|
|
||||||||
Activity Leads to Activated T Cell Death and Can Be Inhibited by Natural Adjuvant1

* Institute for Cellular Therapeutics and
Department of Microbiology and Immunology, University of Louisville School of Medicine, Louisville, KY 40202
| Abstract |
|---|
|
|
|---|
plays a decisive role in determining the extent to which T cells are eliminated after activation. Involvement of GSK-3
in ATCD was tested by measuring T cell survival after GSK-3
inhibition, either ex vivo with chemical and pharmacological inhibitors or in vivo by retroviral expression of a dominant-negative form of GSK-3. We also measured amounts of inactivating phosphorylation of GSK-3
(Ser9) in T cells primed in the presence or absence of LPS. Our results show that GSK-3
activity is required for ATCD and that its inhibition promoted T cell survival. Adjuvant treatment in vivo maintained GSK-3
(Ser9) phosphorylation in activated T cells, whereas with adjuvant-free stimulation it peaked and then decayed as the cells became susceptible to ATCD. We conclude that the duration of GSK-3
inactivation determines activated T cell survival and that natural adjuvant stimulation decreases the severity of clonal contraction in part by keeping a critical proapoptotic regulatory factor, GSK-3
, inactivated. | Introduction |
|---|
|
|
|---|
, and that LPS promotes activated T cell survival by prolonged maintenance of the functionally inhibited form of GSK-3
. ATCD occurs by decreasing signals from IL-2 and other growth factor cytokines affecting the balance of Bcl-2 family members, resulting in mitochondrial outer membrane instability (8). This mechanism is quite different from activation-induced cell death stimulated by death receptors like Fas (CD95) (11), which requires repetitive TCR stimulation (12). ATCD occurs normally in Fas and Fas-ligand knockout mice (13) and it can be reversed by the transgenic (Tg) expression of Bcl-2 (7, 14), suggesting that ATCD follows a Fas-independent pathway. Moreover, Fas-independent death of activated T cells is observed in several physiological contexts such as acute viral infection and immunization with soluble proteins (15, 16, 17).
Some activated T cells must survive through growth factor deficiency following clonal expansion to differentiate into effector and memory cells. TCR-mediated and classical costimulatory signals to T cells are not likely to be sufficient for T cell survival post activation. Although early proliferation is CD28 dependent, CD28 signals alone clearly do not protect the responding T cells from ATCD (9, 18). ATCD can be avoided via signals generated by the engagement of various TLRs on APCs by microbial products (9). The TLRs or the adjuvant receptors bind different pathogen-associated molecules, such as bacterial LPS, and send a series of signals through associated APC to the T cells to boost their responses (19). These adjuvant responses include increased clonal expansion and maintenance of pathogen-specific T cells, which are required for an effective immunity (9, 20, 21).
The mechanism for adjuvant-induced survival effects remains to be defined. Adjuvant effects are correlated with a transient increase in PI3K/phosphorylated-Akt (pAkt) activity, an important activation-associated prosurvival signaling molecule (22). Sustained PI3K/pAkt activity, however, has been shown not to be required for post-expansion survival of activated T cells (10). The transient increase in PI3K/pAkt activity after adjuvant stimulation could trigger downstream prosurvival signals, which in turn could be responsible for increased survival.
GSK-3
is a known target of PI3K/pAkt signaling and has been studied extensively for its proapoptotic functions in neuronal cells (23, 24, 25, 26). GSK-3 was originally identified as a regulator of the metabolic enzyme glycogen synthase (27). Its
isoform, GSK-3
, is regulated by several mechanisms (including phosphorylation at Ser9) and changes in intracellular distribution as well as through an unknown mechanism involving Wnt proteins (28, 29). Other than glycogen synthase, notable signaling proteins regulated by GSK-3
include the transcription factors AP-1, NFATc, p53, and NF
B (p65 and p105), as well as cyclins D1 and E and heat shock factor-1 (30, 31, 32, 33, 34, 35, 36). In addition to neuronal cells, the importance of GSK-3
in lymphocytes is increasingly being appreciated. The first report of a role for GSK-3
in lymphocytes was by Welsh et al. (37), who showed that GSK-3
is inactivated by phosphorylation upon mitogenic stimulation of T cells. GSK-3
is responsible for Ag receptor-mediated regulation of
-catenin in B cells (38). GSK-3
was recently shown to be responsible for differential regulation of TLR-mediated production of both pro- and anti-inflammatory cytokines in monocytes or human PBMC upon stimulation (39). Rapid inactivation of GSK-3
regulates TCR-mediated proliferation of T cells, possibly by inducing NFATc activity and IL-2 production during early activation (40). More recently, Song et al. (41) have shown increased phosphorylation of GSK-3
as a marker of increased pAkt activity upon OX40-mediated costimulation of T cells. But, to date, a role for GSK-3
in post-proliferative T cell survival has not been studied.
We investigated GSK-3
s induction of ATCD using superantigen (SAg) or peptide Ag to activate T cells in vivo. SAg is often used as a tool to study Ag and adjuvant-specific effects on primary T cell activation (9, 10, 42, 43). SAg bound to appropriate class II MHC molecule activates T cells bearing particular V
regions as a part of the TCR. Specifically, the SAg staphylococcal enterotoxin A (SEA) potently stimulates V
3 TCR+ T cells when presented by I-Ek. Acute exposure of responsive T cells to SAg results in activation, expansion, and then deletion of these activated cells by apoptosis (42), which can be prevented by giving LPS within 24 h of the SAg treatment (9). In this study, we show that unrestrained GSK-3
activity causes ATCD, and that we could prevent this death with chemical and pharmacological inhibitors of GSK-3
as well as by expressing a dominant-negative form of GSK-3. In T cells activated under adjuvant-free conditions, GSK-3
was transiently inactivated via Ser9 phosphorylation. However, phosphorylated GSK (phospho-GSK-3
) (Ser9) was maintained for a longer period of time if treatment with LPS was given in vivo. These results indicate that GSK-3
is a major regulator of ATCD, which can be inhibited by the natural adjuvant LPS.
| Materials and Methods |
|---|
|
|
|---|
Six- to 8-wk-old female B10.BR mice were purchased from The Jackson Laboratory. B10.D2/nSnAi and B10.D2/AiTac-TgN (DO11.10)-Ragtml (DORAG) were purchased from Taconic Farms via the Emerging Models program of National Institute of Allergy and Infectious Diseases. OT-II TCR Tg mice were initially purchased from Taconic Farms and then bred in-house. All mice were housed in a specific pathogen-free facility at the University of Louisville, and experiments were conducted according to federal and institutional guidelines and with the approval of the University of Louisville Institutional Animal Care and Use Committee.
Reagents
The staphylococcal enterotoxin A (SEA) was purchased from Toxin Technologies, and OVA peptide323329 (OvaP) was purchased from Peptron. Tissue culture reagents and SuperScript III Platinum Two-Step qRT-PCR kit for cDNA preparation were obtained from Invitrogen Life Technologies. Fluorescent-labeled Abs were purchased from BD Pharmingen or Jackson ImmunoResearch Laboratories. Abs for intracellular staining and Western blots were obtained from Cell Signaling Technologies. SB216763 was purchased from Tocris Bioscience. Stock solutions of 10 mM SB216763 were prepared in DMSO. EasySep CD4+ T cell Negative Purification kit was obtained from Stem Cell Technologies, RNA isolation kit was obtained from Qiagen and Power SYBR-Green RT-PCR mastermix from Applied Biosystems. All other reagents were purchased from Sigma-Aldrich.
T cell activation, in vitro culture, and survival analysis
Activated T cells were harvested from SAg-treated mice as described earlier (10). Briefly, B10.BR mice expressing V
3 as a part of their TCRs were activated by i.v. injection of 0.1 µg of SEA and 16 h later with 10 µg of LPS. Spleens were harvested at different time points after activation, RBC were lysed with ACK buffer (160 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA), and splenocytes were resuspended at 5 x 106 cells/ml in RPMI 1640 tissue culture medium supplemented and L-glutamine. FBS was not used in any primary cell culture experiment. For ex vivo survival analysis, 5 x 105 cells/well were plated in a 96-well tissue culture plate and incubated for 20 h at 37°C in a CO2 incubator.
Following incubation, cells were washed with staining buffer (1x HBSS, 2% heat-inactivated bovine serum, 0.02% sodium azide) and stained with anti-CD4-allophycocyanin, anti-CD8-FITC, and anti-V
3-PE mAbs. Survival was determined using a flow cytometer (FACSCalibur; BD Immunocytometry Systems) to measure the proportion of V
3+CD4+ and V
3+CD8+ T cells, the light scatter properties of which showed that they were alive. We have previously shown that live-dead gating to assess activated T cell survival gives identical results to staining with annexin V and propidium iodide (10).
GSK-3
inhibition and survival of activated T cells
Survival effects with chemical or pharmacological inhibitors of GSK-3
were tested in splenocytes harvested 40 h after activation by SEA injection of B10.BR mice. Cells were incubated in vitro for 20 h in RPMI 1640 supplemented with lithium chloride (025 mM) or kenpaullone (040 µM). Survival of V
3+ T cells upon GSK-3
inhibition was measured by flow cytometry as described above. Splenocytes were also harvested from mice given SEA in the presence or absence of LPS to test for survival after 20-h incubation with the GSK-3 inhibitor SB216763 (040 µM), with or without IL-2 (50 ng/ml). Vehicle control for respective inhibitors were tested simultaneously. Survival of V
3+ T cells upon GSK-3
inhibition were assessed using flow cytometry as described above (10).
For adoptive transfer experiments, spleens and lymph nodes harvested from naive DORAG mice were processed into single-cell suspensions in HBSS. Four million cells were injected into recipient B10.D2 mice via tail-vein injection. Twenty-four hours later, the recipient mice were injected i.v. with 50 µg of OvaP with or without LPS. Seventy-two hours after activation, spleens were harvested and single-cell suspensions were incubated for 20 h at 37°C in RPMI 1640 medium supplemented with or without SB216763 (20 µM). Following incubation, cells were surface stained with a clonotypic Ab against DO11.10 TCR (KJ1-26; Caltag Laboratories) and with an anti-CD4 mAb and viability of DO11.10 TCR+CD4+ T cells were assessed as described previously (10).
In vivo inhibition of GSK-3
with pharmacological inhibitors
To test the effect of GSK-3
inhibition in vivo, B10.BR mice were injected with 0.1 µg of SEA and 16 h later a batch of these animals was injected i.v. either with SB216763 (25 µg/gm body weight) prepared in 1% FBS or with vehicle control. Three more doses of SB216763 or vehicle control were given to these animals i.p. every 4 h. Animals were sacrificed and splenocytes were harvested after 2 or 7 days to enumerate V
3+ T cells.
Retroviral expression of GSK3DN in activated T cells
In vivo expression of a dominant-negative form of GSK-3
in activated T cells was tested for its ability to rescue the cells from ATCD. DORAG mice expressing D0.11.10 TCR were used as a source of cycling T cells to increase the frequency of retroviral transduction. Forty-eight hours after injection of OvaP (50 µg), lymph nodes and splenocytes were harvested and cells were infected with retrovirus containing the parental retroviral vector MSCV-IRES-Thy1.1 (MiT) or MiT vectors encoding a dominant-negative form of GSK-3
(GSK3DN) or Bcl-2 as described previously (44). GSK3DN encodes a point mutation at aa 85 in which lysine is substituted with arginine making the kinase inactive (45). Fixed numbers of infected cells were then injected into B10.D2 recipients. Seven days after cell transfer, the animals were sacrificed and recovery of infected CD4+ T cells expressing Thy1.1 was determined by flow cytometry after staining cells with anti-CD4 and anti-Thy1.1 mAb (Fig. 5A).
|
To correlate the adjuvant-induced survival pathway in activated T cells with ex vivo inhibition of GSK-3
, we tested selected GSK-3
targets by qPCR and Western blots. Spleens from OT-II mice injected with OvaP (100 µg) in presence or absence of 10 µg LPS were harvested after 72 h after activation. CD4+ T cells from spleens of naive and treated mice were enriched to >95% by magnetic separation using the EasySep CD4 T cell Negative Selection kit. The enriched CD4+ T cells from OvaP-treated spleens were incubated in vitro for 6 h with SB216763 (20 µM) and then RNA was isolated using Qiagen RNeasy kit (Qiagen). cDNA was prepared from isolated RNA using SuperScript III Platinum Two-Step qRT-PCR kit (Invitrogen Life Technologies). Primers for mouse mcl1 (forward (Fwd): AGAGCGCTGGAGACCCTG; reverse (Rev): CTATCTTATTAGATATGCCAGACC),
-catenin (Fwd: TGGTCGAGGAGTAACAATACAAAT; Rev: TAAAACAAAGAACAAGCAAGGCTA), il2 (Fwd: CCTGAGCAGGATGGAGAATTACA; Rev: TCCAGAACATGCCGCAGAG), bcl2 (Fwd: ATCTTCTCCTTCCAGCCT; Rev: TCATTCAACCAGACATGC), bcl-x (Fwd: TGGAGTCAGTTTAGTGATGTC; Rev: GCTCGATTGTTCCCGTAGAG), and
-actin (Fwd: TGGAATCCTGTGGCATCCATGAAAC; Rev: TAAAACGCAGCTCAGTAACAGTCCG) were purchased from Sigma-Genosys. Quantitative RT-PCR was performed using Applied Biosystems 7500 Fast system using Power SYBR-Green RT-PCR mastermix. Expression of each target gene was normalized to
-actin. Fold expression was calculated using the
method (46). mRNA and cDNA prepared from enriched CD4+T cells activated in vitro with PMA (50 ng/ml) and ionomycin (500 ng/ml) for 6 h were used as positive controls. For immunoblot analysis,
95% pure CD4+ T cells were lysed by sonication in cold SDS-PAGE sample buffer containing a protease inhibitor mixture. Lysates from 2 x 106 CD4+ T cells were separated by electrophoresis on a 10% SDS-polyacrylamide gel and transferred to nitrocellulose membrane (GE Healthcare). Transferred membranes were blocked with 5% nonfat milk in TBS (100 mM Tris, 150 mM NaCl (pH 7.4)) for 1 h at room temperature and incubated overnight at 4°C with Abs against Bcl-2, Bcl-3,
-actin (Santa Cruz Biotechnology), Mcl-1 (Rockland Immunochemicals), and
-catenin, respectively. To measure intracellular levels of phospho-GSK-3
(Ser9), transferred lysates were also incubated with anti-phospho-GSK-3
(Ser9)Ab. Bands were developed by incubation with HRP-conjugated secondary Ab for 1 h at room temperature, and immunoreactive bands were visualized using the ECL detection reagents (GE Healthcare). Films were scanned in a densitometric scanner and intensity of the bands were measured by Quantity One software (version 4.2.3; Bio-Rad).
Intracellular staining for phospho-GSK-3
Phospho-GSK-3
(Ser9) levels in activated T cells were also measured by intracellular staining. Briefly, splenocytes harvested at different time points after SEA activation, with or without adjuvant treatment, were stained with anti-CD4-allophycocyanin and anti-V
3-FITC mAb for 1 h at room temperature as described earlier. The cells were washed then fixed with 1% paraformaldehyde for 15 min at 37°C and permeabilized with ice-cold pure methanol overnight. The fixed cells were stained with anti-phospho-GSK-3
(Ser9) polyclonal Ab for 1 h followed by anti-rabbit IgG conjugated with PE (Jackson ImmunoResearch Laboratories). After washing twice, the levels of phospho-GSK-3
in V
3 CD4+ cells were measured via flow cytometry. Rabbit
globulin (Jackson ImmunoResearch Laboratories) was used to normalize for nonspecific binding.
Statistical analysis
SPSS statistical software package for Windows (version 13.0) was used to run ANOVA, two-tailed unequal variance t test, and Students t test on the data presented. A value of p < 0.05 was considered significant. MS Excel 2003 was used for calculating SDs and SEMs.
| Results |
|---|
|
|
|---|
inhibitors in ex vivo cultures
Survival effects of GSK-3
inhibition were tested on SAg-stimulated T cells by injecting B10.BR mice with SEA and cultured ex vivo for 20 h in increasing concentrations of the GSK-3
inhibitors, lithium chloride (025 mM), or kenpaullone (040 µM). Although lithium and kenpaullone each act as inhibitors of distinct spectra of kinases, the only kinase targeted by both is GSK-3
(29). Flow cytometric analysis showed increases in survival of V
3+CD4+ and V
3+CD8+ T cells an average of 2.75- and 2.8-fold, respectively, with 12.5 mM lithium chloride (Fig. 1). Concentration of LiCl above 12.5 µM reduced the viability of cells, indicating nonspecific actions of the inhibitor. Similar results were observed with kenpaullone, a small molecule inhibitor of GSK-3
. Five to 10 µM kenpaullone increased survival of activated T cells by 2.5- and 2.75-fold in activated CD4+ and CD8+ T cells. respectively. These results indicate that inhibition of GSK-3
can prevent ATCD in ex vivo culture.
|
inhibition occurs to physiologically relevant levels
Under normal physiological conditions, natural adjuvants like LPS increase the survival of activated T cells (9, 21). To determine whether GSK-3
inhibition could explain some or all of these adjuvant-associated survival effects, T cells activated in the presence or absence of LPS were cultured with the GSK-3
-specific inhibitor SB216763 (47). Splenocytes were harvested at the peak of clonal expansion from B10.BR mice treated with SEA alone or with LPS, which will be designated as "SEA" or "SEA+LPS" T cells hereafter. SEA or SEA+LPS T cells were incubated ex vivo for 20 h with increasing concentrations of SB216763. Following incubation, the viabilities of the V
3+ T cells within each population were analyzed. The viability of SEA-treated T cells was increased by SB216763 in a dose-dependent manner to a maximum increase of
2-fold in CD4+ T cells to 2.9-fold in CD8+ T cells at 20 µM inhibitor, which almost exactly replicated the survival effect of LPS treatment (Fig. 2). SB216763 had no significant effect on the SEA+LPS-treated CD4+ or CD8+ T cells (Fig. 2). These results strongly suggested that ATCD is caused by GSK-3
activity and that LPS could influence survival from ATCD by inhibiting GSK-3
.
|
.
GSK-3
mediated death in peptide-stimulated T cells
To confirm that the prosurvival effects of GSK-3
inhibition were not specific to SAg-stimulated T cells, peptide-stimulated T cells were also tested. DO11.10 T cells were adoptively transferred to non-Tg B10.D2 recipients and stimulated by injection of OvaP alone or with LPS (OvaP+LPS). After 72-h in vivo activation, splenocyte populations containing activated DO11.10 T cells were cultured in the presence or absence of 20 µM SB216763 and tested for viability (Fig. 3). As was seen in the SAg-activated model, inhibition of GSK-3
with SB216763 increased the viability of DO11.10+CD4+ T cells that had been stimulated with OvaP alone. Also as before, pharmacological inhibition of GSK-3
generated survival effects that matched those of LPS, whereas LPS-mediated survival was not further enhanced by GSK-3
inhibition (Fig. 3). This result indicated that 1) GSK-3
contributes to ATCD in peptide-stimulated T cells and 2) the LPS-associated survival effects may be explained by adjuvant-inducible inhibition of GSK-3
.
|
inhibition promotes activated T cell survival in vivo
SB216763 was tested for its ability to rescue T cells from clonal contraction in vivo. B10.BR mice were injected with SEA to activate V
3+ T cells and then treated with either SB216763 (a total of four doses of 25 µg/g body weight/injection) or vehicle control as described in Materials and Methods. Splenocytes were harvested and recovery of V
3+CD4+ and V
3+CD8+ T cells was analyzed after 2 or 7 days. After 2 days, 2.5- to 3-fold increases in V
3-expressing T cells were observed in SEA-treated animals, which was unchanged in animals also given SB216763. This result indicated that early activation was the same with or without GSK-3
inhibition. However, after 7 days, although there was a significant drop in number of V
3-expressing cells in animals from both treatment groups, an average of 2.2-fold more V
3-expressing CD4+ T cells and 1.6-fold more CD8+ T cells were present in SB216763-treated animals (Fig. 4). This experiment confirmed a role for GSK-3
in mediating ATCD in vivo but could not determine whether GSK-3
inhibition in T cells or in other cell types was responsible for protection from ATCD.
|
Direct effects of GSK-3
inhibition in T cells was tested by retroviral gene transfer of a dominant-negative form of GSK-3
in DO11.10 T cells. Peptide-stimulated CD4+ T cells from DO11.10 TCR Tg mice were infected with a mouse retrovirus expressing Thy1.1 (MiT-vector control), or MiT encoding dominant-negative GSK-3
(MiT-GSK3DN), or Bcl-2 (MiT-Bcl2) as positive control and then transferred to B10.D2-syngeneic recipients. As shown in Fig. 5B, in vitro culture showed an increase in survival of the CD4+ T cells when transduced with MiT-GSK3DN and MiT-Bcl2, respectively, compared with parental MiT vector. Seven days after transfer, the number of infected T cells (Thy1.1+) persisting in the spleens was determined. Recovery of the transduced CD4+ T cells (Thy1.1+CD4+) was increased by an average of 4.3-fold with MiT-GSK3DN compared with parental MiT vector. Recovery of CD4+ T cells expressing control MiT-Bcl2 was 2-fold more than the cells expressing MiT (Fig. 5C). These results indicate that GSK-3
activity within the T cells promotes ATCD in vivo.
Inhibition of GSK-3
activity by SB216763 is confirmed by expression of its substrates
We next tested downstream targets of GSK-3
s kinase activity to determine which of several candidates might be affected in activated T cells. GSK-3
activity is usually associated with increased degradation of phosphorylated substrates (48, 49). Therefore, increases in protein expression were expected to result from induced inhibition of GSK-3
. For these experiments, OT-II TCR Tg mice were used (50). The OT-II TCR, like the DO.11.10-TCR, is activated by OvaP, but adjuvant effects are more readily observed in OT-II Tg mice (P.J., unpublished observation) and relatively pure populations of activated CD4+ T cells can be prepared by negative selection methods (
95% CD4+ T cells that have been untouched by potentially cross-linking Abs).
OT-II Tg mice were injected (i.v.) with 100 µg of OvaP in the absence of LPS and after 72 h, CD4+ T cells were isolated from harvested lymph nodes and spleens. The cells were incubated for 6 h with or without 20 µM SB216763 and then used to prepare cDNA from total cellular RNA. The cDNAs were probed with primers for Mcl-1,
-catenin, and IL-2.
-Actin was used as control. Expression of other known prosurvival factors like Bcl-2 and Bcl-XL were also tested. qPCR results showed only 2-fold increases in transcription of
-catenin, mcl-1 and il-2 (Fig. 6A) with SB216763 (ex vivo) or LPS (in vivo) when compared with OvaP only. These values were not statistically significant and were orders of magnitude lower than transcripts levels from CD4+ T cells after activation with PMA/ionomycin (Fig. 6C). The transcript messages of bcl-2 and bcl-x also remained unchanged with SB216763 or LPS treatment (Fig. 6A). As expected, these data indicate that GSK-3
inhibition does not regulate these factors at the level of transcription.
|
-catenin and Mcl-1 protein showed 6.5-fold and 1.7-fold increases, respectively, after SB216763 treatment. There were no changes in expression of Bcl-2 and Bcl-XL protein levels (Fig. 7, A and B). We consistently saw these patterns of protein expression after SB216763-mediated inhibition of GSK-3
in peptide-stimulated T cells. Increased protein levels but not transcription of
-catenin and Mcl-1, upon GSK-3
inhibition with SB216763, was consistent with the protection of these proteins from GSK-3
-triggered degradation (51, 52).
|
is inhibited upon SB216763 treatment and also indicate that prosurvival factors like IL-2, Bcl-2 and Bcl-XL are not likely to be playing a role in this survival pathway. Instead, increased
-catenin and Mcl-1 were correlated with the survival effects of GSK-3
inhibition.
Molecular targets confirm GSK-3
inhibition in activated T cells after adjuvant stimulation
Similar measurements of GSK-3
targets were made using T cells from OvaP+LPS-treated mice to determine whether the adjuvant effects of LPS were likely to be explained by natural inhibition of GSK-3
. As was true of SB216763-mediated GSK-3
inhibition, qPCR results for transcript levels of
-catenin, mcl-1, il-2, bcl-2, and bcl-xl showed no statistically significant changes in CD4+ T cell populations from OvaP+LPS as compared with OvaP-treated mice (Fig. 6B). Protein levels of these targets were measured by immunoblot as described above, and densitometric analysis of the immunoblots indicated a 5-fold increase in
-catenin signal after LPS stimulation when compared with OvaP-treated cells only (Fig. 7, C and D). Mcl-1 signal was increased by 1.5-fold, whereas there was no change in Bcl-2 and Bcl-x signals (Fig. 7, C and D). Comparison of Fig. 7, B and D, shows that LPS treatment in vivo gave strikingly similar patterns of protein expression as GSK-3
pharmacological inhibition ex vivo.
Adjuvant treatment prolongs GSK-3
phosphorylation in vivo
Maintenance of
-catenin and Mcl-1 strongly indicated that LPS-induced survival effects were mediated by natural inhibition of GSK-3
activity. To confirm this hypothesis, intracellular levels of the phosphorylation-inhibited form of GSK-3
(phospho-GSK-3
(Ser9)) were measured in V
3+CD4+ T cells from B10.BR mice at different time points after activation with SEA and treatment with LPS. Fig. 8A shows that GSK-3
was rapidly phosphorylated at Ser9 upon activation with SEA alone, but in the absence of adjuvants levels of phospho-GSK-3
(Ser9) started decreasing around 20 h after activation to almost its starting level by 44 h. Addition of LPS after 16 h of activation did not increase the peak levels of phospho-GSK-3
(Ser9), but maintained them for as long as 44 h, the time point at which the T cells show maximal adjuvant-induced survival effects. Hence, LPS adjuvant effects resulted in increased stability of a naturally inhibited form of GSK-3
.
|
(Ser9) in OvaP-stimulated CD4+ T cells were also measured by immunoblot from OT-II mice injected with OvaP or OvaP+LPS (Fig. 8B). Densitometric analysis showed a 10-fold increase in phospho-GSK-3
levels in OvaP+LPS-activated T cells and only a 2-fold change in total GSK, when compared with OvaP-activated T cells.
Together, these results indicate that at least one mechanism through which the natural adjuvant LPS promotes activated T cell survival is by maintaining the inactive form of GSK-3
(phosphor-Ser9), thereby preventing GSK-3
from inducing ATCD.
| Discussion |
|---|
|
|
|---|
activity is required for ATCD following Ag-stimulated proliferation and (2) the natural adjuvant LPS protected activated T cells from clonal death in a manner that was correlated with maintenance of a functionally inhibited form of GSK-3
. Hence, GSK-3
is a novel and regulatable effector of ATCD.
Clonally expanded T cells survived longer upon pharmacological inhibition of GSK-3
, rescuing them from ATCD. T cells activated in the absence of adjuvants and then cultured briefly in the presence of lithium chloride, kenpaullone, or SB216763 survived better, strongly indicating that unmanipulated cells were dying as a result of GSK-3
activity (Figs. 13). Furthermore, increased yield of activated T cells from mice injected with SB216763 confirmed that ATCD is promoted by GSK-3
activity and can be reduced by pharmacological inhibition in vivo (Fig. 4). The fact that involvement of GSK-3
in ATCD was intrinsic to activated T cells and not an effect of accessory cells was confirmed upon increased recovery of dominant-negative GSK-3
expressing activated T cells (Fig. 5). We have also regularly observed increased survival of pure activated CD4+ T cells from OT-II Tg mice upon pharmacological inhibition of GSK-3
(data not shown).
Not only can GSK-3
inhibition improve activated T cell survival under experimental conditions, but it is likely to be an important part of physiological adjuvant-induced survival. Increased survival of Ag-activated T cells with increasing doses of SB216763 and convergence of that pattern with the survival of LPS-treated cells indicates that some or all of the LPS-induced survival may be attributable to GSK-3
inhibition (Figs. 2 and 3). Intracellular levels of phospho-GSK-3
(Ser9) show that indeed LPS protects GSK-3
inhibition in clonally activated CD4 T cells. Conversely, T cells activated under adjuvant-free conditions do not retain phosphorylation at the Ser9 residue (Fig. 8).
GSK-3
activity has been previously reported to regulate IL-2 production and control proliferation during early T cell activation (40). However, our observations were made during late clonal expansion, and failed to show a correlation with the transcription or biological function of IL-2 because IL-2-responsive factors such as Bcl-2 were not affected by GSK-3
inhibition. Although addition of IL-2 could increase the survival of activated T cells after SB216763 treatment, it appeared that IL-2 activity imparted only additive survival effects (Fig. 2). There were only modest (nonsignificant) changes in IL-2 transcript levels with either SB216763-mediated inhibition of GSK-3
or LPS treatment. Moreover, Bcl-2 and Bcl-XL transcript and protein levels were unchanged, indicating no evidence of T cell exposure to IL-2 or related cytokines (Figs. 6 and 7). These results corroborate previous reports in which neither Bcl-2 or Bcl-XL were associated with adjuvant-mediated inhibition of ATCD (7, 21, 43) and mixed-culture experiments that showed that soluble factors were not associated with the late survival effects of LPS adjuvant activity (data not shown).
Inhibition of GSK-3
by phosphorylation has been shown to be caused by CD28 or OX-40-mediated costimulatory signals in in vitro-stimulated T cells (41, 53). Similarly, phosphorylation of GSK-3
has been shown as a target of CpG-mediated costimulatory signals through MyD88 adaptor molecules in T cells (54). These reports essentially use GSK-3
inhibition as the downstream marker of PI3K/pAkt pathway. Our work adds to these reports by showing that unrestrained GSK-3
activity drives ATCD.
The strong increases in
-catenin protein levels upon either SB216763-mediated or LPS-induced inhibition of GSK-3
are also striking.
-Catenin has been associated with cell cycle control and hemopoietic cell cycle renewal (55). Although it is not an obvious "end-point survival factor," recent reports suggest that it plays a role in thymocyte survival and T cell development (56, 57). Therefore, both Mcl-1 and
-catenin warrant further investigation as mediators of adjuvant-mediated survival effects.
Maurer et al. (52) reported Mcl-1 to be a target of GSK-3
when pharmacological inhibition of GSK-3
lead to maintenance of Mcl-1. Mcl-1 is a Bcl-2 family protein that can act as a key molecule in apoptosis control, promoting cell survival, and acting as a critical factor for development and maintenance of B and T lymphocytes in mammals (58). In our experiments, Mcl-1 protein expression showed consistent but slight increase with either SB216763 treatment or LPS adjuvant effects (Fig. 7). It is nevertheless striking that Mcl-1 protein expression increased whereas Bcl-2 and Bcl-XL remained unchanged, which correlates with, but does not prove, a role for Mcl-1 in the GSK-3
inhibition-mediated survival.
This study shows, for the first time, that GSK-3
contributes to ATCD, and point to a mechanism through which adjuvants can increase the survival of activated T cells leading to effective immune responses. Pharmacological inhibitors of GSK-3
are currently being developed, primarily for their potential to treat neurodegenerative diseases (29, 35). Our data show that these same agents are likely to be beneficial to a variety of immune responses from tumor immunotherapy to immunization.
| Acknowledgment |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by U.S. Public Health Service Grants AI51377 and AI059023, the Commonwealth of Kentucky Research Challenge Trust Fund, the Kentucky Lung Cancer Research Program, and the Jewish Hospital Foundation. ![]()
2 Address correspondence and reprint requests to Dr. Thomas C. Mitchell, Institute for Cellular Therapeutics, University of Louisville, Donald Baxter Research Building, 570 South Preston Street, Room 404C, Louisville, KY 40202. E-mail address: tom.mitchell{at}louisville.edu ![]()
3 Abbreviations used in this paper: ACTD, activated T cell death; glycogen synthase kinase; Tg, transgenic; pAkt, phosphorylated-Akt; phospho-GSK, phosphorylated GSK; SAg, superantigen; SEA, staphylococcal enterotoxin A; qPCR, quantitative PCR; Fwd, forward; Rev, reverse; CT, cycle threshold. ![]()
Received for publication December 14, 2006. Accepted for publication March 1, 2007.
| References |
|---|
|
|
|---|
in neuronal apoptosis induced by trophic withdrawal. J. Neurosci. 20: 2567-2574.
in neuronal apoptosis: links to
phosphorylation. Eur J. Neurosci. 15: 651-660. [Medline]
by phosphorylation: new kinase connections in insulin and growth-factor signalling. Biochem. J. 296: (Pt. 1):15-19. [Medline]
in the regulation of HSF-1 activity. J. Neurochem. 75: 2401-2408. [Medline]
(GSK3
) binds to and promotes the actions of p53. J. Biol. Chem. 278: 48872-48879.
regulates cyclin D1 proteolysis and subcellular localization. Genes Dev. 12: 3499-3511.
functions to specify gene-specific, NF-
B-dependent transcription. Mol. Cell. Biol. 25: 8444-8455.
-catenin via protein kinase C-mediated inhibition of glycogen synthase kinase-3. J. Immunol. 169: 758-769. 
CT method. Methods 25: 402-408. [Medline]
: structural basis for phosphate-primed substrate specificity and autoinhibition. Cell 105: 721-732. [Medline]
and
-catenin and promotes GSK-3
-dependent phosphorylation of
-catenin. EMBO J. 17: 1371-1384. [Medline]