The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 178: 7162-7172.
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiina, T.
Right arrow Articles by Miller, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiina, T.
Right arrow Articles by Miller, M. M.

Extended Gene Map Reveals Tripartite Motif, C-Type Lectin, and Ig Superfamily Type Genes within a Subregion of the Chicken MHC-B Affecting Infectious Disease1,2

Takashi Shiina*, W. Elwood Briles{dagger}, Ronald M. Goto{ddagger}, Kazuyoshi Hosomichi*, Kazuyo Yanagiya*, Sayoko Shimizu*, Hidetoshi Inoko* and Marcia M. Miller3,{ddagger}

* Division of Basic Medical Science and Molecular Medicine, Department of Molecular Life Science, Tokai University School of Medicine, Kanagawa, Japan; {dagger} Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115; and {ddagger} Division of Molecular Biology, Beckman Research Institute, City of Hope National Medical Center, Duarte, CA 91010


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
MHC haplotypes have a remarkable influence on whether tumors form following infection of chickens with oncogenic Marek’s disease herpesvirus. Although resistance to tumor formation has been mapped to a subregion of the chicken MHC-B region, the gene or genes responsible have not been identified. A full gene map of the subregion has been lacking. We have expanded the MHC-B region gene map beyond the 92-kb core previously reported for another haplotype revealing the presence of 46 genes within 242 kb in the Red Jungle Fowl haplotype. Even though MHC-B is structured differently, many of the newly revealed genes are related to loci typical of the MHC in other species. Other MHC-B loci are homologs of genes found within MHC paralogous regions (regions thought to be derived from ancient duplications of a primordial immune defense complex where genes have undergone differential silencing over evolutionary time) on other chromosomes. Still others are similar to genes that define the NK complex in mammals. Many of the newly mapped genes display allelic variability and fall within the MHC-B subregion previously shown to affect the formation of Marek’s disease tumors and hence are candidates for genes conferring resistance.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The MHC has long been recognized as an immune-regulatory system important in regard to disease susceptibility and resistance. Autoimmune disease associations with HLA are sometimes reported for alleles at individual loci, but with few exceptions it is difficult to understand whether individual loci or other genes nearby are actually responsible for the observed effect. In the chicken, MHC-B haplotypes, until recently distinguished primarily by serological methods, display strong influences in several infectious diseases (1, 2, 3, 4, 5). Resistance to Marek’s disease tumors was mapped to a gene, or genes, closely linked to serologically-defined MHC-B class I (as opposed to BG Ags) in analyses of rMHC-B haplotypes (6, 7, 8). Because MHC-B haplotypes reproducibly influence the incidence of Marek’s disease in experimental lines and these haplotypes are subject to periodic recombination, it may be possible to determine the contribution of individual genes to disease incidence and make progress in defining pathogen-host interactions that drive MHC gene evolution.

As in many other species, the MHC gene complex in the chicken is characterized by the presence of class I, II, and III genes. However, the organization of these genes in the chicken is different from that in other organisms studied so far. Unlike the large single complexes found in humans and many other mammals or the highly dispersed arrangement of MHC genes found in fish (9), the MHC in the chicken is divided into two major regions, MHC-Y (Y) and MHC-B (B), located on the same microchromosome (GGA16) but separated by a crossover breakpoint that results in Y and B haplotypes assorting independently at meiosis (10). In the Y region, distinctive, well-expressed class I genes are intertwined with specialized class II and C-type lectin-like loci (Refs. 11, 12, 13 , M. M. Miller, R. Goto, T. Shiina, and H. Inoko, unpublished data). In the B region, a small minimal core of 66 kb is made up of class I and II genes found in linkage with additional genes typically resident within the MHC including two genes typical of a class III region (14). What lies beyond the class I, II, and III genes found at the core of the B region is only partially known. There are two C-type lectin-like genes linked with the core (14, 15). One is a C-type lectin-like locus (Blec2 or BNK) that is well-expressed in NK cells and is structurally similar to human NKR-P1. The second lectin locus (Blec1) is likely an early activation Ag. Not yet fully sequenced but known to be tightly linked with B class I and II by means of serology is the large family of highly polymorphic Ig superfamily (IgSF)4 genes encoding BG Ags (sometimes called zipper proteins) that are well-expressed on erythrocytes and other tissues (16, 17, 18, 19). BG ectodomains share sequence similarities with mammalian MHC butyrophilin (BTN) and myelin oligodendrocyte glycoprotein (MOG) (20). A short distance away (5.6 cM) from the minimal core is a partially defined region containing a class II{alpha} gene locus (21). Tripartite motif (TRIM)-like genes, two CD1 genes, and a tenascin-like gene (TNXB, also called TN-Y) were mapped recently to the B vicinity by regional sequencing and physical mapping, but a full map of B is still lacking (22, 23, 24, 25).

With the goal of defining the genes responsible for the strong association between B haplotype and resistance to infectious disease, we set out to expand the B gene map and determine which genes lie within the subregion affecting Marek’s disease tumors. We obtained the sequence for an interval spanning the region from BG3 (representing the BG Ag family) to CD1A1 within the Red Jungle Fowl (RJF) haplotype and analyzed this in the context of MHC gene maps for other species. To evaluate interhaplotype variability in gene structure and polymorphism, we compared the RJF haplotype to the previously published sequence from the B12 haplotype. Using the map as a guide, we localized the crossover breakpoint identifying genes within the region affecting Marek’s disease tumors thereby defining a subgroup of genes that may be under selection by this viral pathogen.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Construction of a bacterial artificial chromosome (BAC) based contig map

Membrane-filter sets for four BAC libraries were provided by J. Dodgson (U.S. Department of Agriculture-Cooperative State Research, Education, and Extension Service, National Animal Genome Research Program Poultry Genome Project, Michigan State University, East Lansing, MI). The libraries (TAM31, TAM32, TAM33, and CHORI-261) were all made with DNA from the same highly inbred UCD001 line RJF hen used in the Chicken Genome Whole Genome Shotgun (WGS) Project. The MHC-B haplotype in this animal is referred to here as the RJF haplotype. Filters were screened and positive clones were selected following the recommended procedures. Probes included 178/179f (AF493429), a B class I gene-specific PCR product; bg11 (AF493427); a chCD1-2 cDNA clone (AY375530) provided by C. Dascher (Brigham and Women’s Hospital, Boston, MA); and cloned PCR fragments for MHC class II (DQ007238) and for the complement C4 locus (DQ007237). Positive clones were end-sequenced, fingerprinted, and analyzed in Southern hybridizations.

Long-range PCR amplifications of CD1 region

Two CD1 PCR products (PCR-CD1A1 and PCR-CD1A2) were obtained using genomic DNA from the line UCD001 RJF hen as template. CD1A1- and CD1A2-specific primers were designed based on AY849318, CD1A1F (5'-GGGAATATGCAAGGTGATTAACAGCG-3') and CD1A1R (5'-GGATGTACTTTGACCCACACGCAGC-3'), and CD1A2F (5'-TTGAGGTGAATGGAGCGTGGAATAAA-3') and CD1A2R (5'-CTGACTGCCGTGGCCCTTGGTT-3'). PCR amplifications were performed with a TaKaRa LA-Taq kit (TaKaRa) following the protocol recommended by the manufacturer.

DNA sequencing and analysis

Three BAC clones and two long-PCR products that covered 242 kb from the BG3 to CD1A1 genes were completely and bidirectionally shotgun sequenced with an average redundancy of 7.5, which was sufficient for assembly and analysis of the entire sequence using previously established procedures (26, 27). The completed sequence was compared with previously published chicken genomic sequences from the B12 haplotype found in GenBank accession nos.: AL023516, AY849318, and AY694127 (14, 22, 23). Sequence alignments were performed and homologies were determined using the programs contained within the GENETYX version 11 software packages (www.sdc.co.jp/genetyx). These analyses were complemented with basic local alignment search tool (BLAST) and SwissProt searches for homology and conserved domain sequences, GENSCAN for the prediction of coding sequences, and Repeatmasker2 (http://repeatmasker.genome.washington.edu/) for the identification and classification of repeat sequences.

Diversity analysis

The nucleotide diversity profile was constructed after determining the percent nucleotide difference between the RJF and B12 haplotype sequences for a sliding window of 1 kb with 100-bp overlaps. The diversity profile was then drawn using the graphics output of Microsoft Excel. All indels were removed from the alignments to standardize the number of nucleotides examined within each window. Nonsynonymous to synonymous substitution rates (dN/dS) were calculated by the Nei and Gojobori method (28) with the P-distance parameter in the MEGA3.1 software (www.megasoftware.net).

Haplotype breakpoint mapping

BR5 resulted from a crossover between B21 and B19 providing a new haplotype detected serologically as BG19 and BF21 (6). To verify the genotypes of BR5 DNA samples, they were analyzed in the context of parental haplotypes (B19 and B21) for BG by Southern hybridization (29), and for MHC I and MHC II by single-strand conformational polymorphism patterns (30). Genotypes for LEI0258 were defined using a LEI0258 primer pair (31). For single nucleotide polymorphism (SNP) genotyping, primer pairs were designed to amplify segments of 500–700 bp at varying intervals between the primary markers (BG, LEI0258, and BL). Informative markers defining the crossover breakpoint in BR5 were revealed with the following two sets of primer pairs: F11: AGCTCTACCCCAAGCCTG and R11: TGAGAAAACCCCCGTGAGG; and F12: TTGTTGTGGCTCTCAGCCTTC and R12: AAACCGTCCTTCAACCATTCC. All animals providing DNA for this study were maintained under a protocol approved by the Northern Illinois University Institutional Animal Care Review Committee.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Many MHC-related genes reside nearby the MHC-B core

Sequence covering 241,833 bp of B was obtained from three overlapping RJF BAC clones and two PCR products (Fig. 1A). The RJF sequence encompasses newly sequenced regions on GGA16 lying on either side of the 92-kb sequence previously reported for B12, i.e., as described in Fig. 1B, 88 kb upstream and 39 kb downstream, as well as the full sequence of the overlapping RJF region. Interspersed repeats (15 long interspersed elements/CR1 elements and 4 long terminal repeat (LTR) retrotransposons) (Fig. 1C) and 37 simple repeated nucleotide motifs (Fig. 1D) are distributed across the sequence. Overall, the sequence is extraordinarily G+C-rich (average 55.4%) (Fig. 1E), suggesting that GGA16 may be one of the very most G+C-rich among microchromosomes that as a group have a broad distribution of G+C content shifted to higher values than macrochromosomes (32). Within the 242 kb, some segments are even more G+C-rich, such as 33 kb from KIFC1-LOC417038 (59.6%) and the 69 kb from BLB1-CYP21 (61.9%). Other segments are relatively more AT-rich, e.g., the 17-kb BG3-BG2 interval (G+C content 45.6%), as well as the 10 kb that is marked by the LEI0258 microsatellite and contains B-BTN1 (G+C content 40.4%). Portions of this 242-kb sequence were used to guide assembly of the B contigs in the first and second assemblies of RJF (Gallus gallus) WGS sequence. B remains partially assembled in the WGS sequence and is represented by 18 contigs with 92 segments in the second assembly.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 1. Structure of the complete 242 kb (243,833 bp) RJF MHC-B cluster from BG3 to CD1A1. A, The sequence-ready contig constructed from the overlapping set of three BACs (44G24, 85B10, and 177D20) and two PCR products (PCR-CD1A2 and PCR-CD1A1). B, Gene content. Genes in the same family are indicated by similarly colored boxes. Upper boxes indicate genes oriented from BG3 side to CD1A1 (from left to right in this figure). Lower boxes indicate genes oriented from CD1A1 to BG3. Bar with blocked ends denotes gene region previously sequenced in B12. C, The positions of repeat elements, such as L1 and LTR families, are represented by black bars. D, Locations of di-, tri-, tetra- and penta-nucleotide repeats are defined individually. E, Plot of local GC nucleotide content in overlapping 200 bp windows. F, Margins of the BR5 recombination breakpoint zone are defined by SNPs M11 and M12.

 
GENSCAN and BLAST searches predict the presence of 46 genes densely packed within the 242-kb sequence (averaging 5.4 kb/gene) (Fig. 1B and Table I). The RJF haplotype is fully concordant in gene number and spacing with B12 sequence in the overlapping portions (AL023516, AY849318, and AY694127). The 46 genes include 32 "expressed genes" as assessed by their sequence matching cDNA or expressed sequence tag (EST) clones. Based on structural integrity, an additional nine genes are considered to be "candidate genes." Four more encode tRNA. Donor/acceptor sites are conserved at all intron/exon boundaries in all 32 expressed genes and nine candidate genes except for part of C4 and TNXB where donor/acceptor sites are lacking (data not shown). One pseudogene, Blec4, found in both RJF and B12 haplotypes (in AL023516 without annotation), is identified by a single exon present within a 1.94-kb inverted repeat that is 96% identical with a segment of the adjacent Blec2 (BNK) locus (Table I). At least half the genes can be considered as contributing to immunity. A total of 18 genes are newly added on the B gene map.


View this table:
[in this window]
[in a new window]

 
Table I. Genes identified in the RJF MHC-Ba

 

View this table:
[in this window]
[in a new window]

 
Table IA. (Continued)

 
Thirteen new genes (tRNA-Lys-2, HEP21, TRIM7.1, LAO, 44G24.1, Bzfp1, Bzfp2, TRIM7.2, Bzfp3, Blec3, KIFC1, BG2, and BG3) (Fig. 1B and Table I) lie upstream of the previously described TRIM39.2 locus (22). All new genes, except for one, share significant similarities with genes in other species (Table II). Only 44G24.1 is difficult to relate to other genes. 44G24.1 is expressed, but we found no significant homology between it and other genes in database searches. The new tRNA-Lys-2 locus is the fourth tRNA gene to be mapped. Two new TRIM genes bring the number of TRIM genes to seven (TRIM41, TRIM27.1, TRIM39.1, TRIM27.2, TRIM39.2, TRIM7.1, and TRIM7.2). All encode 30.2 domains (33), as does B-BTN1, one of the two BTN loci previously placed in the B extended region. The amino acid similarities between the TRIM-like genes and homologous sequences in nonavian species ranged from 55 to 70% (Table II).


View this table:
[in this window]
[in a new window]

 
Table II. Comparison of RJF MHC-B genes with genes in other speciesa

 
There are three zinc finger protein genes (Bzfp1, Bzfp2, and Bzfp3) in the new sequence. Two, Bzfp1 and Bzfp2, share sequence similarity with human genes (Table II). Bzfp2, which has a significant similarity to a gene on human 19p13.1-p12, is likely expressed. Bzfp1 is also likely expressed and is nearly identical (99% amino acid similarity) to the chicken Krueppel-type gene CKR1 (LOC396247, NM_205309) (34). Bzfp1 shares a 59% amino acid similarity with human ZFP436 (Q9C0F3) located in 1p36, an HLA paralogous region (35). Bzfp3 shares 99% nucleotide identity with a finished chicken EST clone (BX932436) and is most similar to a gene mapping to human chromosome 5.

Other new genes also with similarities to MHC and MHC paralogous genes in other species include LAO and KIFC1 (Fig. 1B, Tables I and II). LAO is an L-amino acid oxidase precursor sharing a 70% amino acid similarity with a snake venom enzyme (O93364) (36). LAO is also similar to a human amino oxidase gene located in the HLA paralogous region on human chromosome 19. KIFC1 has 65 and 61% amino acid similarities with frog C-terminal kinesin 2 (P79955) and human KIFC1 (Q9BW19), respectively, which are present in the extended class II region in these species.

Blec3 is a newly recognized C-type lectin-like gene lying 113 kb upstream from previously found Blec1 and Blec2 (BNK) (Fig. 1B). Blec3, like Blec1, shares highly significant amino acid similarity with CD69 mammalian early activation Ags (Table II). Blec3 also shares highly significant amino acid similarity with a putative C-type lectin protein FPV239 (P14371) encoded within the genome of fowlpox virus.

The position of BG2 and BG3 at the upstream margin of the RJF sequence establishes the distance (128 kb) that separates the BG gene family from the MHC class I and class II genes with which they are tightly linked (Fig. 1B). Although more BAC clones need to be added to the B contig and sequenced to define all the BG gene family members, the remaining, tightly linked family members likely lie nearby upstream. In harmony with previously reported BG cDNA sequences, BG2 and BG3 genes consist of exons encoding IgV-like and transmembrane domains coupled with multiple 21-nt exons encoding a lengthy coiled-coil intracellular region (16). The BG1 locus found adjacent to Blec4 (Fig. 1B) shares a similar exon organization, but in contrast has two additional distinctive exons at the 3'-end.

HEP21 is a chicken gene which is predominantly expressed in the oviduct producing a protein secreted into hen egg white (37) (Fig. 1B and Tables I and II). It shares no significant homology with any known gene. However, HEP21 is weakly similar to GPI-linked LY6G5B which is encoded in the MHC in mammals. Perhaps HEP21 is one representative of the LY6 gene family in the chickens.

New genes mapping downstream of the B core contribute further to the definition of the chicken class III region (Fig. 1B) and confirm the presence of a well-conserved class III region in avian species. The newly obtained sequence revealed the presence of CYP21 and TNXB downstream of C4 and CenpA forms a unit similar to the discrete, sometimes duplicated, genetic unit found in HLA (38). The four genes are present in a highly conserved order (C4, CenpA, CYP21, and TNXB). CYP21 shares 57% similarity with the HLA cytochrome P450 (P08686), and TNXB has 58% similarity with the HLA Tenascin-X precursor (P22105). CenpA, although missing from HLA, is present within the MHC of Xenopus species in the same position as CenpA in the chicken (39). The remaining gene, LTB4R1, revealed in this segment was unexpected, but consistent with the role of class III genes in inflammation. The predicted amino acid sequence for LTB4R1 matches most closely a human leukotriene B4 receptor (Q15722), encoded on chromosome 14 that mediates chemotaxis (56% amino acid similarity) (40).

The RJF map confirms the short distance between CD1A2 and BF2 class I genes (48 kb) and that CD1A2 and CD1A1 are separated from each other by ~840 bp (23, 24, 25).

Genetic variability stretches beyond the class I and II loci encompassing some loci within the MHC-B extended region

To further investigate the relative stability of the MHC-B core and extended region, we explored genomic and allelic variability by comparing the sequences now available for the RJF and B12 haplotypes. We compared a total of 124,489 bp for the RJF haplotype (116,217 bp from TRIM39.1 to CenpA and 8,272 bp in the CD1 region) with the corresponding 123,987 bp previously determined for the B12 haplotype (115,721 and 8,266 bp) (22, 23, 41). We found differences in gene structure, insertions and deletions (indels), SNPs, and codon substitutions at many loci (Fig. 2). Structural differences were observed in four genes: B-BTN2, TAP1, BF1, and BG1; three of these vary by a few nucleotide differences. Namely, in the RJF haplotype exon 5 of B-BTN2 is 3 bp longer; the final exon of TAP1 is shorter as the result of 14-bp insertion that introduces a stop codon; and exon 1 (signal peptide) in BF1 is 15 bp longer. A substantial difference of over 400 bp exists between BG1 alleles with the RJF allele containing a near perfect duplication of four exons and associated introns encoding a portion of the coiled-coil region of BG1.


Figure 2
View larger version (33K):
[in this window]
[in a new window]

 
FIGURE 2. Genomic diversity plot of the chicken MHC RJF and B12 haplotypes. Diversity plot drawn upon comparison of the total 123-kb segment covering 115 kb between the TRIM39.1 and a part of CenpA genes and the 9-kb region containing CD1 genes is shown by blue line, and indels between two haplotypes are shown by red sticks.

 
Numerous indels (2227) were also observed (Fig. 2). These are especially frequent in the introns and intergenic regions of TRIM27.1, DMB2, TAP2, and C4 genes. The average number of indels overall was 11.1 per kb.

SNPs provide a further measure of the genomic variability between haplotypes and between alleles (Fig. 2 and Table III). Overall, there were 1323 nucleotide variations, i.e., 1.08 nucleotide differences per 100 nucleotides (1.08 SNP %) between the RJF sequence and that of B12 in alignments in which the 2227 indels were excluded. The distribution of SNPs is not uniform. Among the 24 genes within overlapping regions of RJF and B12 haplotypes, SNPs are disproportionately distributed to BG1 (1.89 SNP %) and the polymorphic class I and II Ag-presenting loci BF1 (3.30 SNP %), BF2 (3.69%), BLB1 (2.05%), and BLB2 (1.92%) (Fig. 2 and Table III). SNPs are also fairly common in TRIM27.1, B-BTN2, Blec1, DMB2, TAP1, and TAP2 and relatively less frequent in TRIM39.1, TRIM41, DMA, CD1A2, and CD1A1. No significant differences were found in the eight remaining genes (Table III). When SNPs were examined with respect to synonymous and nonsynonymous nucleotide substitutions within coding regions, four genes (B-BTN2, BLB1, BLB2, and DMB1) stood out as more frequently containing amino acid-altering substitutions (dN/dS ratios >1). In the same comparison, the dN/dS ratios for the class I loci BF1 and BF2 were under 1 (0.9064 in BF1 and 0.7015 in BF2) (Table III). However, when exons 2 and 3 (encoding the BF Ag-binding region) of these loci were examined the dN/dS ratios were significantly higher, 1.4385 for BF1 and 1.8966 for BF2, indicating a large number of synonymous substitutions elsewhere in these loci contribute to their overall low dN/dS ratios.


View this table:
[in this window]
[in a new window]

 
Table III. SNP analysis of 24 genes within the chicken MHC-B region where RJF and B12 haplotypes overlapa

 
These data provide ample evidence for genetic variability within the classical Ag processing and presentation loci (BLB1, BLB2, DMB1, DMB2, BF1, TAP1, TAP2, and BF2) of the B core. Significantly, the data also reveal allelic polymorphism within the genes of the extended region. Most prominent are BG1, TRIM27.1, B-BTN-2, and Blec1 differences. Genetic variability in these and the other genes within the extended region that remain to be analyzed may be contributing to B disease associations presently linked to B at the level of a haplotype.

Meiotic crossover breakpoints map to the MHC-B extended region

With the extended map assembled, it was a matter of interest to understand which of the newly mapped genes, if any, map into the B region previously shown to influence the incidence of Marek’s disease. We analyzed the BR5 recombinant haplotypes with which resistance to Marek’s disease was first mapped to the class I (BF) subregion (6). After first verifying the parent of origin for the BR5 alleles at BG, BL, and BF loci, as well as microsatellite LEI0258 using established methods (see Materials and Methods), we used SNPs revealed by limited resequencing to assign the origin of different portions of the BR5 to one or the other parental haplotype. The BR5 breakpoint, defined by SNPs M11 and M12, is located upstream of TRIM7.2 (Fig. 1F). Hence, all the genes intervening between the BR5 breakpoint and the class I genes encoding the BF Ags map within the region affecting Marek’s disease. Within this region are a number of genes that could contribute to resistance to the challenge of viral infection beyond the loci for Ag-presenting molecules including the BG1, TRIM27.1, B-BTN-2, and Blec1 loci that display significant polymorphism as described above.

Distinctive features of the MHC-B gene map support models for MHC evolution in which different regions restructure and evolve at different rates

Comparisons of B with HLA and the quail MHC (Fig. 3) reinforce previous findings that a number of different types of genes, in addition to those for Ag presentation and the well-conserved class III region genes, remain in the MHC in divergent species over evolutionary time (9). Comparison of B with HLA (Fig. 3) shows that many genes characteristic of the different subregions of HLA are also present in B but reside in the newly mapped region extending upstream of the B core. These include: KIFC1 found in the class II extended segment of HLA; HEP21 the possible homolog of the class III region Ly6 genes; and the BTN, TRIM, and BG which are all structurally related to genes found with HLA class I and class I extended regions. Like HLA, B also contains zinc finger protein genes even though these appear to be more closely related to genes on other human chromosomes, as is also true some of the B TRIM genes. It appears that perhaps over evolutionary time many genes have migrated from a region in which they were commingled, as represented by the B extended region, to various discrete locations nearby class I, II, and III genes as found in HLA or to other chromosomes.


Figure 3
View larger version (32K):
[in this window]
[in a new window]

 
FIGURE 3. Gene maps for human (HLA), chicken (MHC-B), and quail MHC illustrate the pliant nature of MHC gene organization. Shared presence of TRIM, BTN, MOG, and LY6 gene family members in the MHC is evident albeit with considerable differences in locale between HLA and chicken. Conserved gene content and order is found in the class I-III gene regions of chicken and quail MHC (genes named between maps). The conserved class I-III regions contrast with the remaining portions of the upstream sequences where similarities in gene order are not evident and genes cannot be paired with certainty (genes named on either side of maps). Among the genes upstream only chicken Blec2 (BNK) and quail NK3 are paired based on sequence similarity. Quail MHC region sequence was previously reported by Shiina et al. (56 ). Pseudogenes are indicated by striped boxes and by ps notation. Gene size and spacing is approximate and not to scale.

 
Comparison of the B map with the current map for the quail MHC suggests that the MHC extended regions in birds evolve more rapidly than the core region containing class I, II, and III genes. In Fig. 3, the maintenance of gene order and identity between chicken and Japanese quail is readily apparent across the core class I, II, and III regions even though the genes are unlikely to be orthologous and there are small variations in gene number. In contrast, there are striking differences between RJF and quail maps in the extended region. Aside from shared similarity between the two C-type lectin-like (RJF Blec1 and quail Blec2) genes near the class II region boundary (see Fig. 3), there is little evidence for conservation of gene order and type in the extended regions. Although additional sequencing may reveal in quail genes equivalent to those in the RJF extended region beyond the current map, many of the B extended region genes found in the RJF haplotype are entirely missing in quail in the region directly adjacent to the class I, II, and III core. In contrast to the BG1, GNB2L1, BTN, TRIM, LAO, zinger finger, HEP21, and KIFC1 genes found in the RJF map, the quail map contains instead a series of BLbeta, Lec, and BNK genes and pseudogenes that are perhaps derived by repeated duplication within the subregion amid a series of BG genes and pseudogenes. It could be that this portion of the MHC in avian species is rapidly restructured as the result of pathogen selection.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The striking influence of B in Marek’s disease has long served as the outstanding example for the expected, but difficult to find, relationship between the MHC polymorphism and infectious disease (42). Previous studies focused on the B core region, containing class I, II, and II genes, postulate and effectively reasoned on the basis of the data then available that genes within the B core are responsible for the MHC disease associations so evident in chickens (14, 43, 44). The sequencing of the extended B region described here has revealed the presence of many more genes in the B region in linkage with the previously described core. It is important therefore to understand whether these genes contribute to the remarkable influence of B haplotypes in infectious disease. Because many of the newly revealed chicken genes are genes typically found within the MHC region in other species, our findings show that the B region is indeed larger than previously deemed. The extended region sequencing reveals that in the chicken, even more than in quail, the core is compact and minimal, in part, as the result of the avian versions of typically intertwined MHC-associated genes in chickens residing instead within an adjacent region. A number of these MHC-associated genes contribute to immunity, but for others there is no obvious function in immunity (such as the zinc finger protein genes). Understanding which B genes are under selection by the challenge of pathogens is important for understanding how the MHC evolves. This work provides a context for additional experiments aimed at this goal. The position of the crossover breakpoint in the BR5 recombinant haplotype defines which B loci need to be considered as possibly involved in the responses to Marek’s disease. At this time, it is possible only to suggest which among the mapped genes are likely candidates based on their variability and relatedness to genes of known function in other organisms. Studies of additional recombinant haplotypes will likely narrow the range even possibly allowing the contributions from individual loci to be determined.

TRIM and BTN loci are interesting candidates to consider. Both TRIM and BTN genes encode B30.2 domains. In old world monkeys, the B30.2 domain of TRIM 5{alpha} contains a major determinant restricting HIV-1 infection (45). A number of additional TRIM family members display innate immune antiviral properties (46, 47). How many additional TRIM genes also contribute to immunity is not known because the TRIM gene family is large and diverse. Many TRIM genes remain to be studied individually. So it is not yet clear whether any of the seven TRIM genes within B have similar properties. They belong to TRIM gene family clusters that have yet to be found to affect viral infection. And, with respect to Marek’s disease, TRIM genes have not been shown to influence herpesvirus infections. At the same time, one of the three B TRIM genes in the RJF and B12 overlapping region, TRIM27.1, shows significant SNP variability and nonsynonymous coding region differences (Table III). So variability is present in at least one of the seven B TRIM loci. A similar indirect argument can be made for the gene candidate B-BTN-2. B-BTN-2 appears to encode an IgSF cell surface receptor similar to BTNL2, but bearing also a cytosolic B30.2 domain. Although the function of BTN molecules remains to be defined overall, BTNL2 have be shown recently to modulate intestinal inflammation (48) and so it is perhaps more likely that BTN molecules also affect immune fitness in some manner. B-BTN-2 show high SNP percentage values and a significant dN/dS value suggesting it is under selection. More sequence data from other alleles in different haplotypes will help to reveal how much variability exists at these loci and the other TRIM (TRIM27.2, TRIM39.2, TRIM7.1, and TRIM7.2) loci that remain to be compared between haplotypes.

Other candidate genes include the C-type lectin loci. Blec2 (B-NK) is likely a receptor expressed on chicken NK cells and therefore Blec2 (B-NK) is a good candidate for affecting early responses to Marek’s disease virus. Our data showing 15 SNPS in the Blec2 (B-NK) (Table III) all resulting in amino acid differences between B12 and RJF is consistent with this locus being under selection. Interestingly, this finding corroborates an earlier observation by Rogers et al. (49) showing that all 13 nucleotide changes found in the sequences of Blec2(B-NK) in seven different haplotypes produced only nonsynonymous changes. Furthermore, Blec1, a potential cell activation marker, also shows significant SNP variability (Table III), but because only a single SNP is nonsynonymous it remains to be seen how polymorphic this locus may be. Blec3 must wait for evaluation because only the single allele sequence is available.

The final candidate locus to consider within extended region is BG1. BG1 is a locus peculiar to chickens that shows substantial sequence differences among alleles including RJF, B12, and alleles in other haplotypes (R. M. Goto and M. M. Miller, unpublished data). This cell surface protein displays an unusual pattern of variability. Variability is largely confined to duplications and deletions in different haplotypes of four small coiled-coil domains. Because BG1 is only weakly similar to genes in mammals, it is difficult to infer much from this perspective about possible function; however, this IgSF locus shows distinctive differences among haplotypes indicating that this locus should be included among candidate loci affecting disease incidence.

Five loci within the B core region, DMB2, BF1, TAP1, TAP2, and BF2, show high SNP values (1.12~3.69) in comparisons between the RJF and B12 haplotype (Table II). Therefore, these genes may be affected by the positive selection that generates MHC polymorphisms and associated disease resistance or susceptibility as has been suggested for the dominantly expressed BF2 class I locus (44). We observed that almost all SNPS in the coding sequence (CDS) of BF2 occur in the Ag-binding region encoding exons 2 and 3 (45 of 54 SNPs). Interestingly, for the second, minor class I locus BF1, almost all the CDS SNPs are also within exons 2 and 3 (25 of 36 SNPs in BF1) suggesting that this locus may also be affected by positive selection. We observe similar distributions of CDS SNPs to exons for the Ag-presenting regions in the two class II beta loci, 20 of 25 SNPs in BLB1, and all SNPs in BLB2, suggesting that alleles at these loci may also be positively selected.

Although it is possible perhaps that diversity at the DMB2, TAP1, and TAP2 also derive by positive selection, it may be that variability at these loci is not the result of direct selection, but is rather the result of their location in close proximity with the highly selected, polymorphic BF genes (Fig. 2) (50). In HLA, four locations near the HLA-A, -B, -DR/DQ, and -DP loci are thought to be regions affected by hitchhiking and these segments confer susceptibility to several autoimmune diseases such as insulin-dependent diabetes mellitus, rheumatoid arthritis, and psoriasis vulgaris (50, 51). Similar indirect selection might result in the observed variability of DMB2, TAP1, and TAP2 whether or not the variability influences disease susceptibility.

The presence in B of C-type lectin-like loci, sharing homology with mammalian lymphoid inhibitory (Blec2-BNK) and activating (Blec1 and Blec3) receptors strengthens the argument that the ancestral MHC may have contained several classes of receptors and ligands used in the primitive immune defense. Overall, the organization of MHC genes in the chicken and the quail is consistent with recent models of the MHC evolving first as a protocomplex containing genes involved in innate immunity (35, 52) and with the rapid evolution of gene-encoding receptors and ligands for innate and adaptive immune cell interactions. Furthermore, the similarities between the chicken B (and Y) C-type lectin-like genes and sequences present within the genomes of avian pathogens are striking (M. M. Miller, unpublished data). Implied in these similarities is the use of pirated B and Y gene sequences as decoys for immune evasion. If this has indeed occurred, then it is not surprising that C-type lectin-like genes evolve rapidly across species and evolutionary time.

The comparison of B with the MHC of the Japanese quail suggests that the MHC maybe often be restructured in birds (Fig. 3). Even if TRIM, BTN, zinc finger genes, and other loci are found later with further sequencing to be located at a more distant point in the quail MHC, it is apparent that the organization of MHC genes in these two closely similar species has already diverged. Ongoing literature suggests that the number, and likely the linkage relationship, of class I and II genes in birds is variable (53, 54, 55). The comparisons presented here are among the first to reveal the composition of the MHC-extended region of the MHC in birds and to suggest that this region is rapidly remodeled. These findings help to strengthen the need to consider the function of these MHC-associated genes in immunity.

A number of MHC genes assigned to chicken chromosome 16 remain to be mapped. Still to be done is completion of the link between B and Y and finding the location of additional MHC genes, such as the class II{alpha} gene and more genes expected in the class III region. The sequence of the highly polymorphic BG gene family awaits completion. It will be interesting to see whether chicken BG genes are contiguous or if other genes intertwine as occurs among the BG loci in quail.


    Acknowledgments
 
We thank Keely Walker, Renee Kupolos, Linda Yates, Jerzy K. Kulski, Kei Hanzawa, and Jerry Dodgson for many helpful discussions and suggestions for improving data presentation. We thank Jerry Dodgson for generously providing BAC filters and Chris Dascher for providing the chCD1–2 cDNA clone.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Science Foundation MCB-9604589, National Cancer Institute R21 CA105426, National Research Initiative Grant Nos. 2004-35205-14203 and 2006-35205-16678 from the U.S. Department of Agriculture Cooperative State Research, Education, and Extension Service, and Kakenhi (Grant-in-Aid for Scientific Research) on Priority Areas "Comparative Genomics" from the Ministry of Education, Culture, Sports, Science and Technology of Japan. BAC filters were provided through the U.S. Department of Agricultural Cooperative State Research, Education, and Extension Service Multi-State Research Committee NRSP-8. Back

2 The sequence(s) presented in this article has been submitted to GenBank under accession number(s) AB268588. Back

3 Address correspondence and reprint requests to Dr. Marcia M. Miller, Beckman Research Institute, City of Hope National Medical Center, 1450 East Duarte Road, Duarte, CA 91010. E-mail address: mamiller{at}coh.org Back

4 Abbreviations used in this paper: IgSF, Ig superfamily; BTN, butyrophilin; MOG, myelin oligodendrocyte glycoprotein; TRIM, tripartite motif; RJF, Red Jungle Fowl; BAC, bacterial artificial chromosome; CDS, coding sequence; BLAST, basic local alignment search tool; EST, expressed sequence tag; LTR, long terminal repeat; SNP, single nucleotide polymorphism; WGS, Whole Genome Shotgun. Back

Received for publication November 21, 2006. Accepted for publication March 19, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Schierman, L. W., W. M. Collins. 1987. Influence of the major histocompatibility complex on tumor regression and immunity in chickens. Poult. Sci. 66: 812-818. [Medline]
  2. Taylor, R. L., Jr. 2004. Major histocompatibility (B) complex control of responses against Rous sarcomas. Poult. Sci. 83: 638-649. [Abstract/Free Full Text]
  3. Lamont, S. J., C. Bolin, N. Cheville. 1987. Genetic resistance to fowl cholera is linked to the major histocompatibility complex. Immunogenetics 25: 284-289. [Medline]
  4. Lillehoj, H. S., M. D. Ruff, L. D. Bacon, S. J. Lamont, T. K. Jeffers. 1989. Genetic control of immunity to Eimeria tenella: interaction of MHC genes and non-MHC linked genes influences levels of disease susceptibility in chickens. Vet. Immunol. Immunopathol. 20: 135-148. [Medline]
  5. Cotter, P. F., R. L. Taylor, Jr, H. Abplanalp. 1998. B-complex associated immunity to Salmonella enteritidis challenge in congenic chickens. Poult. Sci. 77: 1846-1851. [Abstract/Free Full Text]
  6. Briles, W. E., R. W. Briles, R. E. Taffs, H. A. Stone. 1983. Resistance to a malignant lymphoma in chickens is mapped to subregion of major histocompatibility (B) complex. Science 219: 977-979. [Abstract/Free Full Text]
  7. Plachy, J., V. Jurajda, V. Benda. 1984. Resistance to Marek’s disease is controlled by a gene within the B-F region of the chicken major histocompatibility complex in Rous sarcoma regressor or progressor inbred lines of chickens. Folia Biol. 30: 251-258.
  8. Hepkema, B. G., J. J. Blankert, G. A. Albers, M. G. Tilanus, E. Egberts, A. J. van der Zijpp, E. J. Hensen. 1993. Mapping of susceptibility to Marek’s disease within the major histocompatibility (B) complex by refined typing of White Leghorn chickens. Anim. Genet. 24: 283-287. [Medline]
  9. Kelley, J., L. Walter, J. Trowsdale. 2005. Comparative genomics of major histocompatibility complexes. Immunogenetics 56: 683-695. [Medline]
  10. Miller, M. M., R. M. Goto, R. L. Taylor, Jr, R. Zoorob, C. Auffray, R. W. Briles, W. E. Briles, S. E. Bloom. 1996. Assignment of Rfp-Y to the chicken major histocompatibility complex/NOR microchromosome and evidence for high-frequency recombination associated with the nucleolar organizer region. Proc. Natl. Acad. Sci. USA 93: 3958-3962. [Abstract/Free Full Text]
  11. Hunt, H. D., R. M. Goto, D. N. Foster, L. D. Bacon, M. M. Miller. 2006. At least one YMHCI molecule in the chicken is alloimmunogenic and dynamically expressed on spleen cells during development. Immunogenetics 58: 297-307. [Medline]
  12. Afanassieff, M., R. M. Goto, J. Ha, M. Sherman, L. Zhong, C. Auffray, F. Coudert, R. Zoorob, M. M. Miller. 2001. At least one class I gene in restriction fragment pattern-Y (Rfp-Y), the second MHC gene cluster in the chicken, is transcribed, polymorphic and shows divergent specialization in antigen binding region. J. Immunol. 166: 3324-3333. [Abstract/Free Full Text]
  13. Rogers, S., I. Shaw, N. Ross, V. Nair, L. Rothwell, J. Kaufman, P. Kaiser. 2003. Analysis of part of the chicken Rfp-Y region reveals two novel lectin genes, the first complete genomic sequence of a class I {alpha}-chain gene, a truncated class II beta-chain gene, and a large CR1 repeat. Immunogenetics 55: 100-108. [Medline]
  14. Kaufman, J., S. Milne, T. W. Gobel, B. A. Walker, J. P. Jacob, C. Auffray, R. Zoorob, S. Beck. 1999. The chicken B locus is a minimal essential major histocompatibility complex. Nature 401: 923-925. [Medline]
  15. Rogers, S. L., T. W. Gobel, B. C. Viertlboeck, S. Milne, S. Beck, J. Kaufman. 2005. Characterization of the chicken C-type lectin-like receptors B-NK and B-lec suggests that the NK complex and the MHC share a common ancestral region. J. Immunol. 174: 3475-3483. [Abstract/Free Full Text]
  16. Miller, M. M., R. Goto, S. Young, J. Chirivella, D. Hawke, C. G. Miyada. 1991. Immunoglobulin variable-region-like domains of diverse sequence within the major histocompatibility complex of the chicken. Proc. Natl. Acad. Sci. USA 88: 4377-4381. [Abstract/Free Full Text]
  17. Miller, M. M., R. Goto, S. Young, J. Liu, J. Hardy. 1990. Antigens similar to major histocompatibility complex B-G are expressed in the intestinal epithelium in the chicken. Immunogenetics 32: 45-50. [Medline]
  18. Kaufman, J., J. Salomonsen. 1993. What in the dickens is with these chickens: an only slightly silly response to the first draft of Langman and Cohn. Res. Immunol. 144: 495-502. discussion 502–419. [Medline]
  19. Bikle, D. D., S. Munson, L. Komuves. 1996. Zipper protein, a B-G protein with the ability to regulate actin/myosin 1 interactions in the intestinal brush border. J. Biol. Chem. 271: 9075-9083. [Abstract/Free Full Text]
  20. Pham-Dinh, D., M. G. Mattei, J. L. Nussbaum, G. Roussel, P. Pontarotti, N. Roeckel, I. H. Mather, K. Artzt, K. F. Lindahl, A. Dautigny. 1993. Myelin/oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex. Proc. Natl. Acad. Sci. USA 90: 7990-7994. [Abstract/Free Full Text]
  21. Salomonsen, J., D. Marston, D. Avila, N. Bumstead, B. Johansson, H. Juul-Madsen, G. D. Olesen, P. Riegert, K. Skjodt, O. Vainio, et al 2003. The properties of the single chicken MHC classical class II {alpha} chain (B-LA) gene indicate an ancient origin for the DR/E-like isotype of class II molecules. Immunogenetics 55: 605-614. [Medline]
  22. Ruby, T., B. Bed’Hom, H. Wittzell, V. Morin, A. Oudin, R. Zoorob. 2005. Characterisation of a cluster of TRIM-B30.2 genes in the chicken MHC B locus. Immunogenetics 57: 116-128. [Medline]
  23. Salomonsen, J., M. R. Sorensen, D. A. Marston, S. L. Rogers, T. Collen, A. van Hateren, A. L. Smith, R. K. Beal, K. Skjodt, J. Kaufman. 2005. Two CD1 genes map to the chicken MHC, indicating that CD1 genes are ancient and likely to have been present in the primordial MHC. Proc. Natl. Acad. Sci. USA 102: 8668-8673. [Abstract/Free Full Text]
  24. Miller, M. M., C. Wang, E. Parisini, R. D. Coletta, R. M. Goto, S. Y. Lee, D. C. Barral, M. Townes, C. Roura-Mir, H. L. Ford, et al 2005. Characterization of two avian MHC-like genes reveals an ancient origin of the CD1 family. Proc. Natl. Acad. Sci. USA 102: 8674-8679. [Abstract/Free Full Text]
  25. Maruoka, T., H. Tanabe, M. Chiba, M. Kasahara. 2005. Chicken CD1 genes are located in the MHC: CD1 and endothelial protein C receptor genes constitute a distinct subfamily of class-I-like genes that predates the emergence of mammals. Immunogenetics 57: 590-600. [Medline]
  26. Shiina, T., G. Tamiya, A. Oka, N. Takishima, T. Yamagata, E. Kikkawa, K. Iwata, M. Tomizawa, N. Okuaki, Y. Kuwano, et al 1999. Molecular dynamics of MHC genesis unraveled by sequence analysis of the 1,796,938-bp HLA class I region. Proc. Natl. Acad. Sci. USA 96: 13282-13287. [Abstract/Free Full Text]
  27. Mizuki, N., H. Ando, M. Kimura, S. Ohno, S. Miyata, M. Yamazaki, H. Tashiro, K. Watanabe, A. Ono, S. Taguchi, et al 1997. Nucleotide sequence analysis of the HLA class I region spanning the 237-kb segment around the HLA-B and -C genes. Genomics 42: 55-66. [Medline]
  28. Nei, M., T. Gojobori. 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3: 418-426. [Abstract]
  29. Briles, W. E., R. M. Goto, C. Auffray, M. M. Miller. 1993. A polymorphic system related to but genetically independent of the chicken major histocompatibility complex. Immunogenetics 37: 408-414. [Medline]
  30. Goto, R. M., M. Afanassieff, J. Ha, G. M. Iglesias, S. J. Ewald, W. E. Briles, M. M. Miller. 2002. Single-strand conformation polymorphism (SSCP) assays for major histocompatibility complex B genotyping in chickens. Poult. Sci. 81: 1832-1841. [Abstract/Free Full Text]
  31. Fulton, J. E., H. R. Juul-Madsen, C. M. Ashwell, A. M. McCarron, J. A. Arthur, N. P. O’Sullivan, R. L. Taylor, Jr. 2006. Molecular genotype identification of the Gallus gallus major histocompatibility complex. Immunogenetics 58: 407-421. [Medline]
  32. Hillier, L. W., W. Miller, E. Birney, W. Warren, R. C. Hardison, C. P. Ponting, P. Bork, D. W. Burt, M. A. Groenen, M. E. Delany, et al 2004. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432: 695-716. [Medline]
  33. Rhodes, D. A., B. de Bono, J. Trowsdale. 2005. Relationship between SPRY and B30.2 protein domains: evolution of a component of immune defence?. Immunology 116: 411-417. [Medline]
  34. Benn, A., M. Antoine, H. Beug, J. Niessing. 1991. Primary structure and expression of a chicken cDNA encoding a protein with zinc-finger motifs. Gene 106: 207-212. [Medline]
  35. Flajnik, M. F., M. Kasahara. 2001. Comparative genomics of the MHC: glimpses into the evolution of the adaptive immune system. Immunity 15: 351-362. [Medline]
  36. Raibekas, A. A., V. Massey. 1998. Primary structure of the snake venom L-amino acid oxidase shows high homology with the mouse B cell interleukin 4-induced Fig 1 protein. Biochem. Biophys. Res. Commun. 248: 476-478. [Medline]
  37. Nau, F., C. Guerin-Dubiard, C. Desert, J. Gautron, S. Bouton, J. Gribonval, S. Lagarrigue. 2003. Cloning and characterization of HEP21, a new member of the uPAR/Ly6 protein superfamily predominantly expressed in hen egg white. Poult. Sci. 82: 242-250. [Abstract/Free Full Text]
  38. Yang, Z., A. R. Mendoza, T. R. Welch, W. B. Zipf, C. Y. Yu. 1999. Modular variations of the human major histocompatibility complex class III genes for serine/threonine kinase RP, complement component C4, steroid 21-hydroxylase CYP21, and tenascin TNX (the RCCX module): a mechanism for gene deletions and disease associations. J. Biol. Chem. 274: 12147-12156. [Abstract/Free Full Text]
  39. Ohta, Y., W. Goetz, M. Z. Hossain, M. Nonaka, M. F. Flajnik. 2006. Ancestral organization of the MHC revealed in the amphibian Xenopus. J. Immunol. 176: 3674-3685. [Abstract/Free Full Text]
  40. Yokomizo, T., T. Izumi, K. Chang, Y. Takuwa, T. Shimizu. 1997. A G-protein-coupled receptor for leukotriene B4 that mediates chemotaxis. Nature 387: 620-624. [Medline]
  41. Kaufman, J.. 1999. Co-evolving genes in MHC haplotypes: the "rule" for nonmammalian vertebrates?. Immunogenetics 50: 228-236. [Medline]
  42. Klein, J.. 1986. Natural History of the Major Histocompatibility Complex Wiley, New York.
  43. Kaufman, J., J. Jacob, I. Shaw, B. Walker, S. Milne, S. Beck, J. Salomonsen. 1999. Gene organisation determines evolution of function in the chicken MHC. Immunol. Rev. 167: 101-117. [Medline]
  44. Wallny, H. J., D. Avila, L. G. Hunt, T. J. Powell, P. Riegert, J. Salomonsen, K. Skjodt, O. Vainio, F. Vilbois, M. V. Wiles, J. Kaufman. 2006. Peptide motifs of the single dominantly expressed class I molecule explain the striking MHC-determined response to Rous sarcoma virus in chickens. Proc. Natl. Acad. Sci. USA 103: 1434-1439. [Abstract/Free Full Text]
  45. Stremlau, M., M. Perron, S. Welikala, J. Sodroski. 2005. Species-specific variation in the B30.2(SPRY) domain of TRIM5{alpha} determines the potency of human immunodeficiency virus restriction. J. Virol. 79: 3139-3145. [Abstract/Free Full Text]
  46. Nisole, S., J. P. Stoye, A. Saib. 2005. TRIM family proteins: retroviral restriction and antiviral defence. Nat. Rev. Microbiol. 3: 799-808. [Medline]
  47. Si, Z., N. Vandegraaff, C. O’Huigin, B. Song, W. Yuan, C. Xu, M. Perron, X. Li, W. A. Marasco, A. Engelman, et al 2006. Evolution of a cytoplasmic tripartite motif (TRIM) protein in cows that restricts retroviral infection. Proc. Natl. Acad. Sci. USA 103: 7454-7459. [Abstract/Free Full Text]
  48. Arnett, H. A., S. S. Escobar, E. Gonzalez-Suarez, A. L. Budelsky, L. A. Steffen, N. Boiani, M. Zhang, G. Siu, A. W. Brewer, J. L. Viney. 2007. BTNL2, a butyrophilin/B7-like molecule, is a negative costimulatory molecule modulated in intestinal inflammation. J. Immunol. 178: 1523-1533. [Abstract/Free Full Text]
  49. Rogers, S., T. Gobel, J. Kaufman. 2001. Genomic analysis of B-NK and B-lec, two c-type lectin-like genes in the chicken MHC. K. A. Schat, Jr, ed. 6th Avian Immunology Research Group Meeting, October 8–10, 2000 120-126. American Association of Avian Pathologists, Cornell University, Ithaca, NY.
  50. Shiina, T., M. Ota, S. Shimizu, Y. Katsuyama, N. Hashimoto, M. Takasu, T. Anzai, J. K. Kulski, E. Kikkawa, T. Naruse, et al 2006. Rapid evolution of major histocompatibility complex class I genes in primates generates new disease alleles in humans via hitchhiking diversity. Genetics 173: 1555-1570. [Abstract/Free Full Text]
  51. Stewart, C. A., R. Horton, R. J. Allcock, J. L. Ashurst, A. M. Atrazhev, P. Coggill, I. Dunham, S. Forbes, K. Halls, J. M. Howson, et al 2004. Complete MHC haplotype sequencing for common disease gene mapping. Genome Res. 14: 1176-1187. [Abstract/Free Full Text]
  52. Belov, K., J. E. Deakin, A. T. Papenfuss, M. L. Baker, S. D. Melman, H. V. Siddle, N. Gouin, D. L. Goode, T. J. Sargeant, M. D. Robinson, et al 2006. Reconstructing an ancestral mammalian immune supercomplex from a marsupial major histocompatibility complex. PLoS Biol. 4: 317-328.
  53. Westerdahl, H., H. Wittzell, T. von Schantz. 2000. MHC diversity in two passerine birds: no evidence for a minimal essential MHC. Immunogenetics 52: 92-100. [Medline]
  54. Ekblom, R., M. Grahn, J. Hoglund. 2003. Patterns of polymorphism in the MHC class II of a non-passerine bird, the great snipe (Gallinago media). Immunogenetics 54: 734-741. [Medline]
  55. Bonneaud, C., G. Sorci, V. Morin, H. Westerdahl, R. Zoorob, H. Wittzell. 2004. Diversity of MHC class I and IIB genes in house sparrows (Passer domesticus). Immunogenetics 55: 855-865. [Medline]
  56. Shiina, T., S. Shimizu, K. Hosomichi, S. Kohara, S. Watanabe, K. Hanzawa, S. Beck, J. K. Kulski, H. Inoko. 2004. Comparative genomic analysis of two avian (quail and chicken) MHC regions. J. Immunol. 172: 6751-6763. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. Hosomichi, M. M. Miller, R. M. Goto, Y. Wang, S. Suzuki, J. K. Kulski, M. Nishibori, H. Inoko, K. Hanzawa, and T. Shiina
Contribution of Mutation, Recombination, and Gene Conversion to Chicken Mhc-B Haplotype Diversity
J. Immunol., September 1, 2008; 181(5): 3393 - 3399.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiina, T.
Right arrow Articles by Miller, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiina, T.
Right arrow Articles by Miller, M. M.


HOME HELP FEEDBACK