|
|
||||||||
via Mitogen-Activated Kinase Phosphatase-1 in Airway Smooth Muscle Cells1Experimental Medicine, Airway Studies Section, National Heart and Lung Institute, Imperial College, London, United Kingdom
| Abstract |
|---|
|
|
|---|
(GRO-
), from airway smooth muscle cells (ASMC) is regulated by pathways involving NF-
B and MAPK activation. We determined the effects of dexamethasone on GRO-
induced by IL-1
or TNF-
with respect to the role of MAPK pathways and of MAPK phosphatase-1 (MKP-1). Human ASMC were studied in primary culture at confluence. Dexamethasone (108105 M) partially inhibited GRO-
expression and release induced by IL-1
and TNF-
; this was associated with an inhibition of JNK, but not of p38 or ERK phosphorylation. Together with IL-1
or TNF-
, dexamethasone rapidly induced mRNA and protein expression of MKP-1, which dephosphorylates MAPKs. Using MKP-1 small interfering RNA (siRNA) to block the expression of IL-1
- and dexamethasone-induced MKP-1 by 50%, JNK phosphorylation was doubled. The inhibitory effect of dexamethasone on GRO-
release was partially reversed in ASMC treated with MKP-1 siRNA compared with those treated with scrambled siRNA. In contrast, overexpression of MKP-1 led to a reduction in IL-1
-induced release of GRO-
, but the inhibitory effects of dexamethasone were preserved. Nuclear translocation of the glucocorticoid receptor was increased in ASMC exposed to dexamethasone and IL-1
. Using chromatin immunoprecipitation assay, glucocorticoid receptor binding to the MKP-1 promoter was increased by IL-1
and dexamethasone compared with either alone. Glucocorticoids and IL-1
or TNF-
modulate GRO-
release partly through the inhibition of JNK pathway, resulting from an up-regulation of MKP-1 expression. | Introduction |
|---|
|
|
|---|
(GRO-
) in response to inflammatory mediators (2, 3, 4, 5, 6, 7), and may therefore be important effector cells in lung inflammation. GRO-
expression and release induced by IL-1
or TNF-
are dependent on the activation of MAPK pathways and of the pathways associated with the activation of the transcription factor, NF-
B (5). The MAPKs are part of intracellular signal transduction pathways that are induced by proinflammatory cytokines such as IL-1
or TNF-
, and regulate the expression of many proinflammatory genes, growth factors, and adhesion molecules (8). An endogenous negative regulatory pathway, the MAPK phosphatases (MKPs), deactivates MAPKs by dephosphorylation of their tyrosine and threonine motifs. Of the 10 mammalian MKPs described (9), MKP-1 has been the most studied. With a broad specificity, MKP-1 is capable of deactivating JNK, ERK, and p38 MAPK (10, 11).
Corticosteroids are an important treatment of many airway inflammatory conditions, such as asthma, and contribute their beneficial anti-inflammatory effects by suppressing the expression of proinflammatory cytokines. This anti-inflammatory effect is also observed on ASMC, because corticosteroids have inhibitory effects on the induced expression and release of many proinflammatory cytokines, such as RANTES, IL-8, eotaxin, and GM-CSF (2, 4, 5, 6). However, the effects of corticosteroids on GRO-
release are unknown. In this study, we determined whether corticosteroids could inhibit GRO-
expression and release from ASMC, and the mechanisms of corticosteroid effects by examining their effects on MAPK and NF-
B activation pathways. We particularly evaluated the role of MPK-1 in the release of GRO-
induced by a combination of IL-1
or TNF-
and dexamethasone. We found that this combination was particularly effective in inducing MPK-1 expression, which in turn modulated JNK activation, which was sensitive to inhibition by corticosteroids. The inhibitory effect of dexamethasone on GRO-
release was partly dependent on MPK-1 induction.
| Materials and Methods |
|---|
|
|
|---|
All tissue culture reagents and chemicals were obtained from Sigma-Aldrich, unless otherwise stated. Protease inhibitor mixture was obtained from Roche Diagnostic. Cell culture plasticware was purchased from Falcon Labware (BD Biosciences). Human rIL-1
and rTNF-
, as well as the matched Ab pairs for GRO-
ELISA were purchased from R&D Systems. The Abs for Western blotting (JNK; phospho-JNK) were purchased from New England Biolabs, whereas the MKP-1 Ab was purchase from Santa Cruz Biotechnology.
Isolation of human ASMC
Human ASMC were dissected out from lobar or main bronchus obtained from patients undergoing lung resection for carcinoma of the bronchus, as previously described (2, 12). Cells were maintained in DMEM containing 10% FCS supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acids (1/100), penicillin (100 U/ml1), streptomycin (100 µg/ml1), and amphotericin B (1.5 µg/ml1) in a humidified atmosphere at 37°C in air/CO2 (95:5% v/v). Confluent cells were passaged with 0.25% trypsin and 1 mM EDTA. Human ASMC at passages 37 from 12 different donors were used in the studies described below. ASMC were characterized by positive immunostaining with an anti-calponin, anti-smooth muscle
-actin, and anti-myosin H chain Abs (all at 1/400; Sigma-Aldrich).
Measurement of GRO-
Human ASMC were serum deprived for 24 h using serum-free medium (SFM), which consists of DMEM supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acids (1/100), penicillin (100 U/ml)/streptomycin (10,000 µg/ml1), amphotericin B (1.5 µg/ml1), BSA (0.1%), and ascorbic acid (100 µM). Cells were stimulated in duplicate for 24 h in fresh SFM containing cytokines, IL-1
(0.01 ng/ml1), or TNF-
(1 ng/ml1). After 24 h, the supernatants were collected and stored at 20°C. GRO-
levels were measured by using dual set ELISA kit (R&D Systems), according to the manufacturers instructions. The samples were diluted until the cytokine level was within the linear range of the standard curve. The detection threshold was 31.25 pg/ml1.
RNA preparation and real-time PCR
Cells were plated at a seeding density of 1 x 104 cells/cm2 in six-well plates. The 24-h serum-deprived cells were stimulated in duplicate with IL-1
(0.1 ng/ml1) or TNF-
(1 ng/ml1) either alone or in the presence of dexamethasone (108105 M) for either 1 or 24 h. Cells were harvested and total RNA was isolated using the Qiagen RNase easy extraction kit (RNeasy Mini; Qiagen), according to the manufacturers instructions. First-strand cDNA was synthesized in a volume of 60 µl containing 0.25 µg of total RNA. For the real-time PCR, 0.5 µl of the RT-PCR first strand cDNA and 0.5 µM primers were used in total 20-µl reaction containing 10 µl of Universal SYBR Green Master Mix (Qiagen) using a Rotor-Gene 3000TM Four-Channel Multiplexing System (Corbett Research).
The primers used were as follows: GRO-
, ATGGCCCGCGCTGCTCTCTCC (forward) and GTTGGATTTGTCACTGTTCAG (reverse); GAPDH, GAAGATGGTGATGGGATTTC (forward) and GAAGGTGAAGGTCGGAGT (reverse); MKP-1, GTACATCAAGTCCATCTGAC (forward) and GGTTCTTCTAGGAGTAGACA (reverse); and 18S, TGAAGAACGAAAGTGGGAGGT (forward) and GGACATCTAAGGGCATCACAG (reverse).
A standard was generated for the internal control and the test primer using a serial dilution of a sample as a template. The conditions of the reaction were as follows: denature at 95°C for 15 min, followed by denaturing step (20 s at 94°C) and annealing step (60°C for 20 s) for 45 cycles. GAPDH or 18S expression was performed in a parallel tube, and all reactions were undertaken in duplicate. Target mRNA was normalized to GAPDH mRNA, expressed relative to control, which was given a value of 1 for each donor.
Effect of dexamethasone on GRO-
expression
ASMC were serum deprived for 24 h. The cells were preincubated for 1 h with dexamethasone (108105 M) or diluents alone in fresh SFM before addition of IL-1
(0.1 ng/ml1) or TNF-
(1 ng/ml1). The supernatants were collected after 24-h incubation at 37°C in a CO2 incubator and stored at 20°C. RNA was extracted from the remaining cells, as described earlier. Colorimetric dyes, MTT, and crystal violet were used to measure the viability of cells.
Western blot of phosphorylated JNK, ERK, p38 MAPK, and MKP-1
Serum-deprived cells at a seeding density of 1 x 104 cells/cm2 in SFM for 24 h were preincubated for 1 h with either 1 µM dexamethasone or the diluent alone in fresh SFM before addition of either IL-1
(0.1 ng/ml1) or TNF-
(1 ng/ml1). The cells were collected after incubation at 37°C in a CO2 incubator. The cells were rinsed with ice-cold PBS and lysed in radioimmunoprecipitation assay buffer (PBS containing 0.5% sodium deoxycholate, 0.1% SDS, 1% Igepal, 200 µM Na3VO4, and protease inhibitor mixture (1 tablet/10 ml buffer)). Cells were scraped off the wells and followed by centrifugation (10,000 x g, 4°C, 4 min). Protein concentrations were determined using a protein assay reagent kit (Pierce).
Total protein extracts heated at 90°C for 5 min were separated by SDS-PAGE (10 µg per lane) using 412% polyacrylamide precast gel (NOVEX; Invitrogen Life Technologies), transferred to membranes, and blotted with anti-MKP-1 Ab (Santa Cruz Biotechnology) or anti-phosphorylated threonine and tyrosine residues of JNK, p42/44 ERK, or p38-MAPK (all 1/1,000), according to the manufacturers instruction (New England Biolabs). After washing with PBS/T, the membrane was incubated with HRP-conjugated secondary Ab (goat anti-rabbit IgG 1/2,000) for 1 h at room temperature. Membranes were thoroughly washed with PBS/T and visualized by ECL (LumiGLO; Kirkegaard & Perry Laboratories). The membranes were reprobed with anti-JNK Ab. To confirm the equal protein loading, a mouse anti-GAPDH mAb (1/20,000; clone 6G5; Biogenesis) was also applied.
Band intensities on autoradiographs were quantified using software from Ultraviolet Products. Densitometric data for the phosphorylated band were normalized for equal loading by dividing the phosphorylated value to total nonphosphorylated band or GAPDH, and then normalized to control cells, which were set to 1.0.
Small interfering RNAs (siRNAs) against MKP-1 and MKP-1 overexpression vector
MKP-1 was inhibited by using RNA interference technology. Human ASMC were transiently transfected with MKP-1-specific siRNA, a SMART pool consisting of four siRNAs designed by Dharmacon. As a control for the siRNA, a scrambled sequence that was not complementary to any known genes was also transfected.
Cells were also transfected with pFlagCMV2 alone or containing MKP-1 overexpression vector obtained as a gift from A. Clark (Kennedy Institute of Rheumatology Division, Imperial College, London, U.K.) (13).
The Amaxas Nucleofector electroporation method was used to transfect the siRNA into ASMC, using the manufacturers protocol. We used cotransfection of pmaxGFP (Amaxa), encoding the GFP with a siRNA directed against maxGFP. We monitored the success of gene silencing as a decrease of green fluorescence compared with control sample using fluorescence microscopy. We also transfected the cells with RNA-induced silencing complex-free CY3-labeled siRNA and used confocal microscopy to monitor transfection. Semiconfluent ASMC transfected with MKP-1 siRNA were starved for an additional 24 h, followed by treatment with IL-1
. After 1 h, MKP-1 mRNA was measured using real-time RT-PCR, and after 30 min, 1 h, or 24 h, MKP-1 and phospho-JNK were measured by Western blot analysis. Supernatants were collected after 24 h to measure GRO-
release by ELISA.
Immunocytochemistry
Immunostaining was performed to detect the nuclear translocation of glucocorticoid receptor (GR) induced by dexamethasone and IL-1
in human ASMC cultures on chamber slides. Cells were fixed and permeabilized, and nonspecific binding was blocked, followed by incubation with control or the primary anti-GR Ab (1/100; Santa Cruz Biotechnology) overnight at 4°C. After washing, Rhodamine Red-X-conjugated donkey anti-rabbit IgG 1/200 (Jackson ImmunoResearch Laboratories) was applied at room temperature, followed by thorough washing, then staining with 4',6'-diamidino-2-phenylindole (300 nM). Staining was visualized using confocal microscopy.
Measurements of NF-
B- and GR-binding activities
We determined the effect of dexamethasone on NF-
B- and GR DNA-binding activities in ASMC using an ELISA-based assay (TransAM Transcription Factor Assay kit; Active Motif). Briefly, ASMC were pretreated with dexamethasone (106 M) or medium only for 1 h, followed by adding IL-1
(0.1 ng/ml1) or medium for additional 1 h. Nuclear extracts were used to determine the binding activity of p65, a component of NF-
B, or the binding activity of GR, according to the manufacturers instructions.
Chromatin immunoprecipitation (ChIP) assay
We applied ChIP assay to determine the status of the GR binding site at the promoter region of the MKP-1 gene in response to IL-1
in the presence of dexamethasone. The ChIP assay is a powerful technique to determine true in vivo binding of transcription factors and other nucleosomal proteins to chromatin. As described before (5), ASMC exposed to dexamethasone (106 M) or DMEM alone for 1 h before adding IL-1
(0.1 ng/ml1) were collected, and protein-DNA complexes were cross-linked with 1% formaldehyde. Following lysis and sonication, supernatants were collected, and one-tenth of the total lysate was used for total genomic DNA as input DNA control. From the rest of the supernatant, the soluble chromatin solution was immunoprecipitated by using anti-GR or p65 Ab (Santa Cruz Biotechnology). Protein-bound immunoprecipitated DNA fragments were purified with phenol/chloroform and the pellet was resuspended in nuclease-free water. Quantitative PCR was performed with DNA sample from both sample and input (Rotor-Gene 3000TM Four-Channel Multiplexing System; Corbett Research) with a QuantiTect SYBR Green PCR Kit (Qiagen) to quantify the immunoprecipitated DNA. The PCR primers corresponding to sequences within the NF-
B binding site on the GRO-
promoter reagent were: forward (5'-CGT CGC CTT CCT TCC GGA CTC G-3') and reverse (5'-GCT CTC CGA GAT CCG CGA ACCC-3'). The putative GRE binding site on MKP-1 promoter reagent was used to design the PCR primers for GRE: forward (5'-TT GCT TTC GGC CTA TAA CG-3') and reverse (5'-TGA GCT TCT CCA TCC CTT TC). Cycling parameters were 95°C for 15 min to activate HotStarTaq DNA polymerase, followed by annealing and extension at 45 cycles of 94°C for 15 s, 60°C for 25 s, and 72°C for 25 s. The samples were normalized with each corresponding input. Data were expressed relative to the untreated control, which was given a value of 1 for each donor.
Data analysis
Data are presented as mean ± SEM. Data were compared using one-way ANOVA, followed by Newman-Keuls test post hoc to determine statistical differences after multiple comparisons. A p value of <0.05 was considered significant.
| Results |
|---|
|
|
|---|
expression and release
Dexamethasone (108105 M) partly inhibited IL-1
(0.1 ng/ml1)- or TNF-
(1 ng/ml1)-induced GRO-
mRNA expression, with a maximal inhibition of 50 and 60% at 10 µM, respectively (p
0.01) (Fig. 1, A and B). Dexamethasone also partly attenuated GRO-
protein release stimulated by IL-1
(p
0.001; n = 5) and by TNF-
(p
0.05; n = 3) (Fig. 1, C and D). Neither IL-1
, TNF-
, dexamethasone, nor the combination had any effect on cell viability.
|
B DNA binding
To investigate the effect of dexamethasone on GR nuclear translocation, we performed immunostaining of ASMC with an anti-GR Ab. Dexamethasone increased GR nuclear translocation in untreated cells as measured by immunostaining, whereas IL-1
or TNF-
alone had no effect; there was no further effect with the combination of IL-1
or TNF-
with dexamethasone (Fig. 2A). These observations were confirmed by the measurement of GR-binding activity, which was increased by dexamethasone, but not IL-1
or TNF-
(data not shown). We investigated the effect of dexamethasone on p65 DNA-binding activity and on p65 binding to the GRO-
promoter by ChIP assay. Dexamethasone (106 M) alone had no effect on either total NF-
B activity or p65 binding on GRO-
promoter. IL-1
or TNF-
alone increased p65 activity, and this effect was further enhanced by 2030%, respectively, in the presence of dexamethasone (Fig. 2, B and C). IL-1
, but not dexamethasone, increased p65 binding on GRO-
promoter (Fig. 2D).
|
inhibition
To determine the role of chromatin remodeling in dexamethasones inhibition of IL-1
-induced GRO-
release, we studied the effect of the inhibitor of histone deacetylase, TSA. TSA (100 ng/ml) caused a significant reversal of dexamethasones effect. To determine whether TSA could interfere with MKP-1 expression, we examined the effect of TSA (100 ng/ml) on dexamethasone and IL-1
-induced MKP-1 mRNA expression measured by real-time PCR. We found that TSA had no significant effect (data not shown).
Effect of dexamethasone on MAPK phosphorylation
To investigate whether dexamethasone acted through MAPK pathway to inhibit GRO-
release, we studied its effect on JNK, ERK, and p38 MAPK phosphorylation. Human ASMC stimulated with IL-1
or TNF-
for 30 min enhanced the phosphorylation of JNK; pretreatment with dexamethasone (106 M) for 1 h significantly inhibited IL-1
- or TNF-
-induced JNK phosphorylation (Fig. 3, AC). Although IL-1
also caused activation of p42/44 ERK and p38 MAPK, there was no significant effect of dexamethasone on these effects (Fig. 3, DG).
|
MKP-1 mRNA was increased following treatment with dexamethasone (106 M) alone with a maximal effect at 2 h. TNF-
(1 ng/ml1) and IL-1
(0.1 ng/ml1) also increased MKP-1 mRNA expression with a maximum effect at 1 h. Dexamethasone (106 M) enhanced MKP-1 induced by IL-1
or TNF-
(Fig. 4, A and B). Dexamethasone or IL-1
alone significantly increased MKP-1 protein expression transiently at 1 h, as measured by Western blotting. There was a greater increase in expression with dexamethasone and IL-1
added together (p
0.001; n = 4; Fig. 4, C and D), with maximal induction at 1 h, and persisting with less abundance at 24 h.
|
We first determined whether we could transfect siRNA into ASMC by using Cy3-conjugated siRNA with pmaxGFP and by detecting the presence of Cy3 within the cytoplasm by confocal microscopy. GFP plasmid and Cy3-labeled siRNA fluorescence were detected in the majority of the cells at 24 h after electroporation (data not shown). Cells transfected with MKP-1 SMART pool siRNA and treated with IL-1
showed a significant reduction of MKP-1 expression (p
0.001; n = 3) compared with cells exposed to scrambled siRNA. Similarly, MKP-1-siRNA-transfected cells treated with IL-1
and dexamethasone (106 M) showed a significant reduction in dexamethasone-induced MKP-1 mRNA and protein expression when compared with cells treated with scrambled control (p
0.001; n = 3; Fig. 5, A and B). The inhibition of MKP-1 was observed at 30 min, 1 h, and 24 h (Fig. 5C).
|
or the combination of IL-1
and dexamethasone (Fig. 6A). This effect was observed at 30 min and 1 h, but not at 24 h (Fig. 6B). This indicates that the inhibition of MKP-1 reversed dexamethasones inhibitory effect on JNK activation induced by IL-1
. In contrast, transfection with MKP-1 siRNA had no effect on phospho-ERK and phospho-p38 expression induced by IL-1
, dexamethasone, or both (Fig. 6, C and D).
|
and dexamethasone were assayed for GRO-
. ASMC treated with MKP-1 siRNA showed significantly increased GRO-
release in the presence of IL-1
or the combination of IL-1
and dexamethasone (Fig. 6E). However, in these cells, dexamethasone did not significantly inhibit the release of GRO-
induced by IL-1
, in contrast to the inhibition observed in the cells treated with scrambled siRNA. Effect of MKP-1 overexpression
Transfection with the vector pCMV-Flag-MKP-1 increased MKP-1 mRNA and protein expression in dexamethasone (106 M)- and IL-1
(0.1 ng/ml1)-treated cells compared with those transfected with empty vector (Fig. 7, A and B). There was a greater induction of MKP-1 protein in MKP-1-overexpressing cells induced by IL-1
and dexamethasone compared with those transfected with empty vector (Fig. 7B). MKP-1-transfected cells caused significantly less release of GRO-
when exposed to either IL-1
or the combination of IL-1
and dexamethasone (Fig. 7C). However, dexamethasone significantly inhibited IL-1
-induced GRO-
release in both MKP-1-transfected and nontransfected cells (Fig. 7C).
|
Normalized samples with total input DNA control amplification (input DNA) showed a marked enrichment of the MKP-1 promoter DNA after dexamethasone treatment, which was further increased following both dexamethasone and IL-1
(p
0.001 compared with dexamethasone alone; n = 3; Fig. 8).
|
| Discussion |
|---|
|
|
|---|
gene and protein induced by IL-1
or TNF-
are partially inhibited by dexamethasone, and that this effect is also partly due to inhibition of activation of JNK, but not of the other MAPKs, namely ERK and p38. We further determined that dexamethasones regulation of JNK activity was through MKP-1 because we demonstrated that dexamethasone together with IL-1
or TNF-
caused an increase in MKP-1 gene and protein expression. Furthermore, we used siRNA to knock down the expression of MKP-1, which led to an increase in JNK activation and to a failure of dexamethasone to inhibit JNK activation. Under these conditions, there was a failure of dexamethasone to inhibit GRO-
release. Using an overexpression system to up-regulate MKP-1 expression, we showed an increase in JNK activity, and the ability of dexamethasone to partially inhibit GRO-
release was preserved. Therefore, dexamethasones inhibitory effect on GRO-
release is partly regulated by its inhibitory effect on JNK activity, which is in turn regulated by MKP-1 expression.
We have shown previously that IL-1
- and TNF-
-stimulated expression of GRO-
from ASMC is regulated by independent pathways involving NF-
B activation and ERK and JNK pathways (5). The GRO-
promoter region contains NF-
B DNA binding sites (14), and NF-
B activation represents an important pathway mediating GRO-
secretion in several cell types, including ASMC. Both IL-1
and TNF-
stimulate NF-
B activation in ASMC (15, 16), and TNF-
-induced expression of the chemokines, IL-8 and eotaxin, has been shown to be NF-
B dependent (17, 18). We have shown that GRO-
expression is dependent on the activation of NF-
B because an inhibitor of the I
B kinase complex that promotes the degradation of I
B proteins and activates NF-
B inhibited IL-1
- and TNF-
-induced GRO-
expression (5).
We confirmed the effect of corticosteroids in activating translocation of GR to the nucleus, but corticosteroids inhibited neither the global binding of p65 to DNA, as previously reported (16, 17), nor, more importantly, the specific binding of p65 component of NF-
B to the promoter of GRO-
. In contrast, dexamethasone increased both IL-1
- and TNF-
-induced p65-binding activity. This small, but significant effect is unlikely to be biologically relevant to GRO-
regulation because the more specific binding of p65 to the GRO-
promoter was not affected by dexamethasone, as measured by ChIP. However, corticosteroids may act through histone acetylation and chromatin remodeling, a mechanism previously reported, implying the recruitment of histone deacetylase activity by corticosteroids (19), as demonstrated by the reversal of dexamethasone inhibition of GRO-
release by the histone deacetylase inhibitor, TSA. Up-regulation of MKP-1 expression by dexamethasone, IL-1
, or both together may not be modulated through chromatin remodeling, but further studies are needed because this evidence is based on the use of TSA. It is more likely that this may involve another gene product related to GRO-
, independent of MKP-1 transcription.
In this study, we demonstrate another mechanism of corticosteroid inhibition of GRO-
through the induction of MKP-1. Dexamethasone has been shown previously to induce the expression of MKP-1, a dual specificity phosphatase that potently inactivates all MAPKs in rat mast cells, murine macrophage cell line, a breast cancer cell line, and fibroblast-like synoviocytes (13, 20, 21, 22), whereas we now demonstrate this in a primary cell line. As in previous studies, the induction was very rapid, occurring within 1 h. In contrast to some studies, but similar to those in Hela cells, we found a potentiation of MKP-1 expression with the combination of IL-1
and dexamethasone, with IL-1
or dexamethasone on their own having only a modest effect. Although MKP-1 preferentially inactivates MAPK p38 and JNK (10) and although it can also dephosphorylate ERK (23, 24), we found that corticosteroids caused an inhibition of the activity of JNK, but not of p38 or ERK. This is compatible with our previous observation that a selective inhibitor of JNK, SP100625, but not a p38 MAPK inhibitor, SB203508, inhibited IL-1
- or TNF-
-induced GRO-
(5). In addition, knockdown of MKP-1 with MKP-1 siRNA did not affect phosphorylated p38 and ERK activities and, therefore, specifically inhibited JNK activity. Thus, MKP-1 appears to be an important negative regulator of the inflammatory response through the inactivation of JNK specifically; we now provide evidence that MKP-1 partly mediates the suppression of GRO-
release from ASMC. The selectivity of MKP-1 for JNK inactivation in ASMC is unclear and may appear to be unique for this cell type. In U937 cells, MKP-1 rapidly inactivated JNK and p38, whereas ERK phosphorylation remained unchanged up to 6 h (10). Whether this may be dependent on the relative level of MKP-1 expression is a possibility that needs to be addressed.
We investigated to some extent the mechanisms of induction of MKP-1 by demonstrating that dexamethasone caused an increase in GR binding to the promoter site of MKP-1, and at least three putative glucocorticoid response elements in the promoter region of MKP-1 have been described (20). Others have shown in other cell types, such as mesangial cells and non-small cell lung cancer cells, that all-trans retinoic acid, a ligand for retinoic acid nuclear receptors, inhibits JNK activity by suppressing JNK phosphorylation through an increase in the expression of MKP-1 (25, 26). Through this mechanism, retinoids may have an antiapoptotic effect in oxidative stress (25). This mechanism of action of retinoids is reminiscent of that of corticosteroids demonstrated in this study. The expression and activity of MKP-1 are not only dependent on gene expression, but also on its stability, which can be dependent on ERK-mediated phosphorylation (27). Such a mechanism, however, would not be interfered with by dexamethasone in ASMC.
Previous investigators have used MKP-1 inhibitors, such as Ro-31-8220 and triptolide, to investigate the role of MKP-1 (21, 28, 29); however, we found that these inhibitors were toxic to ASMC in culture and, in addition, these inhibitors were unlikely to be selective for MKP-1. For example, Ro-31-8220 is an inhibitor of protein kinase C and raf-1, although it is claimed that this compound inhibits MKP-1 expression independent of these effects in different cell types (30, 31). The studies using these inhibitors demonstrate that MKP-1 is a critical negative regulator of the release of inflammatory cytokines from murine macrophages or synoviocytes (21, 28, 29). Using MKP-1/ macrophages, Zhao et al. (32) demonstrated that these murine cells produce more TNF-
, IL-6, and IL-10 when challenged with LPS compared with wild-type macrophages. Although there has been less success in knocking down MKP-1 using antisense oligonucleotides or siRNA approach (13, 33), we have shown more effect with transfection of ASMC with MKP-1 siRNA that led to an enhancement of GRO-
release with IL-1
stimulation.
Because we were unable to use MKP-1 inhibitors to study ASMC, we relied on the siRNA approach to selectively inhibit MKP-1. Using this method to reduce MKP-1, we showed that MKP-1 protein expression induced by IL-1
or by IL-1
and dexamethasone was reduced by at least half, an effect associated with a concomitant increase in JNK activity as measured by phosphorylated JNK expression. Under these conditions, GRO-
release induced by IL-1
increased, and dexamethasone was less efficient in inducing GRO-
inhibition. We also used a converse approach, which was to overexpress MKP-1, as follows: in unstimulated cells, the gene expression was increased
2-fold, whereas dexamethasone also led to a 2-fold greater expression. Under these conditions, GRO-
release induced by IL-1
was reduced, and dexamethasone continued to inhibit GRO-
release induced by IL-1
. Taking the effects of MKP-1 knockdown and MKP-1 overexpression together, we conclude that MKP-1 induced by dexamethasone and IL-1
or TNF-
is an important mediator of corticosteroid effects.
Corticosteroids are widely used as anti-inflammatory agents in chronic inflammatory conditions such as asthma. ASMC may be a source of cytokines and chemokines such as GRO-
, which could be responsible in maintaining chronic inflammation in the airways of patients with asthma. We demonstrate that corticosteroids can directly up-regulate MKP-1 expression, most likely through binding of the GR to positive GRE sites on the MKP-1 promoter. Part of the effect of corticosteroid action in inhibiting GRO-
expression is through the specific inhibition of the MAPK, JNK, by up-regulated MKP-1 expression. Other mechanisms of inhibition of GRO-
by corticosteroids are likely to include effects through histone acetylation and chromatin remodeling, but unlikely to involve the inhibition of p65 binding on the GRO-
promoter. Corticosteroids also inhibit cytokines or chemokines other than GRO-
; it is likely that the MKP-1 mechanism of corticosteroids inhibitory effects would also apply to these other cytokines/chemokines. Thus, in ASMC, the release of GM-CSF, IL-8, and RANTES induced by IL-1
or TNF-
is dependent on JNK activation (34). IL-1
is also able to induce a range of other gene classes in ASMC, including proteases, enzymes, cytokine receptors, and transcription factors (35), which could be regulated by corticosteroids through induction of MKP-1. Therefore, our results that relate specifically to GRO-
regulation may have wider implications as a mechanism of effect of corticosteroids in ASMC.
| Acknowledgment |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Wellcome Trust. ![]()
2 Address correspondence and reprint requests to Dr. Kian Fan Chung, National Heart and Lung Institute, Imperial College, Dovehouse Street, London SW3 6LY, U.K. E-mail address: f.chung{at}imperial.ac.uk ![]()
3 Abbreviations used in this paper: ASMC, airway smooth muscle cell; ChIP, chromatin immunoprecipitation; GR, glucocorticoid receptor; GRO-
, growth-related oncogene protein-
; MKP, MAPK phosphatase; SFM, serum-free medium; siRNA, small interfering RNA; TSA, trichostatin A. ![]()
Received for publication July 10, 2006. Accepted for publication March 27, 2007.
| References |
|---|
|
|
|---|
and TNF
: effects of IL-10 and corticosteroids. Br. J. Pharmacol. 127: 1145-1150.
regulation in airway smooth muscle by IL-1
and TNF-
: role of NF-
B and MAP kinases. Am. J. Physiol. 291: L66-L74.
B-dependent transcriptional activation. J. Clin. Invest. 97: 421-430. [Medline]
and JNK MAP kinases mediate catalytic activation and substrate selectivity of MAP kinase phosphatase-1. J. Biol. Chem. 276: 16491-16500.
B-like transcription factor mediates IL-1/TNF-
induction of GRO in human fibroblasts. J. Immunol. 147: 520-527. [Abstract]
B in IL-1
-induced VCAM-1 expression in human tracheal smooth muscle cells. Am. J. Physiol. 288: L227-L237.
B-dependent signaling pathway that is only partially sensitive to dexamethasone. J. Immunol. 163: 2128-2134.
agonists: interactions with glucocorticoids and
2-agonists. J. Biol. Chem. 280: 2550-2561.
B mediated inflammation by siRNA expressed by recombinant adeno-associated virus. J. Virol. Methods 120: 119-122. [Medline]
-induced histone H4 acetylation on lysines 8 and 12. Mol. Cell. Biol. 20: 6891-6903.
and glucocorticoids. Arthritis Rheum. 50: 3118-3128. [Medline]
cytotoxicity can be achieved through different signaling pathways in rat mesangial cells. Am. J. Physiol. 276: C435-C441. [Medline]
, interleukin-13 and transforming growth factor-
on gene expression in human airway smooth muscle using gene microarrays. Eur. J. Pharmacol. 497: 255-265. [Medline]This article has been cited by other articles:
![]() |
S. M. Wilson, P. Shen, C. F. Rider, S. L. Traves, D. Proud, R. Newton, and M. A. Giembycz Selective Prostacyclin Receptor Agonism Augments Glucocorticoid-Induced Gene Expression in Human Bronchial Epithelial Cells J. Immunol., November 15, 2009; 183(10): 6788 - 6799. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. King, N. S. Holden, W. Gong, C. F. Rider, and R. Newton Inhibition of NF-{kappa}B-dependent Transcription by MKP-1: TRANSCRIPTIONAL REPRESSION BY GLUCOCORTICOIDS OCCURRING VIA p38 MAPK J. Biol. Chem., September 25, 2009; 284(39): 26803 - 26815. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Clark, J. R. S. Martins, and C. R. Tchen Role of Dual Specificity Phosphatases in Biological Responses to Glucocorticoids J. Biol. Chem., September 19, 2008; 283(38): 25765 - 25769. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Quante, Y. C. Ng, E. E. Ramsay, S. Henness, J. C. Allen, J. Parmentier, Q. Ge, and A. J. Ammit Corticosteroids Reduce IL-6 in ASM Cells via Up-Regulation of MKP-1 Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 208 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. N. Kang, J. A. Jude, R. A. Panettieri Jr., T. F. Walseth, and M. S. Kannan Glucocorticoid regulation of CD38 expression in human airway smooth muscle cells: role of dual specificity phosphatase 1 Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L186 - L193. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yang, J. Wu, C. M. Martin, P. R. Kvietys, and T. Rui Important role of p38 MAP kinase/NF-{kappa}B signaling pathway in the sepsis-induced conversion of cardiac myocytes to a proinflammatory phenotype Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H994 - H1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Newton and N. S. Holden Separating Transrepression and Transactivation: A Distressing Divorce for the Glucocorticoid Receptor? Mol. Pharmacol., October 1, 2007; 72(4): 799 - 809. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |