic heart transplants, inducing PIR-B in APC and rendering the graft invulnerable to rejection. Transplant Immunol. 13: 239-247. [Medline]
  7. Kang, H. K., M. A. Michaels, B. R. Berner, S. K. Datta. 2005. Very low-dose tolerance with nucleosomal peptides controls lupus and induces potent regulatory T cell subsets. J. Immunol. 174: 3247-3255. [Abstract/Free Full Text]
  8. Hahn, B. H., R. P. Singh, A. La Cava, F. M. Ebling. 2005. Tolerogenic treatment of lupus mice with consensus peptide induces Foxp3-expressing, apoptosis-resistant, TGFbeta-secreting CD8+ T cell suppressors. J. Immunol. 175: 7728-7737. [Abstract/Free Full Text]
  9. Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, M. Toda. 1995. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor {alpha}-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155: 1151-1164. [Abstract]
  10. Shevach, E. M.. 2002. CD4+CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2: 389-400. [Medline]
  11. La Cava, A., F. M. Ebling, B. H. Hahn. 2004. Ig-reactive CD4+CD25+ T cells from tolerized (New Zealand Black x New Zealand White)F1 mice suppress in vitro production of antibodies to DNA. J. Immunol. 173: 3542-3548. [Abstract/Free Full Text]
  12. Sharabi, A., H. Zinger, M. Zborowsky, Z. M. Sthoeger, E. Mozes. 2006. A peptide based on the complementarity-determining region 1 of an autoantibody ameliorates lupus by up-regulating CD4+CD25+ cells and TGF-beta. Proc. Natl. Acad. Sci. USA 103: 8810-8815. [Abstract/Free Full Text]
  13. Riemekasten, G., D. Langnickel, P. Enghard, R. Undeutsch, J. Humrich, F. M. Ebling, B. Hocher, T. Humaljoki, H. Neumayer, G. R. Burmester, et al 2004. Intravenous injection of a D1 protein of the Smith proteins postpones murine lupus and induces type 1 regulatory T cells. J. Immunol. 173: 5835-5842. [Abstract/Free Full Text]
  14. Oida, T., L. Xu, H. L. Weiner, A. Kitani, W. Strober. 2006. TGF-beta-mediated suppression by CD4+CD25+ T cells is facilitated by CTLA-4 signaling. J. Immunol. 177: 2331-2339. [Abstract/Free Full Text]
  15. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235-238. [Medline]
  16. Hahn, B. H., R. R. Singh, W. K. Wong, B. P. Tsao, K. Bulpitt, F. M. Ebling. 2001. Treatment with a consensus peptide based on amino acid sequences in autoantibodies prevents T cell activation by autoantigens and delays disease onset in murine lupus. Arthritis Rheum. 44: 432-441. [Medline]
  17. Fan, G. C., R. R. Singh. 2002. Vaccination with minigenes encoding VH-derived major histocompatibility complex class I-binding epitopes activates cytotoxic T cells that ablate autoantibody-producing B cells and inhibit lupus. J. Exp. Med. 196: 731-741. [Abstract/Free Full Text]
  18. Tsao, B. P., F. M. Ebling, C. Roman, N. Panosian-Sahakian, K. Calame, B. H. Hahn. 1990. Structural characteristics of the variable regions of immunoglobulin genes encoding a pathogenic autoantibody in murine lupus. J. Clin. Invest. 85: 530-540. [Medline]
  19. Ohnishi, K., F. M. Ebling, B. Mitchell, R. R. Singh, B. H. Hahn, B. P. Tsao. 1994. Comparison of pathogenic and non-pathogenic murine antibodies to DNA: antigen binding and structural characteristics. Int. Immunol. 6: 817-830. [Abstract/Free Full Text]
  20. Schramm, C., S. Huber, M. Protschka, P. Czochra, J. Burg, E. Schmitt, A. W. Lohse, P. R. Galle, M. Blessing. 2004. TGFbeta regulates the CD4+CD25+ T-cell pool and the expression of Foxp3 in vivo. Int. Immunol. 16: 1241-1249. [Abstract/Free Full Text]
  21. Fu, S., N. Zhang, A. C. Yopp, D. Chen, M. Mao, H. Zhang, Y. Ding, J. S. Bromberg. 2004. TGF-beta induces Foxp3+ T-regulatory cells from CD4+CD25 precursors. Am. J. Transplant. 4: 1614-1627. [Medline]
  22. Rao, P. E., A. L. Petrone, P. D. Ponath. 2005. Differentiation and expansion of T cells with regulatory function from human peripheral lymphocytes by stimulation in the presence of TGF-beta. J. Immunol. 174: 1446-1455. [Abstract/Free Full Text]
  23. Zheng, S. G., J. H. Wang, W. Stohl, K. S. Kim, J. D. Gray, D. A. Horwitz. 2006. TGF-beta requires CTLA-4 early after T cell activation to induce FoxP3 and generate adaptive CD4+CD25+ regulatory cells. J. Immunol. 176: 3321-3329. [Abstract/Free Full Text]
  24. Filaci, G., M. Fravega, S. Negrini, F. Procopio, D. Fenoglio, M. Rizzi, S. Brenci, P. Contini, D. Olive, M. Ghio, et al 2004. Nonantigen specific CD8+ T suppressor lymphocytes originate from CD8+CD28 T cells and inhibit both T-cell proliferation and CTL function. Hum. Immunol. 65: 142-156. [Medline]
  25. Faria, A. M., H. L. Weiner. 2005. Oral tolerance. Immunol. Rev. 206: 232-259. [Medline]
  26. Wan, Y. Y., R. A. Flavell. 2006. The roles for cytokines in the generation and maintenance of regulatory T cells. Immunol. Rev. 212: 114-130. [Medline]
  27. Kapp, J. A., K. Honjo, L. M. Kapp, X. Y. Xu, A. Cozier, R. P. Bucy. 2006. TCR transgenic CD8+ T cells activated in the presence of TGFbeta express FoxP3 and mediate linked suppression of primary immune responses and cardiac allograft rejection. Int. Immunol. 18: 1549-1562. [Abstract/Free Full Text]
  28. Jarnicki, A. G., J. Lysaght, S. Todryk, K. H. Mills. 2006. Suppression of antitumor immunity by IL-10 and TGF-beta-producing T cells infiltrating the growing tumor: influence of tumor environment on the induction of CD4+ and CD8+ regulatory T cells. J. Immunol. 177: 896-904. [Abstract/Free Full Text]
  29. Skapenko, A., J. R. Kalden, P. E. Lipsky, H. Schulze-Koops. 2005. The IL-4 receptor {alpha}-chain-binding cytokines, IL-4 and IL-13, induce forkhead box P3-expressing CD25+CD4+ regulatory T cells from CD25CD4+ precursors. J. Immunol. 175: 6107-6116. [Abstract/Free Full Text]
  30. Wohlfert, E. A., L. Gorelik, R. Mittler, R. A. Flavell, R. B. Clark. 2006. Cutting edge: deficiency in the E3 ubiquitin ligase Cbl-b results in a multifunctional defect in T cell TGF-beta sensitivity in vitro and in vivo. J. Immunol. 176: 1316-1320. [Abstract/Free Full Text]
  31. Hori, S., T. Nomura, S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299: 1057-1061. [Abstract/Free Full Text]
  32. Schubert, L. A., E. Jeffery, Y. Zhang, F. Ramsdell, S. F. Ziegler. 2001. Scurfin (FOXP3) acts as a repressor of transcription and regulates T cell activation. J. Biol. Chem. 276: 37672-37679. [Abstract/Free Full Text]
  33. Khattri, R., D. Kasprowicz, T. Cox, M. Mortrud, M. W. Appleby, M. E. Brunkow, S. F. Ziegler, F. Ramsdell. 2001. The amount of scurfin protein determines peripheral T cell number and responsiveness. J. Immunol. 167: 6312-6320. [Abstract/Free Full Text]
  34. Khattri, R., T. Cox, S. A. Yasayko, F. Ramsdell. 2003. An essential role for scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4: 337-342. [Medline]
  35. Fontenot, J. D., A. Y. Rudensky. 2005. A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat. Immunol. 6: 331-337. [Medline]
  36. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity 22: 329-341. [Medline]
  37. Wildin, R. S., F. Ramsdell, J. Peake, F. Faravelli, J. L. Casanova, N. Buist, E. Levy-Lahad, M. Mazzella, O. Goulet, L. Perroni, et al 2001. X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat. Genet. 27: 18-20. [Medline]
  38. Bennett, C. L., J. Christie, F. Ramsdell, M. E. Brunkow, P. J. Ferguson, L. Whitesell, T. E. Kelly, F. T. Saulsbury, P. F. Chance, H. D. Ochs. 2001. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat. Genet. 27: 20-21. [Medline]
  39. Bacchetta, R., L. Passerini, E. Gambineri, M. Dai, S. E. Allan, L. Perroni, F. Dagna-Bricarelli, C. Sartirana, S. Matthes-Martin, A. Lawitschka, et al 2006. Defective regulatory and effector T cell functions in patients with FOXP3 mutations. J. Clin. Invest. 116: 1713-1722. [Medline]
  40. Xystrakis, E., A. S. Dejean, I. Bernard, P. Druet, R. Liblau, D. Gonzalez-Dunia, A. Saoudi. 2004. Identification of a novel natural regulatory CD8 T-cell subset and analysis of its mechanism of regulation. Blood 104: 3294-3301. [Abstract/Free Full Text]
  41. Scotto, L., A. J. Naiyer, S. Galluzzo, P. Rossi, J. S. Manavalan, S. Kim-Schulze, J. Fang, R. D. Favera, R. Cortesini, N. Suciu-Foca. 2004. Overlap between molecular markers expressed by naturally occurring CD4+CD25+ regulatory T cells and antigen specific CD4+CD25+ and CD8+CD28 T suppressor cells. Hum. Immunol. 65: 1297-1306. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. P. Singh, A. La Cava, and B. H. Hahn
pConsensus Peptide Induces Tolerogenic CD8+ T Cells in Lupus-Prone (NZB x NZW)F1 Mice by Differentially Regulating Foxp3 and PD1 Molecules
J. Immunol., February 15, 2008; 180(4): 2069 - 2080.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar