The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 178, 6083 -6091
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sengupta, S.
Right arrow Articles by Mitchell, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sengupta, S.
Right arrow Articles by Mitchell, T. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

Unrestrained Glycogen Synthase Kinase-3beta Activity Leads to Activated T Cell Death and Can Be Inhibited by Natural Adjuvant1

Sadhak Sengupta*, Padmini Jayaraman*,{dagger}, Paula M. Chilton*, Carolyn R. Casella* and Thomas C. Mitchell2,*,{dagger}

* Institute for Cellular Therapeutics and {dagger} Department of Microbiology and Immunology, University of Louisville School of Medicine, Louisville, KY 40202


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Activated T cell death (ATCD) after peak clonal expansion is required for effective homeostasis of the immune system. Using a mouse model of T cell clonal expansion and contraction, we found that regulation of the proapoptotic kinase glycogen synthase kinase (GSK)-3beta plays a decisive role in determining the extent to which T cells are eliminated after activation. Involvement of GSK-3beta in ATCD was tested by measuring T cell survival after GSK-3beta inhibition, either ex vivo with chemical and pharmacological inhibitors or in vivo by retroviral expression of a dominant-negative form of GSK-3. We also measured amounts of inactivating phosphorylation of GSK-3beta (Ser9) in T cells primed in the presence or absence of LPS. Our results show that GSK-3beta activity is required for ATCD and that its inhibition promoted T cell survival. Adjuvant treatment in vivo maintained GSK-3beta (Ser9) phosphorylation in activated T cells, whereas with adjuvant-free stimulation it peaked and then decayed as the cells became susceptible to ATCD. We conclude that the duration of GSK-3beta inactivation determines activated T cell survival and that natural adjuvant stimulation decreases the severity of clonal contraction in part by keeping a critical proapoptotic regulatory factor, GSK-3beta, inactivated.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Activation signals from the TCR-MHC complex and costimulatory molecules drive T cell division and promote early survival of the dividing T cells (1, 2, 3, 4). However, T cell proliferation is followed by activated T cell death (ATCD)3 that is caused by loss of access to survival signals, transcriptional inhibition of Bcl-2 and Bcl-XL, and Bim-triggered apoptosis (5, 6, 7, 8). ATCD is important for reducing the risk of autoimmune responses, but can hamper immunity because complete elimination of the responding T cells would reduce the ability to resist subsequent infection. Vella et al. (9) first showed that in vivo-activated T cells were protected from ATCD by the natural adjuvant LPS, but the survival pathway still remains unclear. Our recent report on transient activation of PI3K in activated T cells after LPS injection suggests involvement of post PI3K signaling effects in adjuvant-mediated survival (10). In this study, we show that ATCD requires activity of the Ser/Thr kinase, glycogen synthase kinase (GSK)-3beta, and that LPS promotes activated T cell survival by prolonged maintenance of the functionally inhibited form of GSK-3beta.

ATCD occurs by decreasing signals from IL-2 and other growth factor cytokines affecting the balance of Bcl-2 family members, resulting in mitochondrial outer membrane instability (8). This mechanism is quite different from activation-induced cell death stimulated by death receptors like Fas (CD95) (11), which requires repetitive TCR stimulation (12). ATCD occurs normally in Fas and Fas-ligand knockout mice (13) and it can be reversed by the transgenic (Tg) expression of Bcl-2 (7, 14), suggesting that ATCD follows a Fas-independent pathway. Moreover, Fas-independent death of activated T cells is observed in several physiological contexts such as acute viral infection and immunization with soluble proteins (15, 16, 17).

Some activated T cells must survive through growth factor deficiency following clonal expansion to differentiate into effector and memory cells. TCR-mediated and classical costimulatory signals to T cells are not likely to be sufficient for T cell survival post activation. Although early proliferation is CD28 dependent, CD28 signals alone clearly do not protect the responding T cells from ATCD (9, 18). ATCD can be avoided via signals generated by the engagement of various TLRs on APCs by microbial products (9). The TLRs or the adjuvant receptors bind different pathogen-associated molecules, such as bacterial LPS, and send a series of signals through associated APC to the T cells to boost their responses (19). These adjuvant responses include increased clonal expansion and maintenance of pathogen-specific T cells, which are required for an effective immunity (9, 20, 21).

The mechanism for adjuvant-induced survival effects remains to be defined. Adjuvant effects are correlated with a transient increase in PI3K/phosphorylated-Akt (pAkt) activity, an important activation-associated prosurvival signaling molecule (22). Sustained PI3K/pAkt activity, however, has been shown not to be required for post-expansion survival of activated T cells (10). The transient increase in PI3K/pAkt activity after adjuvant stimulation could trigger downstream prosurvival signals, which in turn could be responsible for increased survival.

GSK-3beta is a known target of PI3K/pAkt signaling and has been studied extensively for its proapoptotic functions in neuronal cells (23, 24, 25, 26). GSK-3 was originally identified as a regulator of the metabolic enzyme glycogen synthase (27). Its beta isoform, GSK-3beta, is regulated by several mechanisms (including phosphorylation at Ser9) and changes in intracellular distribution as well as through an unknown mechanism involving Wnt proteins (28, 29). Other than glycogen synthase, notable signaling proteins regulated by GSK-3beta include the transcription factors AP-1, NFATc, p53, and NF{kappa}B (p65 and p105), as well as cyclins D1 and E and heat shock factor-1 (30, 31, 32, 33, 34, 35, 36). In addition to neuronal cells, the importance of GSK-3beta in lymphocytes is increasingly being appreciated. The first report of a role for GSK-3beta in lymphocytes was by Welsh et al. (37), who showed that GSK-3beta is inactivated by phosphorylation upon mitogenic stimulation of T cells. GSK-3beta is responsible for Ag receptor-mediated regulation of beta-catenin in B cells (38). GSK-3beta was recently shown to be responsible for differential regulation of TLR-mediated production of both pro- and anti-inflammatory cytokines in monocytes or human PBMC upon stimulation (39). Rapid inactivation of GSK-3beta regulates TCR-mediated proliferation of T cells, possibly by inducing NFATc activity and IL-2 production during early activation (40). More recently, Song et al. (41) have shown increased phosphorylation of GSK-3beta as a marker of increased pAkt activity upon OX40-mediated costimulation of T cells. But, to date, a role for GSK-3beta in post-proliferative T cell survival has not been studied.

We investigated GSK-3beta’s induction of ATCD using superantigen (SAg) or peptide Ag to activate T cells in vivo. SAg is often used as a tool to study Ag and adjuvant-specific effects on primary T cell activation (9, 10, 42, 43). SAg bound to appropriate class II MHC molecule activates T cells bearing particular Vbeta regions as a part of the TCR. Specifically, the SAg staphylococcal enterotoxin A (SEA) potently stimulates Vbeta3 TCR+ T cells when presented by I-Ek. Acute exposure of responsive T cells to SAg results in activation, expansion, and then deletion of these activated cells by apoptosis (42), which can be prevented by giving LPS within 24 h of the SAg treatment (9). In this study, we show that unrestrained GSK-3beta activity causes ATCD, and that we could prevent this death with chemical and pharmacological inhibitors of GSK-3beta as well as by expressing a dominant-negative form of GSK-3. In T cells activated under adjuvant-free conditions, GSK-3beta was transiently inactivated via Ser9 phosphorylation. However, phosphorylated GSK (phospho-GSK-3beta) (Ser9) was maintained for a longer period of time if treatment with LPS was given in vivo. These results indicate that GSK-3beta is a major regulator of ATCD, which can be inhibited by the natural adjuvant LPS.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Animals

Six- to 8-wk-old female B10.BR mice were purchased from The Jackson Laboratory. B10.D2/nSnAi and B10.D2/AiTac-TgN (DO11.10)-Ragtml (DORAG) were purchased from Taconic Farms via the Emerging Models program of National Institute of Allergy and Infectious Diseases. OT-II TCR Tg mice were initially purchased from Taconic Farms and then bred in-house. All mice were housed in a specific pathogen-free facility at the University of Louisville, and experiments were conducted according to federal and institutional guidelines and with the approval of the University of Louisville Institutional Animal Care and Use Committee.

Reagents

The staphylococcal enterotoxin A (SEA) was purchased from Toxin Technologies, and OVA peptide323–329 (OvaP) was purchased from Peptron. Tissue culture reagents and SuperScript III Platinum Two-Step qRT-PCR kit for cDNA preparation were obtained from Invitrogen Life Technologies. Fluorescent-labeled Abs were purchased from BD Pharmingen or Jackson ImmunoResearch Laboratories. Abs for intracellular staining and Western blots were obtained from Cell Signaling Technologies. SB216763 was purchased from Tocris Bioscience. Stock solutions of 10 mM SB216763 were prepared in DMSO. EasySep CD4+ T cell Negative Purification kit was obtained from Stem Cell Technologies, RNA isolation kit was obtained from Qiagen and Power SYBR-Green RT-PCR mastermix from Applied Biosystems. All other reagents were purchased from Sigma-Aldrich.

T cell activation, in vitro culture, and survival analysis

Activated T cells were harvested from SAg-treated mice as described earlier (10). Briefly, B10.BR mice expressing Vbeta3 as a part of their TCRs were activated by i.v. injection of 0.1 µg of SEA and 16 h later with 10 µg of LPS. Spleens were harvested at different time points after activation, RBC were lysed with ACK buffer (160 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA), and splenocytes were resuspended at 5 x 106 cells/ml in RPMI 1640 tissue culture medium supplemented and L-glutamine. FBS was not used in any primary cell culture experiment. For ex vivo survival analysis, 5 x 105 cells/well were plated in a 96-well tissue culture plate and incubated for 20 h at 37°C in a CO2 incubator.

Following incubation, cells were washed with staining buffer (1x HBSS, 2% heat-inactivated bovine serum, 0.02% sodium azide) and stained with anti-CD4-allophycocyanin, anti-CD8-FITC, and anti-Vbeta3-PE mAbs. Survival was determined using a flow cytometer (FACSCalibur; BD Immunocytometry Systems) to measure the proportion of Vbeta3+CD4+ and Vbeta3+CD8+ T cells, the light scatter properties of which showed that they were alive. We have previously shown that live-dead gating to assess activated T cell survival gives identical results to staining with annexin V and propidium iodide (10).

GSK-3beta inhibition and survival of activated T cells

Survival effects with chemical or pharmacological inhibitors of GSK-3beta were tested in splenocytes harvested 40 h after activation by SEA injection of B10.BR mice. Cells were incubated in vitro for 20 h in RPMI 1640 supplemented with lithium chloride (0–25 mM) or kenpaullone (0–40 µM). Survival of Vbeta3+ T cells upon GSK-3beta inhibition was measured by flow cytometry as described above. Splenocytes were also harvested from mice given SEA in the presence or absence of LPS to test for survival after 20-h incubation with the GSK-3 inhibitor SB216763 (0–40 µM), with or without IL-2 (50 ng/ml). Vehicle control for respective inhibitors were tested simultaneously. Survival of Vbeta3+ T cells upon GSK-3beta inhibition were assessed using flow cytometry as described above (10).

For adoptive transfer experiments, spleens and lymph nodes harvested from naive DORAG mice were processed into single-cell suspensions in HBSS. Four million cells were injected into recipient B10.D2 mice via tail-vein injection. Twenty-four hours later, the recipient mice were injected i.v. with 50 µg of OvaP with or without LPS. Seventy-two hours after activation, spleens were harvested and single-cell suspensions were incubated for 20 h at 37°C in RPMI 1640 medium supplemented with or without SB216763 (20 µM). Following incubation, cells were surface stained with a clonotypic Ab against DO11.10 TCR (KJ1-26; Caltag Laboratories) and with an anti-CD4 mAb and viability of DO11.10 TCR+CD4+ T cells were assessed as described previously (10).

In vivo inhibition of GSK-3beta with pharmacological inhibitors

To test the effect of GSK-3beta inhibition in vivo, B10.BR mice were injected with 0.1 µg of SEA and 16 h later a batch of these animals was injected i.v. either with SB216763 (25 µg/gm body weight) prepared in 1% FBS or with vehicle control. Three more doses of SB216763 or vehicle control were given to these animals i.p. every 4 h. Animals were sacrificed and splenocytes were harvested after 2 or 7 days to enumerate Vbeta3+ T cells.

Retroviral expression of GSK3DN in activated T cells

In vivo expression of a dominant-negative form of GSK-3beta in activated T cells was tested for its ability to rescue the cells from ATCD. DORAG mice expressing D0.11.10 TCR were used as a source of cycling T cells to increase the frequency of retroviral transduction. Forty-eight hours after injection of OvaP (50 µg), lymph nodes and splenocytes were harvested and cells were infected with retrovirus containing the parental retroviral vector MSCV-IRES-Thy1.1 (MiT) or MiT vectors encoding a dominant-negative form of GSK-3beta (GSK3DN) or Bcl-2 as described previously (44). GSK3DN encodes a point mutation at aa 85 in which lysine is substituted with arginine making the kinase inactive (45). Fixed numbers of infected cells were then injected into B10.D2 recipients. Seven days after cell transfer, the animals were sacrificed and recovery of infected CD4+ T cells expressing Thy1.1 was determined by flow cytometry after staining cells with anti-CD4 and anti-Thy1.1 mAb (Fig. 5A).


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 5. Expression of dominant-negative GSK-3beta inhibits ATCD. A, Schematic diagram of experimental procedure: DO11.10 Rag–/– mice were injected with 50 µg of OvaP, and lymph nodes and splenocytes were pooled after 48 h and infected with retroviral vectors encoding Thy1.1 and either dominant-negative GSK-3 (MiT-GSK3DN) or Bcl-2 (MiT-Bcl2). B, Survival after overnight culture: viability of CD4+ T cells were significantly increased when transduced with MiT-GSK3DN or MiT-Bcl2. C, Infected cells were adoptively transferred into B10.D2 syngeneic host and 7 days after transfer percentage recovery of input Thy1.1+CD4+ T cells was calculated. Expression of GSK3DN increased the persistence of DO11.10+ T cells by 4.3-fold. Results were confirmed to be statistically significant using the paired samples test (*, p < 0.01 and **, p < 0.05).

 
Quantitative PCR (qPCR) and Western blots

To correlate the adjuvant-induced survival pathway in activated T cells with ex vivo inhibition of GSK-3beta, we tested selected GSK-3beta targets by qPCR and Western blots. Spleens from OT-II mice injected with OvaP (100 µg) in presence or absence of 10 µg LPS were harvested after 72 h after activation. CD4+ T cells from spleens of naive and treated mice were enriched to >95% by magnetic separation using the EasySep CD4 T cell Negative Selection kit. The enriched CD4+ T cells from OvaP-treated spleens were incubated in vitro for 6 h with SB216763 (20 µM) and then RNA was isolated using Qiagen RNeasy kit (Qiagen). cDNA was prepared from isolated RNA using SuperScript III Platinum Two-Step qRT-PCR kit (Invitrogen Life Technologies). Primers for mouse mcl1 (forward (Fwd): AGAGCGCTGGAGACCCTG; reverse (Rev): CTATCTTATTAGATATGCCAGACC), beta-catenin (Fwd: TGGTCGAGGAGTAACAATACAAAT; Rev: TAAAACAAAGAACAAGCAAGGCTA), il2 (Fwd: CCTGAGCAGGATGGAGAATTACA; Rev: TCCAGAACATGCCGCAGAG), bcl2 (Fwd: ATCTTCTCCTTCCAGCCT; Rev: TCATTCAACCAGACATGC), bcl-x (Fwd: TGGAGTCAGTTTAGTGATGTC; Rev: GCTCGATTGTTCCCGTAGAG), and beta-actin (Fwd: TGGAATCCTGTGGCATCCATGAAAC; Rev: TAAAACGCAGCTCAGTAACAGTCCG) were purchased from Sigma-Genosys. Quantitative RT-PCR was performed using Applied Biosystems 7500 Fast system using Power SYBR-Green RT-PCR mastermix. Expression of each target gene was normalized to beta-actin. Fold expression was calculated using the Formula method (46). mRNA and cDNA prepared from enriched CD4+T cells activated in vitro with PMA (50 ng/ml) and ionomycin (500 ng/ml) for 6 h were used as positive controls. For immunoblot analysis, ≥95% pure CD4+ T cells were lysed by sonication in cold SDS-PAGE sample buffer containing a protease inhibitor mixture. Lysates from 2 x 106 CD4+ T cells were separated by electrophoresis on a 10% SDS-polyacrylamide gel and transferred to nitrocellulose membrane (GE Healthcare). Transferred membranes were blocked with 5% nonfat milk in TBS (100 mM Tris, 150 mM NaCl (pH 7.4)) for 1 h at room temperature and incubated overnight at 4°C with Abs against Bcl-2, Bcl-3, beta-actin (Santa Cruz Biotechnology), Mcl-1 (Rockland Immunochemicals), and beta-catenin, respectively. To measure intracellular levels of phospho-GSK-3beta (Ser9), transferred lysates were also incubated with anti-phospho-GSK-3beta (Ser9)Ab. Bands were developed by incubation with HRP-conjugated secondary Ab for 1 h at room temperature, and immunoreactive bands were visualized using the ECL detection reagents (GE Healthcare). Films were scanned in a densitometric scanner and intensity of the bands were measured by Quantity One software (version 4.2.3; Bio-Rad).

Intracellular staining for phospho-GSK-3beta

Phospho-GSK-3beta (Ser9) levels in activated T cells were also measured by intracellular staining. Briefly, splenocytes harvested at different time points after SEA activation, with or without adjuvant treatment, were stained with anti-CD4-allophycocyanin and anti-Vbeta3-FITC mAb for 1 h at room temperature as described earlier. The cells were washed then fixed with 1% paraformaldehyde for 15 min at 37°C and permeabilized with ice-cold pure methanol overnight. The fixed cells were stained with anti-phospho-GSK-3beta (Ser9) polyclonal Ab for 1 h followed by anti-rabbit IgG conjugated with PE (Jackson ImmunoResearch Laboratories). After washing twice, the levels of phospho-GSK-3beta in Vbeta3 CD4+ cells were measured via flow cytometry. Rabbit {gamma} globulin (Jackson ImmunoResearch Laboratories) was used to normalize for nonspecific binding.

Statistical analysis

SPSS statistical software package for Windows (version 13.0) was used to run ANOVA, two-tailed unequal variance t test, and Student’s t test on the data presented. A value of p < 0.05 was considered significant. MS Excel 2003 was used for calculating SDs and SEMs.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
ATCD can be prevented by GSK-3beta inhibitors in ex vivo cultures

Survival effects of GSK-3beta inhibition were tested on SAg-stimulated T cells by injecting B10.BR mice with SEA and cultured ex vivo for 20 h in increasing concentrations of the GSK-3beta inhibitors, lithium chloride (0–25 mM), or kenpaullone (0–40 µM). Although lithium and kenpaullone each act as inhibitors of distinct spectra of kinases, the only kinase targeted by both is GSK-3beta (29). Flow cytometric analysis showed increases in survival of Vbeta3+CD4+ and Vbeta3+CD8+ T cells an average of 2.75- and 2.8-fold, respectively, with 12.5 mM lithium chloride (Fig. 1). Concentration of LiCl above 12.5 µM reduced the viability of cells, indicating nonspecific actions of the inhibitor. Similar results were observed with kenpaullone, a small molecule inhibitor of GSK-3beta. Five to 10 µM kenpaullone increased survival of activated T cells by 2.5- and 2.75-fold in activated CD4+ and CD8+ T cells. respectively. These results indicate that inhibition of GSK-3beta can prevent ATCD in ex vivo culture.


Figure 1
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 1. Activated T cell death is decreased by GSK-3beta inhibitors. Splenocytes were harvested from B10.BR mice 40 h after i.v. injection with SEA and cultured for 20 h with lithium chloride (0–25 mM; top panels) or kenpaullone (0–40 µM; bottom panels). Viability of Vbeta3+CD4+ T cells was increased by 2.75 with 12.5 mM lithium chloride and by 2.5-fold with 5–10 µM of kenpaullone. Those of Vbeta3+CD8+ T cells were increased by 2.8- and 2.75-fold with lithium chloride and kenpaullone, respectively. The error bars show the SEM from triplicate cultures (*, p < 0.05). Results are from one of three independent experiments.

 
Activated T cell survival upon GSK-3beta inhibition occurs to physiologically relevant levels

Under normal physiological conditions, natural adjuvants like LPS increase the survival of activated T cells (9, 21). To determine whether GSK-3beta inhibition could explain some or all of these adjuvant-associated survival effects, T cells activated in the presence or absence of LPS were cultured with the GSK-3{alpha}beta-specific inhibitor SB216763 (47). Splenocytes were harvested at the peak of clonal expansion from B10.BR mice treated with SEA alone or with LPS, which will be designated as "SEA" or "SEA+LPS" T cells hereafter. SEA or SEA+LPS T cells were incubated ex vivo for 20 h with increasing concentrations of SB216763. Following incubation, the viabilities of the Vbeta3+ T cells within each population were analyzed. The viability of SEA-treated T cells was increased by SB216763 in a dose-dependent manner to a maximum increase of ~2-fold in CD4+ T cells to 2.9-fold in CD8+ T cells at 20 µM inhibitor, which almost exactly replicated the survival effect of LPS treatment (Fig. 2). SB216763 had no significant effect on the SEA+LPS-treated CD4+ or CD8+ T cells (Fig. 2). These results strongly suggested that ATCD is caused by GSK-3beta activity and that LPS could influence survival from ATCD by inhibiting GSK-3beta.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 2. GSK-3beta inhibitor simulates adjuvant-like survival pattern in T cell survival. Splenocytes from B10.BR mice harvested 40 h after injection with SEA or SEA+LPS were cultured for 20 h with GSK-3beta inhibitor SB216763 (0–40 µM). Viability of SEA-stimulated cells ({square}) increased by 2-fold in Vbeta3+CD4+ cells (top panel) and by 2.9-fold in Vbeta3+CD8+ cells (bottom panel) to the levels seen in SEA+LPS-stimulated cells ({blacksquare}) at 20 µM SB216763. Bars at the far right show a further increase in viability with 50 ng/ml IL-2 in addition to 20 µM SB216763. Error bars show SEM from triplicate cultures (*, p < 0.05). Survival effects of SB216763 on SEA+LPS cells were not statistically significant. These results are representative of those from three independent experiments.

 
To determine whether IL-2 was influencing this survival, 50 ng/ml IL-2 was added to replicate cultures of SEA or SEA+LPS T cells. IL-2 increased the viability of both populations of activated CD4+ and CD8+ T cells and further increased the survival activity of 20 µM SB216763 (Fig. 2). This pattern suggested that IL-2 survival effects were additive to, and therefore distinctive from, the survival effects induced by inhibition of GSK-3beta.

GSK-3beta mediated death in peptide-stimulated T cells

To confirm that the prosurvival effects of GSK-3beta inhibition were not specific to SAg-stimulated T cells, peptide-stimulated T cells were also tested. DO11.10 T cells were adoptively transferred to non-Tg B10.D2 recipients and stimulated by injection of OvaP alone or with LPS (OvaP+LPS). After 72-h in vivo activation, splenocyte populations containing activated DO11.10 T cells were cultured in the presence or absence of 20 µM SB216763 and tested for viability (Fig. 3). As was seen in the SAg-activated model, inhibition of GSK-3beta with SB216763 increased the viability of DO11.10+CD4+ T cells that had been stimulated with OvaP alone. Also as before, pharmacological inhibition of GSK-3beta generated survival effects that matched those of LPS, whereas LPS-mediated survival was not further enhanced by GSK-3beta inhibition (Fig. 3). This result indicated that 1) GSK-3beta contributes to ATCD in peptide-stimulated T cells and 2) the LPS-associated survival effects may be explained by adjuvant-inducible inhibition of GSK-3beta.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 3. Inhbition of GSK-3beta rescues OvaP-activated T cells. T cells from DO11.10 Rag–/– mice were adoptively transferred into B10.D2 mice and activated with 50 µg of OvaP in presence or absence of 100 µg of LPS. Splenocytes harvested after 72 h of activation were cultured with or without 20 µM SB216763. Viability of OvaP-stimulated DO11.10+ CD4+ T cells ({square}) were increased to the levels of OvaP+LPS ({blacksquare}). Error bars show SEM from triplicate cultures.

 
GSK-3beta inhibition promotes activated T cell survival in vivo

SB216763 was tested for its ability to rescue T cells from clonal contraction in vivo. B10.BR mice were injected with SEA to activate Vbeta3+ T cells and then treated with either SB216763 (a total of four doses of 25 µg/g body weight/injection) or vehicle control as described in Materials and Methods. Splenocytes were harvested and recovery of Vbeta3+CD4+ and Vbeta3+CD8+ T cells was analyzed after 2 or 7 days. After 2 days, 2.5- to 3-fold increases in Vbeta3-expressing T cells were observed in SEA-treated animals, which was unchanged in animals also given SB216763. This result indicated that early activation was the same with or without GSK-3beta inhibition. However, after 7 days, although there was a significant drop in number of Vbeta3-expressing cells in animals from both treatment groups, an average of 2.2-fold more Vbeta3-expressing CD4+ T cells and 1.6-fold more CD8+ T cells were present in SB216763-treated animals (Fig. 4). This experiment confirmed a role for GSK-3beta in mediating ATCD in vivo but could not determine whether GSK-3beta inhibition in T cells or in other cell types was responsible for protection from ATCD.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 4. In vivo inhibition of GSK-3beta rescues Ag-activated T cells. B10.BR mice activated with SEA were injected with SB216763 i.p. as described in Materials and Methods. Day 2 results (left panels) shows 2.5- and 3-fold increases in Vbeta3-TCR bearing CD4+ and CD8+ T cells, respectively, and was not affected with SB216763 treatment. Percentage recovery of Vbeta3+CD4+ and Vbeta3+CD8+ T cells 7 days (right panels) after SEA injection yielded 2.2- and 1.6-fold more activated T cells, respectively, from mice that had received SEA+SB216763 in comparison to those with SEA alone (*, p > 0.1 and **, p < 0.05). Error bars show SEM from five animals per treatment group.

 
Expression of dominant-negative GSK3 promotes activated T cell survival in vivo

Direct effects of GSK-3beta inhibition in T cells was tested by retroviral gene transfer of a dominant-negative form of GSK-3beta in DO11.10 T cells. Peptide-stimulated CD4+ T cells from DO11.10 TCR Tg mice were infected with a mouse retrovirus expressing Thy1.1 (MiT-vector control), or MiT encoding dominant-negative GSK-3beta (MiT-GSK3DN), or Bcl-2 (MiT-Bcl2) as positive control and then transferred to B10.D2-syngeneic recipients. As shown in Fig. 5B, in vitro culture showed an increase in survival of the CD4+ T cells when transduced with MiT-GSK3DN and MiT-Bcl2, respectively, compared with parental MiT vector. Seven days after transfer, the number of infected T cells (Thy1.1+) persisting in the spleens was determined. Recovery of the transduced CD4+ T cells (Thy1.1+CD4+) was increased by an average of 4.3-fold with MiT-GSK3DN compared with parental MiT vector. Recovery of CD4+ T cells expressing control MiT-Bcl2 was 2-fold more than the cells expressing MiT (Fig. 5C). These results indicate that GSK-3beta activity within the T cells promotes ATCD in vivo.

Inhibition of GSK-3beta activity by SB216763 is confirmed by expression of its substrates

We next tested downstream targets of GSK-3beta’s kinase activity to determine which of several candidates might be affected in activated T cells. GSK-3beta activity is usually associated with increased degradation of phosphorylated substrates (48, 49). Therefore, increases in protein expression were expected to result from induced inhibition of GSK-3beta. For these experiments, OT-II TCR Tg mice were used (50). The OT-II TCR, like the DO.11.10-TCR, is activated by OvaP, but adjuvant effects are more readily observed in OT-II Tg mice (P.J., unpublished observation) and relatively pure populations of activated CD4+ T cells can be prepared by negative selection methods (~95% CD4+ T cells that have been untouched by potentially cross-linking Abs).

OT-II Tg mice were injected (i.v.) with 100 µg of OvaP in the absence of LPS and after 72 h, CD4+ T cells were isolated from harvested lymph nodes and spleens. The cells were incubated for 6 h with or without 20 µM SB216763 and then used to prepare cDNA from total cellular RNA. The cDNAs were probed with primers for Mcl-1, beta-catenin, and IL-2. beta-Actin was used as control. Expression of other known prosurvival factors like Bcl-2 and Bcl-XL were also tested. qPCR results showed only 2-fold increases in transcription of beta-catenin, mcl-1 and il-2 (Fig. 6A) with SB216763 (ex vivo) or LPS (in vivo) when compared with OvaP only. These values were not statistically significant and were orders of magnitude lower than transcripts levels from CD4+ T cells after activation with PMA/ionomycin (Fig. 6C). The transcript messages of bcl-2 and bcl-x also remained unchanged with SB216763 or LPS treatment (Fig. 6A). As expected, these data indicate that GSK-3beta inhibition does not regulate these factors at the level of transcription.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 6. GSK-3beta inhibition has little effect on transcription of selected genes. qPCR was performed to test the transcript levels of GSK-3beta targets beta-catenin, mcl1, and il-2 in either naive or activated CD4+ T cells as described in Materials and Methods. Transcript levels of bcl2 and bcl-XL were also tested in the same experiment. The changes in transcript levels of the respective genes upon in vitro GSK-3beta inhibition with SB216763 (A) or OvaP+LPS treatment in vivo (B) were not found to be statistically significant when compared with OvaP-only cells. C, Transcript levels of the same genes in CD4+ T cells showed significant increases 6 h after activation with PMA/ionomycin (bottom panel) (*, p < 0.01).

 
In contrast, immunoblot analysis of beta-catenin and Mcl-1 protein showed 6.5-fold and 1.7-fold increases, respectively, after SB216763 treatment. There were no changes in expression of Bcl-2 and Bcl-XL protein levels (Fig. 7, A and B). We consistently saw these patterns of protein expression after SB216763-mediated inhibition of GSK-3beta in peptide-stimulated T cells. Increased protein levels but not transcription of beta-catenin and Mcl-1, upon GSK-3beta inhibition with SB216763, was consistent with the protection of these proteins from GSK-3beta-triggered degradation (51, 52).


Figure 7
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 7. Protein levels of molecular targets confirms inhibition of GSK-3beta. Protein levels of GSK-3beta targets after SB216763 (ex vivo) or LPS (in vivo) treatment of CD4+ T cell were measured by immunoblot as described in Materials and Methods. beta-Actin was used as loading control. A, Immunoblot of GSK-3beta targets in OvaP activated T cells after ex vivo SB216763 treatment. Top panel shows Mcl-1 protein levels in OvaP-activated CD4+ T cells with or without 6-h incubation with SB216763. The lower panel shows the immunoblot results of beta-catenin, Bcl-2, and Bcl-XL from similarly treated cells. Results are from one of two (beta-catenin) or three (other targets) experiments. B, Graphical representation of immunoblot results from SB216763-treated T cells. Densitometric analysis of the Western blot results were plotted in a bar graph that showed 6.5-fold more beta-catenin and 1.7-fold more Mcl-1 upon SB216763 treatment after normalization to beta-actin levels. Western blots for Bcl-2 and Bcl-XL did not show any changes in protein expression with SB216763 treatment. Densitometric values of respective proteins in OvaP-only T cells were considered as the cutoff mark. Error bars represent SD between densitometric values obtained in each repetition. C, Immunoblot of GSK-3beta targets in OvaP-activated T cells after LPS stimulation. Top panel shows beta-catenin protein levels in naive and clonally expanded CD4+ T cells activated in vivo with OvaP or OvaP+LPS. The lower panel shows the immunoblot results of Mcl-1, Bcl-2, and Bcl-XL of similarly treated cells. Results are from 1 of ≥3 experiments. D, Graphical representation of immunoblot results from OvaP±LPS-activated T cells. After normalization to beta-actin levels, densitometric analysis of the Western blot results showed 5-fold more beta-catenin and 1.5-fold more Mcl-1 in OvaP+LPS cells when compared with OvaP-only cells. Bcl-2 and Bcl-XL did not show any remarkable changes in their protein expression pattern upon adjuvant treatment. Error bars represent SD between densitometric values obtained in each repetition.

 
These results confirm that GSK-3beta is inhibited upon SB216763 treatment and also indicate that prosurvival factors like IL-2, Bcl-2 and Bcl-XL are not likely to be playing a role in this survival pathway. Instead, increased beta-catenin and Mcl-1 were correlated with the survival effects of GSK-3beta inhibition.

Molecular targets confirm GSK-3beta inhibition in activated T cells after adjuvant stimulation

Similar measurements of GSK-3beta targets were made using T cells from OvaP+LPS-treated mice to determine whether the adjuvant effects of LPS were likely to be explained by natural inhibition of GSK-3beta. As was true of SB216763-mediated GSK-3beta inhibition, qPCR results for transcript levels of beta-catenin, mcl-1, il-2, bcl-2, and bcl-xl showed no statistically significant changes in CD4+ T cell populations from OvaP+LPS as compared with OvaP-treated mice (Fig. 6B). Protein levels of these targets were measured by immunoblot as described above, and densitometric analysis of the immunoblots indicated a 5-fold increase in beta-catenin signal after LPS stimulation when compared with OvaP-treated cells only (Fig. 7, C and D). Mcl-1 signal was increased by 1.5-fold, whereas there was no change in Bcl-2 and Bcl-x signals (Fig. 7, C and D). Comparison of Fig. 7, B and D, shows that LPS treatment in vivo gave strikingly similar patterns of protein expression as GSK-3beta pharmacological inhibition ex vivo.

Adjuvant treatment prolongs GSK-3beta phosphorylation in vivo

Maintenance of beta-catenin and Mcl-1 strongly indicated that LPS-induced survival effects were mediated by natural inhibition of GSK-3beta activity. To confirm this hypothesis, intracellular levels of the phosphorylation-inhibited form of GSK-3beta (phospho-GSK-3beta (Ser9)) were measured in Vbeta3+CD4+ T cells from B10.BR mice at different time points after activation with SEA and treatment with LPS. Fig. 8A shows that GSK-3beta was rapidly phosphorylated at Ser9 upon activation with SEA alone, but in the absence of adjuvants levels of phospho-GSK-3beta (Ser9) started decreasing around 20 h after activation to almost its starting level by 44 h. Addition of LPS after 16 h of activation did not increase the peak levels of phospho-GSK-3beta (Ser9), but maintained them for as long as 44 h, the time point at which the T cells show maximal adjuvant-induced survival effects. Hence, LPS adjuvant effects resulted in increased stability of a naturally inhibited form of GSK-3beta.


Figure 8
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 8. Inhibitory phosphorylation of GSK-3beta is maintained longer in activated T cells upon adjuvant stimulation. A, Flow cytometric measurement of phospho-GSK-3beta (Ser9). B10.BR mice were injected i.v. with 0.1 µg of SEA ({triangleup}), and 16 h later a subgroup of these animals received 10 µg of LPS ({square}). Spleens were harvested at 0, 4, 16, 20, 24, 40, and 44 h after SEA injection, and levels of phospho-GSK-3beta (Ser9) were measured in Vbeta3+CD4+ T cells by flow cytometry. Error bars represent SEM of three mice per treatment group. B, Immunoblot for phospho-GSK-3beta (Ser9). OT-II Tg mice were injected with 100 µg of OvaP or OvaP+LPS (100 µg), and 72 h later harvested splenocytes were enriched to ≥95% pure CD4+ T cells by negative selection and subjected to immunoblot analysis of phospho-GSK-3beta (Ser9) levels. Densitometric analysis of the Western blot results showed 10-fold more phospho-GSK-3beta (Ser9) (top panel) and 2-fold more total GSK-3beta (middle panel) in OvaP+LPS-stimulated T cells as compared with OvaP-only T cells. beta-Actin levels were used to control for loading of equal amounts of cell lysates.

 
Levels of phospho-GSK-3beta (Ser9) in OvaP-stimulated CD4+ T cells were also measured by immunoblot from OT-II mice injected with OvaP or OvaP+LPS (Fig. 8B). Densitometric analysis showed a 10-fold increase in phospho-GSK-3beta levels in OvaP+LPS-activated T cells and only a 2-fold change in total GSK, when compared with OvaP-activated T cells.

Together, these results indicate that at least one mechanism through which the natural adjuvant LPS promotes activated T cell survival is by maintaining the inactive form of GSK-3beta (phosphor-Ser9), thereby preventing GSK-3beta from inducing ATCD.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The observations in this study are remarkable because they show (1) that GSK-3beta activity is required for ATCD following Ag-stimulated proliferation and (2) the natural adjuvant LPS protected activated T cells from clonal death in a manner that was correlated with maintenance of a functionally inhibited form of GSK-3beta. Hence, GSK-3beta is a novel and regulatable effector of ATCD.

Clonally expanded T cells survived longer upon pharmacological inhibition of GSK-3beta, rescuing them from ATCD. T cells activated in the absence of adjuvants and then cultured briefly in the presence of lithium chloride, kenpaullone, or SB216763 survived better, strongly indicating that unmanipulated cells were dying as a result of GSK-3beta activity (Figs. 1–3). Furthermore, increased yield of activated T cells from mice injected with SB216763 confirmed that ATCD is promoted by GSK-3beta activity and can be reduced by pharmacological inhibition in vivo (Fig. 4). The fact that involvement of GSK-3beta in ATCD was intrinsic to activated T cells and not an effect of accessory cells was confirmed upon increased recovery of dominant-negative GSK-3beta expressing activated T cells (Fig. 5). We have also regularly observed increased survival of pure activated CD4+ T cells from OT-II Tg mice upon pharmacological inhibition of GSK-3beta (data not shown).

Not only can GSK-3beta inhibition improve activated T cell survival under experimental conditions, but it is likely to be an important part of physiological adjuvant-induced survival. Increased survival of Ag-activated T cells with increasing doses of SB216763 and convergence of that pattern with the survival of LPS-treated cells indicates that some or all of the LPS-induced survival may be attributable to GSK-3beta inhibition (Figs. 2 and 3). Intracellular levels of phospho-GSK-3beta (Ser9) show that indeed LPS protects GSK-3beta inhibition in clonally activated CD4 T cells. Conversely, T cells activated under adjuvant-free conditions do not retain phosphorylation at the Ser9 residue (Fig. 8).

GSK-3beta activity has been previously reported to regulate IL-2 production and control proliferation during early T cell activation (40). However, our observations were made during late clonal expansion, and failed to show a correlation with the transcription or biological function of IL-2 because IL-2-responsive factors such as Bcl-2 were not affected by GSK-3beta inhibition. Although addition of IL-2 could increase the survival of activated T cells after SB216763 treatment, it appeared that IL-2 activity imparted only additive survival effects (Fig. 2). There were only modest (nonsignificant) changes in IL-2 transcript levels with either SB216763-mediated inhibition of GSK-3beta or LPS treatment. Moreover, Bcl-2 and Bcl-XL transcript and protein levels were unchanged, indicating no evidence of T cell exposure to IL-2 or related cytokines (Figs. 6 and 7). These results corroborate previous reports in which neither Bcl-2 or Bcl-XL were associated with adjuvant-mediated inhibition of ATCD (7, 21, 43) and mixed-culture experiments that showed that soluble factors were not associated with the late survival effects of LPS adjuvant activity (data not shown).

Inhibition of GSK-3beta by phosphorylation has been shown to be caused by CD28 or OX-40-mediated costimulatory signals in in vitro-stimulated T cells (41, 53). Similarly, phosphorylation of GSK-3beta has been shown as a target of CpG-mediated costimulatory signals through MyD88 adaptor molecules in T cells (54). These reports essentially use GSK-3beta inhibition as the downstream marker of PI3K/pAkt pathway. Our work adds to these reports by showing that unrestrained GSK-3beta activity drives ATCD.

The strong increases in beta-catenin protein levels upon either SB216763-mediated or LPS-induced inhibition of GSK-3beta are also striking. beta-Catenin has been associated with cell cycle control and hemopoietic cell cycle renewal (55). Although it is not an obvious "end-point survival factor," recent reports suggest that it plays a role in thymocyte survival and T cell development (56, 57). Therefore, both Mcl-1 and beta-catenin warrant further investigation as mediators of adjuvant-mediated survival effects.

Maurer et al. (52) reported Mcl-1 to be a target of GSK-3beta when pharmacological inhibition of GSK-3beta lead to maintenance of Mcl-1. Mcl-1 is a Bcl-2 family protein that can act as a key molecule in apoptosis control, promoting cell survival, and acting as a critical factor for development and maintenance of B and T lymphocytes in mammals (58). In our experiments, Mcl-1 protein expression showed consistent but slight increase with either SB216763 treatment or LPS adjuvant effects (Fig. 7). It is nevertheless striking that Mcl-1 protein expression increased whereas Bcl-2 and Bcl-XL remained unchanged, which correlates with, but does not prove, a role for Mcl-1 in the GSK-3beta inhibition-mediated survival.

This study shows, for the first time, that GSK-3beta contributes to ATCD, and point to a mechanism through which adjuvants can increase the survival of activated T cells leading to effective immune responses. Pharmacological inhibitors of GSK-3beta are currently being developed, primarily for their potential to treat neurodegenerative diseases (29, 35). Our data show that these same agents are likely to be beneficial to a variety of immune responses from tumor immunotherapy to immunization.


   Acknowledgment
 
The retroviral vector pMiT-GSK3DN was constructed from a GSK3DN plasmid provided by Michal Hetman (University of Louisville, Louisville, KY).


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by U.S. Public Health Service Grants AI51377 and AI059023, the Commonwealth of Kentucky Research Challenge Trust Fund, the Kentucky Lung Cancer Research Program, and the Jewish Hospital Foundation. Back

2 Address correspondence and reprint requests to Dr. Thomas C. Mitchell, Institute for Cellular Therapeutics, University of Louisville, Donald Baxter Research Building, 570 South Preston Street, Room 404C, Louisville, KY 40202. E-mail address: tom.mitchell{at}louisville.edu Back

3 Abbreviations used in this paper: ACTD, activated T cell death; glycogen synthase kinase; Tg, transgenic; pAkt, phosphorylated-Akt; phospho-GSK, phosphorylated GSK; SAg, superantigen; SEA, staphylococcal enterotoxin A; qPCR, quantitative PCR; Fwd, forward; Rev, reverse; CT, cycle threshold. Back

Received for publication December 14, 2006. Accepted for publication March 1, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Sepulveda, H., A. Cerwenka, T. Morgan, R. W. Dutton. 1999. CD28, IL-2-independent costimulatory pathways for CD8 T lymphocyte activation. J. Immunol. 163: 1133-1142. [Abstract/Free Full Text]
  2. Kearney, E. R., T. L. Walunas, R. W. Karr, P. A. Morton, D. Y. Loh, J. A. Bluestone, M. K. Jenkins. 1995. Antigen-dependent clonal expansion of a trace population of antigen-specific CD4+ T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4. J. Immunol. 155: 1032-1036. [Abstract]
  3. Kondrack, R. M., J. Harbertson, J. T. Tan, M. E. McBreen, C. D. Surh, L. M. Bradley. 2003. Interleukin 7 regulates the survival and generation of memory CD4 cells. J. Exp. Med. 198: 1797-1806. [Abstract/Free Full Text]
  4. Linton, P. J., B. Bautista, E. Biederman, E. S. Bradley, J. Harbertson, R. M. Kondrack, R. C. Padrick, L. M. Bradley. 2003. Costimulation via OX40L expressed by B cells is sufficient to determine the extent of primary CD4 cell expansion and Th2 cytokine secretion in vivo. J. Exp. Med. 197: 875-883. [Abstract/Free Full Text]
  5. Akbar, A. N., M. Salmon. 1997. Cellular environments and apoptosis: tissue microenvironments control activated T-cell death. Immunol. Today 18: 72-76. [Medline]
  6. Vella, A. T., S. Dow, T. A. Potter, J. Kappler, P. Marrack. 1998. Cytokine-induced survival of activated T cells in vitro and in vivo. Proc. Natl. Acad. Sci. USA 95: 3810-3815. [Abstract/Free Full Text]
  7. Hildeman, D. A., Y. Zhu, T. C. Mitchell, J. Kappler, P. Marrack. 2002. Molecular mechanisms of activated T cell death in vivo. Curr. Opin. Immunol. 14: 354-359. [Medline]
  8. Hildeman, D. A., Y. Zhu, T. C. Mitchell, P. Bouillet, A. Strasser, J. Kappler, P. Marrack. 2002. Activated T cell death in vivo mediated by proapoptotic Bcl-2 family member Bim. Immunity 16: 759-767. [Medline]
  9. Vella, A. T., J. E. McCormack, P. S. Linsley, J. W. Kappler, P. Marrack. 1995. Lipopolysaccharide interferes with the induction of peripheral T cell death. Immunity 2: 261-270. [Medline]
  10. Sengupta, S., P. M. Chilton, T. C. Mitchell. 2005. Adjuvant-induced survival signaling in clonally expanded T cells is associated with transient increases in pAkt levels and sustained uptake of glucose. Immunobiology 210: 647-659. [Medline]
  11. Li-Weber, M., P. H. Krammer. 2003. Function and regulation of the CD95 (APO-1/Fas) ligand in the immune system. Semin. Immunol. 15: 145-157. [Medline]
  12. Kishimoto, H., J. Sprent. 1999. Strong TCR ligation without costimulation causes rapid onset of Fas-dependent apoptosis of naive murine CD4+ T cells. J. Immunol. 163: 1817-1826. [Abstract/Free Full Text]
  13. Tucek-Szabo, C. L., S. Andjelic, E. Lacy, K. B. Elkon, J. Nikolic-Zugic. 1996. Surface T cell Fas receptor/CD95 regulation, in vivo activation, and apoptosis: activation-induced death can occur without Fas receptor. J. Immunol. 156: 192-200. [Abstract]
  14. Marrack, P., J. Kappler. 2004. Control of T cell viability. Annu. Rev. Immunol. 22: 765-787. [Medline]
  15. Lohman, B. L., E. S. Razvi, R. M. Welsh. 1996. T-lymphocyte downregulation after acute viral infection is not dependent on CD95 (Fas) receptor-ligand interactions. J. Virol. 70: 8199-8203. [Abstract]
  16. Pellegrini, M., G. Belz, P. Bouillet, A. Strasser. 2003. Shutdown of an acute T cell immune response to viral infection is mediated by the proapoptotic Bcl-2 homology 3-only protein Bim. Proc. Natl. Acad. Sci. USA 100: 14175-14180. [Abstract/Free Full Text]
  17. Van Houten, N., R. C. Budd. 1992. Accelerated programmed cell death of MRL-lpr/lpr T lymphocytes. J. Immunol. 149: 2513-2517. [Abstract]
  18. Vella, A. T., T. Mitchell, B. Groth, P. S. Linsley, J. M. Green, C. B. Thompson, J. W. Kappler, P. Marrack. 1997. CD28 engagement and proinflammatory cytokines contribute to T cell expansion and long-term survival in vivo. J. Immunol. 158: 4714-4720. [Abstract]
  19. Medzhitov, R., C. Janeway, Jr. 2000. The Toll receptor family and microbial recognition. Trends Microbiol. 8: 452-456. [Medline]
  20. Mitchell, T. C., D. Hildeman, R. M. Kedl, T. K. Teague, B. C. Schaefer, J. White, Y. Zhu, J. Kappler, P. Marrack. 2001. Immunological adjuvants promote activated T cell survival via induction of Bcl-3. Nat. Immunol. 2: 397-402. [Medline]
  21. Mitchell, T. C., T. K. Teague, D. A. Hildeman, J. Bender, W. A. Rees, R. M. Kedl, B. Swanson, J. W. Kappler, P. Marrack. 2002. Stronger correlation of bcl-3 than bcl-2, bcl-xL, costimulation, or antioxidants with adjuvant-induced T cell survival. Ann. NY Acad. Sci. 975: 114-131. [Medline]
  22. Okkenhaug, K., A. Bilancio, J. L. Emery, B. Vanhaesebroeck. 2004. Phosphoinositide 3-kinase in T cell activation and survival. Biochem. Soc. Trans. 32: 332-335. [Medline]
  23. Hetman, M., J. E. Cavanaugh, D. Kimelman, Z. Xia. 2000. Role of glycogen synthase kinase-3beta in neuronal apoptosis induced by trophic withdrawal. J. Neurosci. 20: 2567-2574. [Abstract/Free Full Text]
  24. Elyaman, W., F. Terro, N. S. Wong, J. Hugon. 2002. In vivo activation and nuclear translocation of phosphorylated glycogen synthase kinase-3beta in neuronal apoptosis: links to {tau} phosphorylation. Eur J. Neurosci. 15: 651-660. [Medline]
  25. Sutherland, C., I. A. Leighton, P. Cohen. 1993. Inactivation of glycogen synthase kinase-3beta by phosphorylation: new kinase connections in insulin and growth-factor signalling. Biochem. J. 296: (Pt. 1):15-19. [Medline]
  26. Cross, D. A., D. R. Alessi, P. Cohen, M. Andjelkovich, B. A. Hemmings. 1995. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378: 785-789. [Medline]
  27. Embi, N., D. B. Rylatt, P. Cohen. 1980. Glycogen synthase kinase-3 from rabbit skeletal muscle: separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J. Biochem. 107: 519-527. [Medline]
  28. Manoukian, A. S., J. R. Woodgett. 2002. Role of glycogen synthase kinase-3 in cancer: regulation by Wnts and other signaling pathways. Adv. Cancer Res. 84: 203-229. [Medline]
  29. Meijer, L., M. Flajolet, P. Greengard. 2004. Pharmacological inhibitors of glycogen synthase kinase 3. Trends Pharmacol. Sci. 25: 471-480. [Medline]
  30. Woodgett, J. R.. 1994. Regulation and functions of the glycogen synthase kinase-3 subfamily. Semin. Cancer Biol. 5: 269-275. [Medline]
  31. Bijur, G. N., R. S. Jope. 2000. Opposing actions of phosphatidylinositol 3-kinase and glycogen synthase kinase-3beta in the regulation of HSF-1 activity. J. Neurochem. 75: 2401-2408. [Medline]
  32. Neal, J. W., N. A. Clipstone. 2001. Glycogen synthase kinase-3 inhibits the DNA binding activity of NFATc. J. Biol. Chem. 276: 3666-3673. [Abstract/Free Full Text]
  33. Watcharasit, P., G. N. Bijur, L. Song, J. Zhu, X. Chen, R. S. Jope. 2003. Glycogen synthase kinase-3beta (GSK3beta) binds to and promotes the actions of p53. J. Biol. Chem. 278: 48872-48879. [Abstract/Free Full Text]
  34. Diehl, J. A., M. Cheng, M. F. Roussel, C. J. Sherr. 1998. Glycogen synthase kinase-3beta regulates cyclin D1 proteolysis and subcellular localization. Genes Dev. 12: 3499-3511. [Abstract/Free Full Text]
  35. Jope, R. S., G. V. Johnson. 2004. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem. Sci. 29: 95-102. [Medline]
  36. Steinbrecher, K. A., W. Wilson, III, P. C. Cogswell, A. S. Baldwin. 2005. Glycogen synthase kinase 3beta functions to specify gene-specific, NF-{kappa}B-dependent transcription. Mol. Cell. Biol. 25: 8444-8455. [Abstract/Free Full Text]
  37. Welsh, G. I., S. Miyamoto, N. T. Price, B. Safer, C. G. Proud. 1996. T-cell activation leads to rapid stimulation of translation initiation factor eIF2B and inactivation of glycogen synthase kinase-3. J. Biol. Chem. 271: 11410-11413. [Abstract/Free Full Text]
  38. Christian, S. L., P. V. Sims, M. R. Gold. 2002. The B cell antigen receptor regulates the transcriptional activator beta-catenin via protein kinase C-mediated inhibition of glycogen synthase kinase-3. J. Immunol. 169: 758-769. [Abstract/Free Full Text]
  39. Martin, M., K. Rehani, R. S. Jope, S. M. Michalek. 2005. Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat. Immunol. 6: 777-784. [Medline]
  40. Ohteki, T., M. Parsons, A. Zakarian, R. G. Jones, L. T. Nguyen, J. R. Woodgett, P. S. Ohashi. 2000. Negative regulation of T cell proliferation and interleukin 2 production by the serine threonine kinase GSK-3. J. Exp. Med. 192: 99-104. [Abstract/Free Full Text]
  41. Song, J., S. Salek-Ardakani, P. R. Rogers, M. Cheng, P. L. Van, M. Croft. 2004. The costimulation-regulated duration of PKB activation controls T cell longevity. Nat. Immunol. 5: 150-158. [Medline]
  42. McCormack, J. E., J. E. Callahan, J. Kappler, P. C. Marrack. 1993. Profound deletion of mature T cells in vivo by chronic exposure to exogenous superantigen. J. Immunol. 150: 3785-3792. [Abstract]
  43. Mitchell, T., J. Kappler, P. Marrack. 1999. Bystander virus infection prolongs activated T cell survival. J. Immunol. 162: 4527-4535. [Abstract/Free Full Text]
  44. Mitchell, T. C., B. S. Thompson, J. O. Trent, C. R. Casella. 2002. A short domain within Bcl-3 is responsible for its lymphocyte survival activity. Ann. NY Acad. Sci. 975: 132-147. [Medline]
  45. Pap, M., G. M. Cooper. 1998. Role of glycogen synthase kinase-3 in the phosphatidylinositol 3-kinase/Akt cell survival pathway. J. Biol. Chem. 273: 19929-19932. [Abstract/Free Full Text]
  46. Livak, K. J., T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–{Delta}{Delta}CT method. Methods 25: 402-408. [Medline]
  47. Coghlan, M. P., A. A. Culbert, D. A. Cross, S. L. Corcoran, J. W. Yates, N. J. Pearce, O. L. Rausch, G. J. Murphy, P. S. Carter, C. L. Roxbee, et al 2000. Selective small molecule inhibitors of glycogen synthase kinase-3 modulate glycogen metabolism and gene transcription. Chem. Biol. 7: 793-803. [Medline]
  48. Frame, S., P. Cohen, R. M. Biondi. 2001. A common phosphate binding site explains the unique substrate specificity of GSK3 and its inactivation by phosphorylation. Mol. Cell. 7: 1321-1327. [Medline]
  49. Dajani, R., E. Fraser, S. M. Roe, N. Young, V. Good, T. C. Dale, L. H. Pearl. 2001. Crystal structure of glycogen synthase kinase 3beta: structural basis for phosphate-primed substrate specificity and autoinhibition. Cell 105: 721-732. [Medline]
  50. Carbone, F. R., M. W. Moore, J. M. Sheil, M. J. Bevan. 1988. Induction of cytotoxic T lymphocytes by primary in vitro stimulation with peptides. J. Exp. Med. 167: 1767-1779. [Abstract/Free Full Text]
  51. Ikeda, S., S. Kishida, H. Yamamoto, H. Murai, S. Koyama, A. Kikuchi. 1998. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J. 17: 1371-1384. [Medline]
  52. Maurer, U., C. Charvet, A. S. Wagman, E. Dejardin, D. R. Green. 2006. Glycogen synthase kinase-3 regulates mitochondrial outer membrane permeabilization and apoptosis by destabilization of MCL-1. Mol. Cell 21: 749-760. [Medline]
  53. Appleman, L. J., A. A. Van Puijenbroek, K. M. Shu, L. M. Nadler, V. A. Boussiotis. 2002. CD28 costimulation mediates down-regulation of p27kip1 and cell cycle progression by activation of the PI3K/PKB signaling pathway in primary human T cells. J. Immunol. 168: 2729-2736. [Abstract/Free Full Text]
  54. Gelman, A. E., D. F. Larosa, J. Zhang, P. T. Walsh, Y. Choi, J. O. Sunyer, L. A. Turka. 2006. The adaptor molecule MyD88 activates PI-3 kinase signaling in CD4+ T cells and enables CpG oligodeoxynucleotide-mediated costimulation. Immunity 25: 783-793. [Medline]
  55. Staal, F. J., J. Meeldijk, P. Moerer, P. Jay, B. C. van de Weerdt, S. Vainio, G. P. Nolan, H. Clevers. 2001. Wnt signaling is required for thymocyte development and activates Tcf-1 mediated transcription. Eur. J. Immunol. 31: 285-293. [Medline]
  56. Ioannidis, V., F. Beermann, H. Clevers, W. Held. 2001. The beta-catenin–TCF-1 pathway ensures CD4+CD8+ thymocyte survival. Nat. Immunol. 2: 691-697. [Medline]
  57. Xu, Y., D. Banerjee, J. Huelsken, W. Birchmeier, J. M. Sen. 2003. Deletion of beta-catenin impairs T cell development. Nat. Immunol. 4: 1177-1182. [Medline]
  58. Opferman, J. T., A. Letai, C. Beard, M. D. Sorcinelli, C. C. Ong, S. J. Korsmeyer. 2003. Development and maintenance of B and T lymphocytes requires antiapoptotic MCL-1. Nature 426: 671-676. [Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
J. P. McAleer, D. J. Zammit, L. Lefrancois, R. J. Rossi, and A. T. Vella
The Lipopolysaccharide Adjuvant Effect on T Cells Relies on Nonoverlapping Contributions from the MyD88 Pathway and CD11c+ Cells
J. Immunol., November 15, 2007; 179(10): 6524 - 6535.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sengupta, S.
Right arrow Articles by Mitchell, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sengupta, S.
Right arrow Articles by Mitchell, T. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS