The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


Correction for Collins et al., J Immunol 177 (8) 5414-5419.
The Journal of Immunology, 2007, 178: 7486.
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Collins, J. T.
Right arrow Articles by Dunnick, W. A.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Collins, J. T.
Right arrow Articles by Dunnick, W. A.

Induced expression of murine {gamma} 2a by CD40 ligation independently of IFN-{gamma}

J. T. Collins, J. Shi, B. E. Burrell, D. K. Bishop and W. A. Dunnick

Collins, J. T., J. Shi, B. E. Burrell, D. K. Bishop, and W. A. Dunnick. 2006. Induced expression of murine {gamma} 2a by CD40 ligation independently of IFN-{gamma}. J. Immunol. 177: 5414–5419.

As a part of other studies, the authors found that the I{gamma}2a primer used to amplify I{gamma}2aCµ products in one panel of Fig. 4 was contaminated with a C{gamma}2a primer. Therefore, the products designated as "I{gamma}2aCµ" in the second from the top panel of Fig. 4 are actually I{gamma}2aC{gamma}2a germline transcripts. The authors have prepared new I{gamma}2a and new Cµ primers and redone the RT-PCR for I{gamma}2aCµ transcripts. As this required new cDNA, the authors also repeated the RT-PCR for hypoxanthine phosphoribosyltransferase (HPRT) of the same samples.


Figure 4
View larger version (51K):
[in this window]
[in a new window]

 
FIGURE 4. T-depleted splenic lymphocytes from IFN-{gamma}–/– mice were cultured in LPS, CD40L, or LPS plus IFN-{gamma} for 5 h, 1 d, 2 d, or 3 d. Transcripts, as indicated on the left side of the figure, were detected in RNA from these cells by RT-PCR with incorporation of 32P-dATP. The primers for amplification (35 cycles) of I{gamma}2aCµ were GCTGATGTACCTACCTGAGAG (I{gamma}2a) and CCAGGTGAAGGAAATGGAGC (Cµ), and annealing was at 67°C. Other aspects of the RT-PCR reaction, including HPRT amplification, were as described (28). Other RT-PCR products, none of which was the correct size, were inconsistently amplified in the I{gamma}2aCµ reaction. To verify that the designated 294-bp fragment is indeed an authentic I{gamma}2aCµ product, we cloned and sequenced it from RNA of both C57BL/6 and BALB/c cells cultured in CD40L plus IFN-{gamma}. DNA sequence verified that the 294-bp product is the authentic I{gamma}2aCµ product with 169 bp of I{gamma}2a sequence joined to 125 bp of Cµ product, using the expected splice site (43).

 
The original version of the second from the top panel of Fig. 4 is incorrect in that only one authentic RT-PCR product is detected for I{gamma}2aCµ RNA (see revised Fig. 4); the original Fig. 4 showed the two products that the authors now know derive from the two splice variants of {gamma}2a germline transcripts (Ref. 43 in original article). As expected, revised Fig. 4 demonstrates that the expression of authentic I{gamma}2aCµ RNA (a postswitch RNA) lags behind that of germline transcripts; the expression of CD40L-induced I{gamma}2aCµ transcripts cannot be detected at day 2 of induction and does not peak until day 3 (or even later, not tested). Nevertheless, the major point of this figure remains correct. CD40 ligation of B cells results in switch recombination to {gamma}2a. Postswitch I{gamma}2aCµ transcripts do not pre-exist in the B cell population (they cannot be detected at 5 h or 1 day of culture), but {gamma}2a postswitch transcripts do appear at day 3, after germline transcription. This correction does not alter any major conclusion of the publication. The corrected figure and legend are shown below.





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Collins, J. T.
Right arrow Articles by Dunnick, W. A.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Collins, J. T.
Right arrow Articles by Dunnick, W. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS