The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 178, 7405 -7411
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murdoch, C.
Right arrow Articles by Lewis, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murdoch, C.
Right arrow Articles by Lewis, C. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
*Genetics Home Reference

Expression of Tie-2 by Human Monocytes and Their Responses to Angiopoietin-21

Craig Murdoch2, Simon Tazzyman, Steve Webster and Claire E. Lewis3

Tumor Targeting Group, Academic Unit of Pathology, Division of Genomic Medicine, The Sir Henry Wellcome Laboratories for Medical Research, University of Sheffield Medical School, Sheffield, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Angiopoietins 1 and 2 bind to Tie-2 expressed on endothelial cells and regulate vessel stabilization and angiogenesis. Tie-2+ monocytes have been shown to be recruited to experimental tumors where they promote tumor angiogenesis. In this study, we show that 20% of CD14+ human blood monocytes express Tie-2, and that these cells coexpress CD16 (Fc{gamma}RIII) and are predominantly CD34 negative. Ang-2 is up-regulated by endothelial cells in malignant tumors and inflamed tissues, so our finding that Ang-2 is a chemoattractant for human Tie-2+ monocytes and macrophages, suggests that it may help to recruit and regulate their distribution in such tissues. Ang-2 was also found to markedly inhibit release of the important proinflammatory cytokine, TNF-{alpha}, by monocytes in vitro. Following extravasation of monocytes, and their differentiation into macrophages, many accumulate in the hypoxic areas of inflamed and malignant tissues. Ang-2 is known to be up-regulated by hypoxia and we show that monocytes and macrophages up-regulate Tie-2 when exposed to hypoxia. Furthermore, hypoxia augmented the inhibitory effect of Ang-2 on the release of the anti-angiogenic cytokine, IL-12 by monocytes. In sum, our data indicate that Ang-2 may recruit Tie-2+ monocytes to tumors and sites of inflammation, modulate their release of important cytokines and stimulate them to express a proangiogenic phenotype.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Macrophages, derived from peripheral blood monocytes recruited from the local circulation, are a prominent component of the leukocytic infiltrate in inflamed tissues and malignant tumors. These cells tend to accumulate in perivascular areas and other sites that are inadequately perfused (and thus hypoxic) (1, 2). A number of studies have shown that macrophages respond to hypoxia by up-regulating of a number of angiogenic growth factors and enzymes that stimulate angiogenesis. These then diffuse away from the hypoxic area and stimulate endothelial cells in neighboring, vascularized areas to migrate, proliferate, and differentiate into new vessels (3).

Angiopoietins 1–4 (Ang-1–4)4 are important in the formation and function of blood vessels, with the best studied of these being Ang-1 and -2. These regulate processes like angiogenesis by specifically binding to the receptor Tie-2/Tek on endothelial cells (4, 5, 6). The current model suggests that Ang-1 acts as a Tie-2 agonist to promote, maintain, and stabilize mature vessels by promoting interactions between endothelial cells, pericytes, basement membrane, and surrounding extracellular matrix (7). Conversely, Ang-2, the predominant form of angiopoietin in inflamed and malignant tissues (8, 9) is a functional antagonist of Ang-1 and competitively binds to Tie-2, antagonizing the stabilizing effect of Ang-1, resulting in an overall destabilization of existing vessels (6). These destabilized vessels are thought to undergo regression in the absence of vascular endothelial growth factor (VEGF), but when this angiogenic cytokine is present as in inflamed or malignant tissues, the destabilized vessels undergo angiogenic changes and sprout to form new vessels. Thus, angiogenesis is controlled by a dynamic balance between vessel stabilization and growth, mediated by VEGF, Ang-1 and Ang-2 (9). Recently, Ang-2 was shown to possess stimulatory functions via activation of Tie-2 and to stimulate endothelial cell migration and tubule formation in vitro (10, 11). Thus, the role of Ang-2 is still unclear because it appears to possess both agonist and antagonist functions.

Until recently, expression of Tie-2 was thought to be restricted to endothelial cells. However, De Palma and colleagues (12, 13) identified a subset of Tie-2-positive monocytes that were recruited to experimental tumors, where they stimulated tumor angiogenesis. In the present report, we show that Tie-2-expressing monocytes present in human peripheral blood respond to Ang-2 with both chemotaxis and altered cytokine release. Furthermore, hypoxia was seen to up-regulate Tie-2 expression by both monocytes and macrophages, and to modulate their responses to Ang-2. Taken together our findings suggest that Ang-2 may recruit Tie-2+ monocytes to tumors and sites of inflammation, where it then plays an important role in modulating cytokines implicated in angiogenic and inflammatory processes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Isolation and culture of primary human monocytes and monocyte-derived macrophages

Human monocytes were isolated from leukocyte-enriched buffy coats obtained from healthy blood donors (National Blood Service, Sheffield, U.K.). Blood was diluted 1/1 with HBSS (without calcium or magnesium), layered on Ficoll-Paque Plus (Amersham Biosciences) and centrifuged for 40 min at 400 x g. The mononuclear cell-rich layer was removed, washed twice with HBSS, and resuspended in IMDM supplemented with 2% human AB serum, 2 mM L-glutamine (Sigma-Aldrich). Eight x 107 mononuclear cells were seeded into 10 cm2 tissue culture plates or 2 x 107 in 6-well plates (Iwaki) and cultured for 2 h after which nonadherent cells were removed by washing three times with HBSS and the culture medium replenished. To generate fully differentiated monocyte-derived macrophages (MDM), adherent monocytes were cultured for 7 days (14). The purity and full differentiation of the resultant MDM was checked using CD68 by immunocytochemistry and carboxypeptidase M (a marker of terminally differentiated macrophages (15)) by flow cytometry.

Hypoxic culture of monocytes and monocyte-derived macrophages

Monocytes or MDM were exposed to 0.1% (hypoxia) or 20.9% (normoxia) O2 in 5% CO2 humidified multigas incubators (Heto) for 20 h in IMDM supplemented with 2% human AB serum, 2 mM L-glutamine (all obtained from Sigma-Aldrich). Incubator oxygen levels were confirmed during and immediately after all experiments using mobile oxygen analyzers (Analox Sensor Technology). Culture medium depths of <2 mm were used throughout this study to ensure rapid removal of oxygen from the culture medium during hypoxic experiments.

Flow cytometry

Flow cytometry was performed using anti-CD14-FITC (Serotec), anti-Tie-2-allophycocyanin (clone 83715; R&D Systems) and then either anti-CD34-PE or anti-CD16-PE (BD Biosciences) for conjugated staining, and anti-Tie-2 (clone 83715; R&D Systems), anti-CXCR4 (clone 44717; R&D Systems) followed by goat anti-mouse IgG F(ab')2-FITC for unconjugated staining. Isotype-matched Ab controls were used in all staining procedures. Whole blood assay used 50 µl of peripheral blood incubated with 10 µl of conjugated Ab followed by erythrocyte lysis (FACSlyse; BD Biosciences). All other experiments used 5 x 105 CD14+ (>95% by flow cytometric analysis) monocytes isolated from buffy coats by the RosetteSep method (StemCell Technologies) or MDM incubated with 10 µl of conjugated Ab for 30 min at 4°C per test. Nonviable cells were excluded from flow cytometric analysis using propidium iodide.

RT-PCR analysis

Total RNA was extracted from monocytes, MDM and human dermal microvascular endothelial cells (HuDMEC) using RNeasy (Qiagen) and RT-PCR performed using SuperScript III One-Step RT-PCR system (Invitrogen Life Technologies) using specific primers designed on the 3' region of each cDNA as follows Tie-2, sense: TGTTCCTGTGCCACAGGCTG, antisense: CACTGTCCCATCCGGCTTCA; beta-actin, sense ATGGGTCAGAAGGATTCCTATGTG, antisense: CTTCATGAGGTAGTCAGTCAGGTC. For cDNA synthesis, 1 µg of total RNA was reversed transcribed at 55°C for 30 min followed by denaturation at 94°C for 2 min. The thermal profile for PCR was 15 s at 95°C, 15 s at 55°C, 30 s at 68°C. Thirty-five amplification cycles were used for both Tie-2 and beta-actin, which was used as an endogenous control. The expected sizes of Tie-2 and beta-actin were 317 bp, and 359 bp, respectively. To exclude possible contamination of genomic DNA, PCR was also applied to reactions without RT.

Monocyte and macrophage chemotaxis in response to Ang-2

Cell migration was assessed using a 48-well chemotaxis microchamber technique (Neuroprobe) (16, 17). Where nonadherent monocytes were required for these assays, human monocytes were isolated from buffy coats using the RosetteSep method (StemCell Technologies) followed by centrifugation at 1200 x g for 20 min on Ficoll-Hypaque Plus (Amersham Biosciences). Cells were washed and counted, and the concentration was adjusted to 6 x 105 monocytes/ml in HBSS plus 0.1% BSA. A total of 25 µl of 100 ng/ml recombinant human CCL2 or human CXCL12 (positive controls) or various concentrations of Ang-2 (both obtained from R&D Systems) was placed in the lower compartment of the microchamber and 50 µl of cell suspension were seeded in the upper compartment. In the case of MDM, cells were removed from flasks, resuspended at 1 x 106 cells per ml in HBSS plus 0.1% BSA, and 50 µl added to upper wells. The two compartments were separated by a 5 µm pore-size polyvinylpyrrolidone-coated polycarbonate filter (Neuroprobe). Chambers were incubated at 37°C for 2 h (monocytes) or 4 h (MDM). At the end of incubation, filters were removed, fixed with methanol, and stained with Diff-Quik (Fisher Scientific). Cells that had migrated and were attached to the lower side of the membrane were counted per high power field using either a x25 or x40 objective on a light microscope. The statistical significance of migration toward each stimulus vs control was assessed by t test.

Cytokine release by monocytes in response to Ang-2

For Ang-2 stimulation experiments, monocytes adhered to 6-well plates were stimulated with 300 ng/ml recombinant Ang-2 (R&D Systems) in IMDM medium supplemented with 1% FCS, 2 mM L-glutamine (Sigma-Aldrich) for 20 h either in normoxia or hypoxia. Cell culture supernatants were removed, centrifuged to remove debris, and stored at –20°C until analyzed for TNF-{alpha}, CCL2, IL-4, -6, -10, and -12 and CXCL8 by ELISA using commercial kits (OptEIA; BD Biosciences).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Peripheral blood monocytes but not lymphocytes or granulocytes express Tie-2

It is well known that Tie-2 expressed by endothelial cells plays a key role in angiogenesis. Recent evidence suggests that leukocytes, in particular a subpopulation of murine monocytes, and other cells of the myeloid lineage also express Tie-2 (13, 18, 19). We examined the expression of Tie-2 on human peripheral blood leukocytes by flow cytometry. Leukocytes were first gated in accordance with their forward and side scatter properties into granulocytes, monocytes, and lymphocytes (Fig. 1) each population was then analyzed for Tie-2, the classical monocyte marker CD14 and IgG as control using FITC-conjugated Abs. Lymphocytes were CD14 and Tie-2. The granulocyte population (mainly neutrophils) was CD14low and Tie-2. However, the monocyte population was CD14high and Tie-2+ with a significant shift in the median fluorescence intensity levels (Fig. 1).


Figure 1
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 1. Peripheral blood monocytes but not lymphocytes or granulocytes express the Ang receptor, Tie-2. Peripheral blood leukocytes were stained with Tie-2 Ab, CD14, or IgG control and examined by flow cytometry by forward and side scatter properties (top left panel, G, granulocytes, L, lymphocytes, M, monocytes). Lymphocytes and granulocytes did not express Tie-2 while CD14high monocytes expressed cell surface Tie-2 (n = 4). Mean fluorescence intensity is shown in each sample. Data are representative of four replicate experiments.

 
Purifield human monocytes and MDMs express Tie-2 mRNA and protein expression

To confirm that human monocytes and not other circulating cells with similar morphology express Tie-2, peripheral blood monocytes were purified by either adherence to tissue culture plastic or by isolation using RosetteSep. Monocytes (CD14high and CD68+) were typically >95% pure when isolated by these procedures (data not shown). Monocytes were then used for RNA isolation, flow cytometry, or cultured for an additional 7 days to allow differentiation into MDMs (14). Semiquantitative RT-PCR using primers specific for Tie-2 and beta-actin (used as an endogenous control) showed that both monocytes and MDM express mRNA for Tie-2. mRNA expression in cultured HuDMECs was used as a reference control because these cells are known to express cell surface Tie-2 when analyzed by flow cytometry (Fig. 2A) (20). Expression of mRNA transcripts for Tie-2 in monocytes appeared to be lower than that for MDM, whereas Tie-2 mRNA expression in MDM appeared to be comparable to that of HuDMEC (Fig. 2A). Multicolor (CD14-FITC, CD34-PE, and Tie-2-allophycocyanin) flow cytometric analysis of purified monocytes and MDM showed significant shifts in median fluorescence intensities for cell surface Tie-2 (monocytes; Tie-2 20.35, IgG 5.28, MDM; Tie-2 4.96 compared with IgG 2.00). Typically, 20–22% of monocytes and 4% of MDM were Tie-2+ when compared with isotype-matched IgG controls (Fig. 2B).


Figure 2
View larger version (47K):
[in this window]
[in a new window]

 
FIGURE 2. Comparison of the expression of Tie-2 by human monocytes, MDMs, and endothelial cells. A, mRNA transcripts for Tie-2 were detected in extracts from human monocytes, MDM, and HuDMEC. beta-Actin was used as an endogenous control. HuDMEC expressed high levels of cell surface Tie-2 as detected by flow cytometry (IgG, filled histogram; Tie-2, open histogram). B, Purified monocytes and macrophages (MDM) express cell surface Tie-2 as analyzed by dual-stained (CD14-FITC, Tie-2-allophycocyanin) flow cytometry (center and left panels). Monocytes and MDM typically express 20–22% (bottom central panel) and 4% (bottom left panel) Tie-2 positive cells, respectively, compared with control IgG staining (top central and left panel, respectively) (n = 5). Tie-2+ monocytes were analyzed for CD34 coexpression using gated analysis (R1) (bottom right panel). The majority (78%) of CD14+/Tie-2+ monocytes were CD34, while 22% were CD34+ (IgG-PE, filled histogram, CD34-PE, open histogram). Data shown are representative of two replicate experiments.

 
CD14+/Tie-2+ monocytes were also analyzed for coexpression of CD34. A total of 78% of CD14+/Tie-2+ monocytes were CD34, with the remainder expressing detectable levels of CD34+ (Fig. 2B). To further characterize the Tie-2 expressing monocyte phenotype, these cells were also analyzed for coexpression of CD16. As expected, purified peripheral blood monocytes could be subdivided into CD14+/CD16 and CD14+/CD16+ and CD14lowCD16+ subpopulations (21, 22) (Fig. 3, AD). Triple-stained flow cytometric analysis revealed that CD14+/Tie-2+ monocytes were mainly CD16+ (Fig. 3, EG).


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 3. Expression of CD16 by CD14+/Tie-2+ human monocytes. Purified monocytes were stained with conjugated control Abs (IgG-FITC, IgG-PE) (A) or with CD14-FITC (B) or CD16-PE (C) alone to determine the presence of CD14high/CD16low (D, gate R1), CD14high/CD16high (D, gate R2) and CD14low/CD16high (D, gate R3) monocyte subpopulations. These gated populations were then further analyzed for Tie-2 coexpression using tri-color analysis. Tie-2 expression was found predominantly on CD14high/CD16high monocytes (29%; F) compared with expression on CD14high/CD16low (12%; G) CD14low/CD16high (4%; E) (IgG-allophycocyanin, filled histogram; Tie-2, open histogram). Data shown are representative of two replicate experiments.

 
Ang-2 induces chemotaxis in monocytes and macrophages

Ang-2 has been shown to induce chemotaxis in both endothelial cells (11) and fibroblasts (23). We therefore examined the effects of Ang-2 on the migration of human monocytes in vitro. Purified human monocytes were chemotactic to recombinant Ang-2 at 100 ng/ml (p < 0.05) (Fig. 4A) when compared with control medium. This was a highly reproducible effect but was usually less pronounced than that seen for the powerful monocyte chemoattractant, CCL2, in the same assays (Fig. 4A). Moreover, monocytes showed a typical bell-shaped dose response to this cytokine (Fig. 4B). MDM also showed a significant (p < 0.05) increase in migration toward Ang-2 (data not shown).


Figure 4
View larger version (33K):
[in this window]
[in a new window]

 
FIGURE 4. Effect of Ang-2 on monocyte chemotaxis and cytokine release. A, Monocyte migration toward 100 ng/ml recombinant human CCL2 or Ang-2 or medium alone (counted using x40 objective). B, Migration of monocytes to medium alone or medium containing various doses of Ang-2. *, p < 0.05 with respect to control group (using a x25 objective). C, Release of TNF-{alpha}, CCL2, IL-12, and IL-6 by monocytes exposed to medium with or without 300 ng/ml recombinant Ang-2 under normoxic (20.9% O2) or hypoxic (0.1% O2) conditions for 20 h. ^, p < 0.05 with respect to normoxia alone group; ^^, p < 0.05 with respect to hypoxia alone group. Data are mean concentrations ± SEM and are representative of four replicate experiments.

 
Ang-2 inhibits cytokine release by human monocytes

Because both Ang-2 and hypoxia have been shown to regulate both inflammation and angiogenesis (1, 6, 8, 24) and, as shown above, Ang-2 can directly stimulate biological functions in monocytes, we reasoned that Ang-2, either alone or in conjunction with hypoxia, may modulate the expression of cytokines involved in these two important mechanisms. Monocytes were therefore stimulated with Ang-2 in the presence or absence of hypoxia for 20 h and their release of the inflammatory cytokines, TNF-{alpha}, IL-12, CCL2, and IL-6 measured by ELISA (Fig. 4C). Stimulation of monocytes with Ang-2 in normoxic conditions significantly reduced the release of TNF-{alpha} when compared with normoxia alone (p < 0.045), suggesting that Ang-2 can inhibit the production of TNF-{alpha} by monocytes. Hypoxia alone also markedly reduced (3-fold) the release of TNF-{alpha} compared with culture under normoxic conditions (p < 0.03). Moreover, monocytes exposed to Ang-2 in the presence of hypoxia displayed a further reduction in TNF-{alpha} release compared with hypoxia alone (p < 0.01), suggesting that Ang-2 and hypoxia can act synergistically to inhibit monocyte TNF-{alpha} secretion. Hypoxia alone had no effect on IL-12 release by monocytes, and Ang-2 only a minor, nonsignificant effect (Fig. 4C). However, when monocytes were exposed to both Ang-2 and hypoxia there was a significant (p < 0.025) inhibition of IL-12 release by these cells. As with TNF-{alpha}, hypoxia markedly inhibited the release of CCL2 by monocytes (p < 0.002), a phenomena reported previously (25). This was also seen in the presence of Ang-2, which did not alter the release of this chemokine in either normoxia or hypoxia. Release of IL-6 (Fig. 4B), IL-4, IL-10, or CXCL8 (data not shown) was unaffected by exposure to hypoxia or Ang-2 (in normoxia or hypoxia).

Monocytes and MDM up-regulate cell surface expression of Tie-2 in response to hypoxia

Previous studies have shown that hypoxia can up-regulate both mRNA and cell surface expression of Tie-2 on human microvascular endothelial cells (20). We therefore investigated whether hypoxia would also up-regulate the cell surface expression of Tie-2 on monocytes and MDM. Purified monocytes and MDM were subjected to normoxia (20% O2) or chronic hypoxia (0.1% O2) for 20 h, and then cell surface expression of Tie-2 was examined by flow cytometry. Hypoxia caused a significant increase in both the median fluorescence intensity and number of Tie-2+ monocytes or MDM, compared with cells cultured under normoxic conditions (Fig. 5). CXCR4, a chemokine receptor known to be up-regulated by hypoxia in both monocytes and MDM (26), was used as a positive control in all experiments. As hypoxia increases expression of Tie-2 on monocytes (Fig. 5), and as Ang-2 is known to be up-regulated by hypoxia in tumors, we investigated whether this could be part of the mechanism by which monocytes are recruited into hypoxic areas of tumors. Although hypoxia significantly (p < 0.01) enhanced the migratory response of monocytes to the CXCR4 ligand, CXCL12 in vitro, it had no effect on their migration in response to Ang-2 in our chemotaxis assay (data not shown).


Figure 5
View larger version (40K):
[in this window]
[in a new window]

 
FIGURE 5. Hypoxia up-regulates Tie-2 on human monocytes and macrophages. Human peripheral blood monocytes (top panels) and MDM (bottom panels) were incubated in normoxia (20% O2) or hypoxia (0.1% O2) for 20 h and then cell surface expression of Tie-2 (left panels), or the known hypoxia-regulated chemokine receptor, CXCR4 (right panels, positive control) analyzed by flow cytometry. Hypoxia up-regulates the expression of Tie-2 on human monocytes and to a lesser extent on MDM. CXCR4 was markedly increased on both monocytes and macrophages. Data representative of six replicate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Tie-2 expressing monocytes are selectively recruited to murine tumors and human brain gliomas in nude mice, where they play an important part in regulating tumor angiogenesis (13). In the present study, we show that a substantial subpopulation of CD14+ monocytes (20%) in human peripheral blood express Tie-2. These data agree with that of Nowak and colleagues (27) who reported previously Tie-2+ expression on 2% of total PBMC, with the majority of these Tie-2+ cells being monocytes. Similarly, we found negligible levels of Tie-2 on other mononuclear cells or neutrophils (27). Tie-2 mRNA and cell surface protein was expressed by both monocytes and MDM, suggesting that some monocytes maintain Tie-2 expression as they differentiate into macrophages following extravasation across the vasculature into healthy and/or diseased tissues.

From RT-PCR and flow cytometric analysis, it appears that Tie-2 mRNA is more abundant in MDM than monocytes whereas cell surface expression of the protein showed the opposite pattern. One reason for this may be due to the limited sensitivity of semiquantitative end-point RT-PCR analysis. It may also be that Tie-2 mRNA in monocytes is rapidly converted to protein for translocation to the cell surface, whereas in MDM this is less efficient. Recent studies by Bogdanovic et al. (28) show that Tie-2 cell surface expression by endothelial cells is regulated by receptor shedding, internalization, and degradation. Evidence exists for soluble Tie-2 being released as a decoy form of the receptor by endothelial cells (29). Our preliminary studies using protein arrays have suggested that soluble Tie-2 is released/shed by both human monocytes and MDM in vitro (C. Murdoch and C. E. Lewis, unpublished observations) However, it remains to be seen whether this happens to a greater extent on MDM than monocytes.

Previous studies have reported that some CD14+ monocytes coexpress CD34 and have the ability to differentiate into various different cells types (including endothelial cells, fat cells, muscle cells and neurons) (27, 30, 31, 32, 33). However, we found that the majority (nearly 80%) of Tie-2+/CD14+ cells in human blood were CD34 and so unlikely to represent such primitive, multipotential cells in the circulation, the remaining CD34+ subpopulation may represent all or part of such a progenitor cell population.

Our data confirm that human monocytes can be divided into subsets on the basis of their expression of CD14 and CD16, with the majority (nearly 75%) being CD14+/CD16 (34). Such CD14+CD16 monocytes are often termed inflammatory monocytes because they resemble the original description of monocytes and are thought to be the major participants in innate inflammatory responses (21). In contrast, CD14low/CD16+ monocytes home to noninflamed tissues and, as such, have been termed resident monocytes because they are the precursors of tissue macrophages (22). Interestingly, our data show that Tie-2 is predominantly expressed by CD14+/CD16+ monocytes. Furthermore, we demonstrate that Tie-2 was expressed at higher levels by monocytes with a CD14high/CD16high than a CD14high/CD16low phenotype. Only limited Tie-2 expression was observed on CD14low/CD16high monocytes and was completely absent on CD14high/CD16 monocytes. These data indicate that Tie-2+/CD14+/CD16+ monocytes form a subpopulation of monocytes that are distinct from CD14+/CD16 monocytes. It appears that Tie-2+ monocytes have phenotypic characteristics of both CD14+ classical and CD16+ resident monocytes suggesting that their phenotype is more plastic and thus their function flexible.

Ang-2 inhibits the effects of Ang-1 on endothelial cells by blocking Ang-1 signaling via Tie-2 (6). However, recent data has shown that Ang-2 can also induce Tie-2 phosphorylation and endothelial cell migration and survival (10, 11, 35). The present study is the first to describe a chemotactic effect of Ang-2 on human monocytes and macrophages. It is known that during tumor development the Ang-1/Ang-2 balance shifts in favor of Ang-2, with endothelial cells in a high proportion of tumor vessels expressing Ang-2 (9). Interestingly, De Palma et al. (13) demonstrate that many Tie-2-expressing monocytes remained closely associated with tumor blood vessels in experimental tumor models. Our chemotaxis data suggest that Ang-2 released by activated vessels in such tissues would actively recruit Tie-2+ monocytes and possibly contribute to the regulation of their subsequent tissue distribution.

TNF-{alpha} has been shown to impair CCL2-induced transendothelial migration of monocytes, by down-regulating CCR2, the receptor for CCL2 (36). Our finding that Ang-2 inhibits TNF-{alpha} release by monocytes suggests that Ang-2 secreted in and around some vessels could inhibit the release of TNF-{alpha} by newly recruited Tie-2+ monocytes, thereby facilitating CCL2-induced recruitment of monocytes from the circulation. Ang-2 inhibition of TNF-{alpha} release by monocytes may also result in the stimulation of angiogenesis as low doses of TNF-{alpha} have been shown to increase vascular branch formation by endothelial cells in vitro, an effect amplified by high levels of Ang-2 (37).

The presence of multiple areas of hypoxia (low oxygen tension) is a hallmark feature of not only tumors but also various inflammatory conditions (reviewed in Ref. 38). Macrophages have been shown to accumulate in high numbers in hypoxic/necrotic areas of human endometrial (39), breast (40), and ovarian (41) carcinoma, where they play a crucial role in tumor progression fostering the survival, proliferation, invasion, and metastasis of tumor cells, and promoting tumor angiogenesis (2). In hypoxic environments macrophages exhibit a proangiogenic phenotype that aids tumor progression (3).

Ang-2 expression is up-regulated by both endothelial cells (42) and tumor cells (43) exposed to hypoxia in vitro and in poorly vascularized areas of colorectal carcinomas (44). Given our finding that Ang-2 is a chemoattractant for Tie-2+ monocytes in vitro, it is possible that Ang-2 up-regulated in hypoxic areas of tumors or inflamed sites may help to recruit macrophages to these areas. We show that cell surface expression of Tie-2 by macrophages is up-regulated by hypoxia and that this increases their responsiveness to Ang-2 as Ang-2 inhibited IL-12 in the presence of hypoxia but not normoxia. IL-12 is a potent anti-angiogenic and immunostimulatory cytokine (45, 46). Our data indicate that if and when Tie-2+ monocytes accumulate in hypoxic areas of tumors, they promote tumor angiogenesis in part by shutting down their secretion of IL-12. This agrees well with the proangiogenic phenotype reported for Tie-2+ monocytes in murine tumors (13).

Taken together, our findings indicate that Tie-2+ monocytes are abundant in human peripheral blood and are likely to be actively recruited to inflamed or malignant tissues by the chemotactic effect of Ang-2 released by vessels in these tissues. If they then remain close to Ang-2 expressing vessels, our data show that Tie-2+ monocytes are likely to release low levels of TNF-{alpha}. Ang-2 is up-regulated by hypoxic tumor cells, so when Tie-2+ macrophages migrate into hypoxic diseased areas, they would then facilitate angiogenesis by responding to the Ang-2 and hypoxia present with the suppression of IL-12.


    Acknowledgments
 
We thank Sue Newton of the Flow Cytometric Core Facility for technical assistance and Michele De Palma (Telethon Institute for Gene Therapy, San Raffaele Scientific Institute, Milan, Italy) for helpful discussions about our manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by research funding from the Biotechnology and Biological Sciences Research Council and Yorkshire Cancer Research. Back

2 Current address: Department of Oral and Maxillofacial Surgery, University of Sheffield School of Clinical Dentistry, Sheffield, United Kingdom Back

3 Address correspondence and reprint requests to Dr. Claire E. Lewis, Tumor Targeting Group, Academic Unit of Pathology, Division of Genomic Medicine, The Sir Henry Wellcome Laboratories for Medical Research, University of Sheffield Medical School, Beech Hill Road, Sheffield, S10 2RX, U.K. E-mail address: claire.lewis{at}sheffield.ac.uk Back

4 Abbreviations used in this paper: Ang, angiopoietin; VEGF, vascular endothelial growth factor; MDM, monocyte-derived macrophage; HuDMEC, human dermal microvascular endothelial cell. Back

Received for publication December 8, 2006. Accepted for publication February 28, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Murdoch, C., M. Muthana, C. E. Lewis. 2005. Hypoxia regulates macrophage functions in inflammation. J. Immunol. 175: 6257-6263. [Abstract/Free Full Text]
  2. Lewis, C. E., J. W. Pollard. 2006. Distinct role of macrophages in different tumor microenvironments. Cancer Res. 66: 605-612. [Abstract/Free Full Text]
  3. Lewis, C. E., C. Murdoch. 2005. Macrophage responses to hypoxia: implications for tumor progression and anti-cancer therapies. Am. J. Pathol. 167: 627-635. [Abstract/Free Full Text]
  4. Sato, T. N., Y. Tozawa, U. Deutsch, K. Wolburg-Buchholz, Y. Fujiwara, M. Gendron-Maguire, T. Gridley, H. Wolburg, W. Risau, Y. Qin. 1995. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 376: 70-74. [Medline]
  5. Davis, S., T. H. Aldrich, P. F. Jones, A. Acheson, D. L. Compton, V. Jain, T. E. Ryan, J. Bruno, C. Radziejewski, P. C. Maisonpierre, G. D. Yancopoulos. 1996. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 87: 1161-1169. [Medline]
  6. Maisonpierre, P. C., C. Suri, P. F. Jones, S. Bartunkova, S. J. Wiegand, C. Radziejewski, D. Compton, J. McClain, T. H. Aldrich, N. Papadopoulos, et al 1997. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277: 55-60. [Abstract/Free Full Text]
  7. Thurston, G., J. S. Rudge, E. Ioffe, H. Zhou, L. Ross, S. D. Croll, N. Glazer, J. Holash, D. M. McDonald, G. D. Yancopoulos. 2000. Angiopoietin-1 protects the adult vasculature against plasma leakage. Nat. Med. 6: 460-463. [Medline]
  8. Kuroda, K., A. Sapadin, T. Shoji, R. Fleischmajer, M. Lebwohl. 2001. Altered expression of angiopoietins and Tie2 endothelium receptor in psoriasis. J. Invest. Dermatol. 116: 713-720. [Medline]
  9. Tait, C. R., P. F. Jones. 2004. Angiopoietins in tumours: the angiogenic switch. J. Pathol. 204: 1-10. [Medline]
  10. Teichert-Kuliszewska, K., P. C. Maisonpierre, N. Jones, A. I. Campbell, Z. Master, M. P. Bendeck, K. Alitalo, D. J. Dumont, G. D. Yancopoulos, D. J. Stewart. 2001. Biological action of angiopoietin-2 in a fibrin matrix model of angiogenesis is associated with activation of Tie2. Cardiovasc. Res. 49: 659-670. [Abstract/Free Full Text]
  11. Mochizuki, Y., T. Nakamura, H. Kanetake, S. Kanda. 2002. Angiopoietin 2 stimulates migration and tube-like structure formation of murine brain capillary endothelial cells through c-Fes and c-Fyn. J. Cell Sci. 115: 175-183. [Abstract/Free Full Text]
  12. De Palma, M., M. A. Venneri, C. Roca, L. Naldini. 2003. Targeting exogenous genes to tumor angiogenesis by transplantation of genetically modified hematopoietic stem cells. Nat. Med. 9: 789-795. [Medline]
  13. De Palma, M., M. A. Venneri, R. Galli, L. S. Sergi, L. S. Politi, M. Sampaolesi, L. Naldini. 2005. Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors. Cancer Cells 8: 211-226.
  14. Zuckerman, S. H., S. K. Ackerman, S. D. Douglas. 1979. Long-term human peripheral blood monocyte cultures: establishment, metabolism and morphology of primary human monocyte-macrophage cell cultures. Immunology 38: 401-411. [Medline]
  15. Rehli, M., S. W. Krause, M. Kreutz, R. Andreesen. 1995. Carboxypeptidase M is identical to the MAX. 1 antigen and its expression is associated with monocyte to macrophage differentiation. J. Biol. Chem. 270: 15644-15649. [Abstract/Free Full Text]
  16. Falk, W., R. H. Goodwin, Jr, E. J. Leonard. 1980. A 48-well micro chemotaxis assembly for rapid and accurate measurement of leukocyte migration. J. Immunol. Methods 33: 239-247. [Medline]
  17. Sica, A., J. M. Wang, F. Colotta, E. Dejana, A. Mantovani, J. J. Oppenheim, C. G. Larsen, C. O. C. Zachariae, K. Matsushima. 1990. Monocyte chemotactic and activating factor gene-expression induced in endothelial cells by IL-1 and tumor-necrosis factor. J. Immunol. 144: 3034-3038. [Abstract]
  18. Lemieux, C., R. Maliba, J. Favier, J. F. Theoret, Y. Merhi, M. G. Sirois. 2005. Angiopoietins can directly activate endothelial cells and neutrophils to promote proinflammatory responses. Blood 105: 1523-1530. [Abstract/Free Full Text]
  19. Feistritzer, C., B. A. Mosheimer, D. H. Sturn, K. Bijuklic, J. R. Patsch, C. J. Wiedermann. 2004. Expression and function of the angiopoietin receptor Tie-2 in human eosinophils. J. Allergy Clin. Immunol. 114: 1077-1084. [Medline]
  20. Willam, C., P. Koehne, J. S. Jurgensen, M. Grafe, K. D. Wagner, S. Bachmann, U. Frei, K. U. Eckardt. 2000. Tie2 receptor expression is stimulated by hypoxia and proinflammatory cytokines in human endothelial cells. Circ. Res. 87: 370-377. [Abstract/Free Full Text]
  21. Geissmann, F., S. Jung, D. R. Littman. 2003. Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19: 71-82. [Medline]
  22. Ziegler-Heitbrock, H. W., G. Fingerle, M. Strobel, W. Schraut, F. Stelter, C. Schutt, B. Passlick, A. Pforte. 1993. The novel subset of CD14+/CD16+ blood monocytes exhibits features of tissue macrophages. Eur. J. Immunol. 23: 2053-2058. [Medline]
  23. Takahara, K., T. Iioka, K. Furukawa, T. Uchida, M. Nakashima, T. Tsukazaki, H. Shindo. 2004. Autocrine/paracrine role of the angiopoietin-1 and-2/Tie2 system in cell proliferation and chemotaxis of cultured fibroblastic synoviocytes in rheumatoid arthritis. Hum. Pathol. 35: 150-158. [Medline]
  24. Pugh, C. W., P. J. Ratcliffe. 2003. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat. Med. 9: 677-684. [Medline]
  25. Bosco, M. C., M. Puppo, S. Pastorino, Z. Mi, G. Melillo, S. Massazza, A. Rapisarda, L. Varesio. 2004. Hypoxia selectively inhibits monocyte chemoattractant protein-1 production by macrophages. J. Immunol. 172: 1681-1690. [Abstract/Free Full Text]
  26. Schioppa, T., B. Uranchimeg, A. Saccani, S. K. Biswas, A. Doni, A. Rapisarda, S. Bernasconi, S. Saccani, M. Nebuloni, L. Vago, et al 2003. Regulation of the chemokine receptor CXCR4 by hypoxia. J. Exp. Med. 198: 1391-1402. [Abstract/Free Full Text]
  27. Nowak, G., A. Karrar, C. Holmen, S. Nava, M. Uzunel, K. Hultenby, S. Sumitran-Holgersson. 2004. Expression of vascular endothelial growth factor receptor-2 or Tie-2 on peripheral blood cells defines functionally competent cell populations capable of reendothelialization. Circulation 110: 3699-3707. [Abstract/Free Full Text]
  28. Bogdanovic, E., V. P. Nguyen, D. J. Dumont. 2006. Activation of Tie2 by angiopoietin-1 and angiopoietin-2 results in their release and receptor internalization. J. Cell Sci. 119: 3551-3560. [Abstract/Free Full Text]
  29. Reusch, P., B. Barleon, K. Weindel, G. Martiny-Baron, A. Godde, G. Siemeister, D. Marme. 2001. Identification of a soluble form of the angiopoietin receptor TIE-2 released from endothelial cells and present in human blood. Angiogenesis 4: 123-131. [Medline]
  30. Asahara, T., T. Murohara, A. Sullivan, M. Silver, R. van der Zee, T. Li, B. Witzenbichler, G. Schatteman, J. M. Isner. 1997. Isolation of putative progenitor endothelial cells for angiogenesis. Science 275: 964-967. [Abstract/Free Full Text]
  31. Fernandez, P. B., F. C. Lucibello, U. M. Gehling, K. Lindemann, N. Weidner, M. L. Zuzarte, J. Adamkiewicz, H. P. Elsasser, R. Muller, K. Havemann. 2000. Endothelial-like cells derived from human CD14 positive monocytes. Differentiation 65: 287-300. [Medline]
  32. Schmeisser, A., C. D. Garlichs, H. Zhang, S. Eskafi, C. Graffy, J. Ludwig, R. H. Strasser, W. G. Daniel. 2001. Monocytes coexpress endothelial and macrophagocytic lineage markers and form cord-like structures in Matrigel under angiogenic conditions. Cardiovasc. Res. 49: 671-680. [Abstract/Free Full Text]
  33. Kuwana, M., Y. Okazaki, H. Kodama, T. Satoh, Y. Kawakami, Y. Ikeda. 2006. Endothelial differentiation potential of human monocyte-derived multipotential cells. Stem Cells 24: 2733-2743. [Medline]
  34. Passlick, B., D. Flieger, H. W. Ziegler-Heitbrock. 1989. Identification and characterization of a novel monocyte subpopulation in human peripheral blood. Blood 74: 2527-2534. [Abstract/Free Full Text]
  35. Kim, I., J. H. Kim, S. O. Moon, H. J. Kwak, N. G. Kim, G. Y. Koh. 2000. Angiopoietin-2 at high concentration can enhance endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Oncogene 19: 4549-4552. [Medline]
  36. Weber, C., G. Draude, K. S. Weber, J. Wubert, R. L. Lorenz, P. C. Weber. 1999. Downregulation by tumor necrosis factor-{alpha} of monocyte CCR2 expression and monocyte chemotactic protein-1-induced transendothelial migration is antagonized by oxidized low-density lipoprotein: a potential mechanism of monocyte retention in atherosclerotic lesions. Atherosclerosis 145: 115-123. [Medline]
  37. Chen, J. X., Y. Chen, L. DeBusk, W. Lin, P. C. Lin. 2004. Dual functional roles of Tie-2/angiopoietin in TNF-{alpha}-mediated angiogenesis. Am. J. Physiol. 287: H187-H195.
  38. Linn, T., J. Schmitz, I. Hauck-Schmalenberger, Y. Lai, R. G. Bretzel, H. Brandhorst, D. Brandhorst. 2006. Ischaemia is linked to inflammation and induction of angiogenesis in pancreatic islets. Clin. Exp. Immunol. 144: 179-187. [Medline]
  39. Ohno, S., Y. Ohno, N. Suzuki, T. Kamei, K. Koike, H. Inagawa, C. Kohchi, G. I. Soma, M. Inoue. 2004. Correlation of histological localization of tumor-associated macrophages with clinicopathological features in endometrial cancer. Anticancer Res. 24: 3335-3342. [Abstract/Free Full Text]
  40. Leek, R. D., C. E. Lewis, R. Whitehouse, M. Greenall, J. Clarke, A. L. Harris. 1996. Association of macrophage infiltration with angiogenesis and prognosis in invasive breast carcinoma. Cancer Res. 56: 4625-4629. [Abstract/Free Full Text]
  41. Negus, R. P., G. W. Stamp, J. Hadley, F. R. Balkwill. 1997. Quantitative assessment of the leukocyte infiltrate in ovarian cancer and its relationship to the expression of C-C chemokines. Am. J. Pathol. 150: 1723-1734. [Abstract]
  42. Krikun, G., F. Schatz, T. Finlay, S. Kadner, A. Mesia, R. Gerrets, C. J. Lockwood. 2000. Expression of angiopoietin-2 by human endometrial endothelial cells: regulation by hypoxia and inflammation. Biochem. Biophys. Res. Commun. 275: 159-163. [Medline]
  43. Wang, J., K. Wu, F. Bai, H. Zhai, H. Xie, Y. Du, J. Liang, S. Han, Y. Chen, T. Lin, D. Fan. 2006. Celecoxib could reverse the hypoxia-induced angiopoietin-2 upregulation in gastric cancer. Cancer Lett. 242: 20-27. [Medline]
  44. Gu, J., H. Yamamoto, M. Ogawa, C. Y. Ngan, K. Danno, H. Hemmi, N. Kyo, I. Takemasa, M. Ikeda, M. Sekimoto, M. Monden. 2006. Hypoxia-induced up-regulation of angiopoietin-2 in colorectal cancer. Oncol. Rep. 15: 779-783. [Medline]
  45. Colombo, M. P., G. Trinchieri. 2002. Interleukin-12 in anti-tumor immunity and immunotherapy. Cytokine Growth Factor Rev. 13: 155-168. [Medline]
  46. Voest, E. E., B. M. Kenyon, M. S. O’Reilly, G. Truitt, R. J. D’Amato, J. Folkman. 1995. Inhibition of angiogenesis in vivo by interleukin 12. J. Natl. Cancer Inst. 87: 581-586. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
G. Solinas, G. Germano, A. Mantovani, and P. Allavena
Tumor-associated macrophages (TAM) as major players of the cancer-related inflammation
J. Leukoc. Biol., November 1, 2009; 86(5): 1065 - 1073.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Apostolakis, G. Y.H. Lip, and E. Shantsila
Monocytes in heart failure: relationship to a deteriorating immune overreaction or a desperate attempt for tissue repair?
Cardiovasc Res, October 28, 2009; (2009) cvp327v2.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Pucci, M. A. Venneri, D. Biziato, A. Nonis, D. Moi, A. Sica, C. Di Serio, L. Naldini, and M. De Palma
A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships
Blood, July 23, 2009; 114(4): 901 - 914.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Figueroa-Vega, M. Alfonso-Perez, C. Cuesta-Mateos, F. Sanchez-Madrid, R. Moreno-Otero, R. Gonzalez-Amaro, and M. Marazuela
Tie-2 Is Overexpressed by Monocytes in Autoimmune Thyroid Disorders and Participates in Their Recruitment to the Thyroid Gland
J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2626 - 2633.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Errata
J. Leukoc. Biol., December 1, 2008; 84(6): 1623a - 1623.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. L. Tressel, H. Kim, C.-W. Ni, K. Chang, J. C. Velasquez-Castano, W. R. Taylor, Y.-s. Yoon, and H. Jo
Angiopoietin-2 Stimulates Blood Flow Recovery After Femoral Artery Occlusion by Inducing Inflammation and Arteriogenesis
Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 1989 - 1995.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Audoy-Remus, J.-F. Richard, D. Soulet, H. Zhou, P. Kubes, and L. Vallieres
Rod-Shaped Monocytes Patrol the Brain Vasculature and Give Rise to Perivascular Macrophages under the Influence of Proinflammatory Cytokines and Angiopoietin-2
J. Neurosci., October 8, 2008; 28(41): 10187 - 10199.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Voskas, Y. Babichev, L. S. Ling, J. Alami, Y. Shaked, R. S. Kerbel, B. Ciruna, and D. J. Dumont
An eosinophil immune response characterizes the inflammatory skin disease observed in Tie-2 transgenic mice
J. Leukoc. Biol., July 1, 2008; 84(1): 59 - 67.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. K. Biswas, A. Sica, and C. E. Lewis
Plasticity of Macrophage Function during Tumor Progression: Regulation by Distinct Molecular Mechanisms
J. Immunol., February 15, 2008; 180(4): 2011 - 2017.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. Maliba, A. Brkovic, P.-E. Neagoe, L. R. Villeneuve, and M. G. Sirois
Angiopoietin-mediated endothelial P-selectin translocation: cell signaling mechanisms
J. Leukoc. Biol., February 1, 2008; 83(2): 352 - 360.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. E. Lewis, M. De Palma, and L. Naldini
Tie2-Expressing Monocytes and Tumor Angiogenesis: Regulation by Hypoxia and Angiopoietin-2
Cancer Res., September 15, 2007; 67(18): 8429 - 8432.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murdoch, C.
Right arrow Articles by Lewis, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murdoch, C.
Right arrow Articles by Lewis, C. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS