The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pietilä, T. E.
Right arrow Articles by Julkunen, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pietilä, T. E.
Right arrow Articles by Julkunen, I.
The Journal of Immunology, 2007, 178: 253-261.
Copyright © 2007 by The American Association of Immunologists, Inc.

Multiple NF-{kappa}B and IFN Regulatory Factor Family Transcription Factors Regulate CCL19 Gene Expression in Human Monocyte-Derived Dendritic Cells1

Taija E. Pietilä2,*, Ville Veckman*, Anne Lehtonen{dagger}, Rongtuan Lin{ddagger}, John Hiscott{ddagger} and Ilkka Julkunen*

* Department of Viral Diseases and Immunology, National Public Health Institute, Helsinki, Finland; {dagger} Molecular Cancer Biology Program, Institute of Biomedicine, Biomedicum Helsinki, Finland; and {ddagger} Lady Davis Institute for Medical Research, Department of Microbiology and Immunology, Department of Medicine, and Department of Oncology, McGill University, Montreal, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
CCL19 chemokine has a central role in dendritic cell (DC) biology regulating DC traffic and recruitment of naive T cells to the vicinity of activated DCs. In this study, we have analyzed the regulation of CCL19 gene expression in human monocyte-derived DCs. DCs infected with Salmonella enterica or Sendai virus produced CCL19 at late times of infection. The CCL19 promoter was identified as having two putative NF-{kappa}B binding sites and one IFN-stimulated response element (ISRE). Transcription factor binding experiments demonstrated that Salmonella or Sendai virus infection increased the binding of classical p50+p65 and alternative p52+RelB NF-{kappa}B proteins to both of the CCL19 promoter NF-{kappa}B elements. Interestingly, Salmonella or Sendai virus infection also increased the binding of multiple IFN regulatory factors (IRFs), STAT1, and STAT2, to the ISRE element. Enhanced binding of IRF1, IRF3, IRF7, and IRF9 to the CCL19 promoter ISRE site was detected in Salmonella or Sendai virus-infected cell extracts. The CCL19 promoter in a luciferase reporter construct was activated by the expression of NF-{kappa}B p50+p65 or p52+RelB dimers. IRF1, IRF3, and IRF7 proteins also activated CCL19 promoter in the presence of Sendai virus infection. CCL19 promoter constructs mutated at NF-{kappa}B and/or ISRE sites were only weakly activated. Ectopic expression of RIG-I ({Delta}RIG-I, CARDIF) or TLR3/4 (TRIF, MyD88, IKK{epsilon}, or TBK1) signaling pathway components induced CCL19 promoter activity, suggesting that these pathways are important in CCL19 gene expression. Our experiments reveal that expression of the CCL19 gene is regulated by a combined action of several members of the NF-{kappa}B, IRF, and STAT family transcription factors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Dendritic cells (DCs)3 are professional APCs that reside in peripheral tissues where they are on alert for emerging pathogens. DCs regulate the activation of both innate and adaptive immune responses, and their role during microbial infections is well recognized. Upon contact with a microbe, they undergo a maturation process that is associated with enhanced expression of Ag presenting and costimulatory molecules and the production of cytokines and chemokines. Eventually, DCs migrate to a local lymph nodes where Ag presentation to naive T cells takes place (1).

DC trafficking is tightly controlled by differential expression of chemokine ligands and chemokine receptors. Immature DCs express CCR6 and respond to its exclusive ligand CCL20 (2). However, maturation of DCs leads to down-regulation of CCR6 and thus loss of their responsiveness to CCL20. At the same time, mature DCs gain responsiveness to CCL19 via induced CCR7 expression (2, 3). DCs eventually migrate to T cell zones of local lymph nodes where T lymphocytes are also recruited by the effect of chemokines. CCL19, and the other ligand of CCR7, CCL21, are both expressed by stromal cells in the T cell zone of the lymph nodes (4). Mice deficient in CCL19 and CCL21 or CCR7 display defective DC traffic and impaired immune responses (5, 6, 7). Because DCs are also capable of producing both CCL19 and CCL20, it is evident that these chemokines have a unique role in DC biology.

Transcription of cytokine and chemokine genes requires the controlled action of multiple transcription factors activated by microbes or their structural components. Activated transcription factors bind to the regulatory elements of cytokine/chemokine genes, and may either repress or activate the transcription of the respective gene. Mammalian NF-{kappa}B/Rel family has five members; NF-{kappa}B1 (p50), NF-{kappa}B2 (p52), RelA (p65), RelB, and c-Rel. NF-{kappa}B plays an important role in the regulation of innate immunity by activating a wide variety of immune response genes, such as proinflammatory cytokines and chemokines, and cell adhesion molecules (8, 9, 10). NF-{kappa}B proteins form various homo- or heterodimers that bind to specific NF-{kappa}B recognition sites located in the regulatory regions of many genes (10).

IFN regulatory factors (IRFs) constitute a family of nine (IRF1–9) transcription factors that bind to a specific DNA motif known as the IFN-stimulated response element (ISRE) (11). Among IRF family members, IRF1, IRF3, and IRF7 have been established as essential factors for chemokine gene expression in response to viral or cytokine stimulation (12, 13, 14, 15, 16). Recently, IRF5 has also been implicated in the regulation of cytokine and chemokine gene expression (17, 18). IRF9 (p48/ISGF3{gamma}) interacts with STAT1 and STAT2 and forms a complex called IFN-stimulated gene factor 3 (ISGF3) that is also able to bind to ISRE sequences (11, 19). ISGF3 or IRF9/STAT1 complexes have been previously associated with the regulation of chemokine gene expression (20, 21).

We have previously reported that CCL19 mRNA is induced in human monocyte-derived DCs in response to Streptococcus pyogenes (22), Salmonella enterica serovar typhimurium (23), and Sendai virus infections (24). Furthermore, recent findings by us and others have shown that DCs harbor Salmonella (23, 25, 26, 27) and that mature DCs containing Salmonella migrate toward chemokines CCL19 and CCL21 (27). At present, the mechanisms by which CCL19 expression is regulated have been only partially revealed. Saccani and Natoli (28) have previously shown that LPS-stimulated DCs up-regulate the expression of CCL19 by a methylation event occurring at lysine 9 of histone H3. Moreover, a phenomenon called NF-{kappa}B dimer exchange on CCL19 promoter has been described in LPS-stimulated DCs (29). Also, the murine CCL19 has been reported to contain a functional NF-{kappa}B binding site with an alternative consensus sequence that preferentially binds RelB/p52 dimers (30).

Because CCL19 is central in DC biology, we aimed to study its expression in human monocyte-derived DCs in detail. We have used Salmonella or Sendai virus, which are able to induce the expression of CCL19 in human DCs. We show that these microbes activate different members of the NF-{kappa}B, IRF, and STAT families in DCs, and they bind to the CCL19 promoter NF-{kappa}B and ISRE elements in a coordinated fashion. These results were further confirmed by studying the transcriptional activity of the CCL19 promoter in a luciferase reporter assay.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell culture

Leukocyte-rich buffy coats were obtained from healthy blood donors (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). PBMCs were isolated by a density gradient centrifugation using Ficoll-Paque (Amersham Biosciences) followed by isolation of monocytes by Percoll gradient centrifugation (Amersham Biosciences) as described previously (23, 31). Remaining T and B cells were depleted using anti-CD3 and anti-CD19 magnetic beads (Dynal Biotech). Monocytes (2.5 x 106 cells/well) were allowed to adhere to six-well plates (Falcon, BD Biosciences) for 1 h at 37°C in RPMI 1640 medium (Sigma-Aldrich) supplemented with antibiotics and glutamine without FCS. Nonadherent cells were removed by washing with PBS. To obtain immature DCs, monocytes were grown in RPMI 1640 medium (2 ml/well) supplemented with 10% FCS (Integro BV), recombinant human-IL-4 (20 ng/ml; R&D Systems), and GM-CSF (10 ng/ml; Biosite) for 6–7 days. Fresh medium was added every 2 days (1 ml/well).

HEK293 cells (American Type Culture Collection (ATCC) CLR1573) were maintained in Eagle-MEM (Sigma-Aldrich) with antibiotics and 10% FCS. One day before transfections, 75 000 cells/well were seeded on 24-well plates (Falcon) in Eagle-MEM with 2% FCS.

Infections

Salmonella enterica serovar typhimurium ATCC 14028 strain was grown as described previously (23). A multiplicity of infection (MOI) of 5 was used throughout the study. Sendai (Cantell strain) virus was grown as outlined by Ronni et al. (32). The hemagglutination titer of Sendai virus was 4098, and the infectivity of the stock in DCs was 6 x 109 PFU/ml (24). To ensure 100% infection in DCs, a MOI of 50 was used.

Cytokines and inhibitors

Highly purified human leukocyte IFN-{alpha} and IFN-{gamma} were provided by the Finnish Red Cross Blood Transfusion Service and used at 100 IU/ml. Recombinant human IL-1beta and TNF-{alpha} were purchased from R&D Systems and used at 10 ng/ml. PD98059 and SB202190 (Calbiochem) were used at 50 µM and 10 µM, respectively. Pyrrolidine dithiocarbamate (PDTC), diethyl maleate (DEM), and cyclosporin A (CsA) were obtained from Alexis Biochemicals. PDTC and DEM were used at 100 µM unless otherwise indicated, and CsA was used at 1 µg/ml.

Northern blot analysis

Total cellular RNA was isolated with RNeasy Midi kit (Qiagen). Equal amounts of RNA (10 µg) were size-fractionated on a 1.0% formaldehyde-agarose gel, transferred to a nylon membrane (Hybond; Amersham Biosciences), and hybridized with CCL19 and CCL20 (provided by Dr. A. Zlotnik, Neurocrine Biosciences, San Diego, CA) (33), IFN-{gamma} (34), and CXCL10 (21) probes. To control equal RNA loading, ribosomal RNA bands were stained with ethidium bromide, or membranes were hybridized with a beta-actin probe. The probes were labeled with [{alpha}-32P]dATP (3000 Ci/mmol; Amersham Biosciences) by a random-primed DNA labeling kit. Membranes were hybridized overnight in Ultrahyb buffer (Ambion) at 42°C. Membranes were washed three times with 1 x SSC/0.1% SDS at 42°C and once at 65°C, and then exposed to Kodak BioMax XAR films (Eastman Kodak) at –70°C with intensifying screens. The results were quantitated using Kodak Digital Science 1D image analysis software.

ELISA

CCL19 and CCL20 levels from cell culture supernatants were determined by a Duoset kit (R&D Systems). CXCL10 levels were measured using Ab pairs and standards obtained from BD Pharmingen, and IFN-{gamma} determinations were conducted with an Elipair kit (Nordic Biosite).

Plasmids

DNA fragment of 1478 bp encompassing the CCL19 promoter area was amplified from human macrophage chromosomal DNA using the following primers: sense, 5'-ACTCAGGGATCCTCACTTAATCCTAAG (BamHI-site underlined) and antisense, 5'-CGACTGAAGCTTAGGGGTGAAATGCAAGG (HindIII-site underlined) (all oligonucleotides used in the study were obtained from DNA Technology). The resulting PCR product was directly TA-cloned into the PCRII-vector (Invitrogen Life Technologies), from which it was released by BamHI and HindIII digestion. The fragment was cloned into BglII and HindIII restriction sites of the pGL3-basic (Promega) luciferase vector and named CCL19promWT thereafter. Site-specific mutations were introduced using the QuickChange II site-directed mutagenesis kit (Stratagene), and the correct mutations were confirmed by sequencing. The primers used for creating base mutations for relevant binding sites were as follows: NF-{kappa}B(1), 5'-CACAGAATGGGACATGAAGaaaAATTTaAGGCAGAGAAAGTGAAG; NF-{kappa}B(2), 5'-GAAGCACCAGTGAGGACAAaaaATAAAaaTAAGGAAGGGAGCAC; and ISREmut, 5'-CTGGGCGTTTCACATTTAaaaaCTCaaaCAAGGCC (mutated nucleotides are written in lower case).

Human p50 and p65 cDNAs have been described previously (14), and p52 in pCDNA3 and RelB cloned in frame with a FLAG epitope in pCDNA3 were provided by Dr. G. Natoli (Institute for Research in Biomedicine, Bellinzona, Switzerland). The human IRF1 gene was amplified with sense, 5'-CTGCAGGATCCCCAACATGCCCATCACTTGGATG and antisense, 5'-GCC CAGGATCCCTGCTACGCTGCACAGGGAATGG oligonucleotides and cloned into the BamHI site (underlined) of the expression plasmid pBC12/CMV (35). Human IRF5 cDNA was cloned from total cellular RNA isolated from human macrophages by PCR using sense, 5'-TCGGACGGATCCACCATGAACCAGTCCATCCCAGT and antisense, 5'- CCGTCTGGATCCCTATTATTGCATGCCAGCTGGGT oligonucleotides and inserted into the BamHI site (underlined) of the pCDNA3.1(+)-FLAG-tagged expression vector (36). Expression constructs for IRF3 (37), IRF7 (38), retinoic acid-inducible gene I (RIG-I) and {Delta}RIG-I (39), inducible I{kappa}B kinase (IKK{epsilon}), and Tank binding kinase 1 (TBK1) (40) have been described elsewhere. Toll/IL-1R homology domain containing adaptor protein-inducing IFN-beta (TRIF) and MyD88 expression plasmids were gifts from Dr. K. Fitzgerald (University of Massachusetts Medical School, Worcester, MA).

Transfections

HEK293 cells were seeded on 24-well plates 1 day before transfection, after which the reporter and NF-{kappa}B or IRF expression plasmids (100 ng/plasmid) were introduced into cells using FuGENE6 (Roche) transfection reagent. Renilla luciferase plasmid (10 ng/reaction; Promega) was used to control transfection efficiency. Cells were collected 18 h after transfection. In some experiments, the cells were infected with Sendai virus (MOI, 50) for 24 h. Luciferase reporter assays were performed with a Dual Glo kit (Promega) according to manufacturer’s instructions.

DNA affinity binding and Western blot analysis

Equal amounts of cells were collected, and nuclear extracts were prepared by lysing the cells in buffer containing 10 mM HEPES-KOH, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture (Complete; Roche). The remaining nuclei were lysed in 10 mM HEPES, 400 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture. Both strands of the DNA elements were synthesized with BamHI overhangs as spacers, and the upper strand oligonucleotide was 5'-biotinylated (DNA Technology): CCL19 NF-{kappa}B(1) (GGATCCGACATGAAGGGGAATTTCAGGCAGAGAAA), NF-{kappa}B(2) (GGATCCGAGGACAAGGGATAAACCTAAGGAAGGG), and CCL19 ISRE (GGATCCCACATTTAGTTTCTCTTTCAAGGCCTTCT). Protein samples were incubated for 2 h at 4°C with streptavidin-agarose beads (Pierce) coupled to annealed oligonucleotides. The binding reactions were performed in binding buffer containing 10 mM HEPES, 133 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture followed by washing the unbound proteins with binding buffer. The oligonucleotide-bound proteins were released in SDS sample buffer and separated on 8 or 10% SDS-PAGE gels. For direct Western blot analysis, cells were lysed in the presence of 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture, and 20 µg of protein aliquots were run on 10% SDS-PAGE gels.

Proteins were transferred onto Immobilon-P membranes (Millipore), and specific Abs were used to visualize the protein bands on HyperMax or Biomax film using the ECL system (Amersham Biosciences). The results were quantitated using Kodak Digital Science 1D image analysis software. Raising Abs in guinea pigs (anti-IRF1, anti-IRF7) and rabbits (anti-IRF3) has been described previously (15, 24, 41). Rabbit anti-phospho-S396-IRF3 was as described previously (42). Rabbit anti-IRF9 (sc-496), anti-STAT1 (sc-346), anti-STAT2 (sc-476), anti-p50 (sc-7178), anti-p65 (sc-372) anti-RelB (sc-226X), and anti-actin (sc-10731) were all obtained from Santa Cruz Biotechnology. Rabbit anti-p52 (06-413) was obtained from Upstate Biotechnology. Anti-IRF5 was prepared in rabbits by immunizing the animals four times at 4-wk intervals with preparative SDS-PAGE (Bio-Rad) purified Escherichia coli-expressed GST-IRF5 fusion protein (20 µg/immunization). The animals were bled 7 days after the last immunization. HRP-conjugated anti-guinea pig (P0141) and anti-rabbit (P0448) Igs obtained from DakoCytomation were used as secondary Abs.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Salmonella- and Sendai virus-induced expression of CCL19, CCL20, CXCL10, and IFN-{gamma} genes in DCs

Chemokine and IFN-{gamma} expression was first studied at the mRNA level by Northern blotting (Fig. 1A). DCs were left uninfected or infected with Salmonella or Sendai virus, and total cellular RNA was collected at different time points. Consistent with our previous findings (23), CCL19 expression was only seen at later time points starting from 9 h, whereas CCL20 expression peaked at 3 h and was down-regulated thereafter. CXCL10 mRNA expression was rapid and seen at 3-h infection after infection with Salmonella as well as with the Sendai virus. Although CXCL10 mRNA levels remained elevated almost 48 h after infection with Salmonella, Sendai virus-induced CXCL10 mRNA levels returned to undetectable levels within 24 h. IFN-{gamma} mRNA expression was slowly increased until the 48-h time point in Salmonella-infected cells, whereas its expression was only seen at 3 h in Sendai virus-infected cells.


Figure 1
View larger version (48K):
[in this window]
[in a new window]

 
FIGURE 1. Microbe-induced CCL19, CCL20, CXCL10, and IFN-{gamma} gene expression in human DCs. Monocyte-derived DCs from four individual blood donors were infected with Salmonella or Sendai virus for indicated times. A, The cells were pooled and total cellular RNA was isolated for Northern blotting. Ethidium bromide staining of ribosomal RNA and beta-actin probing were used to monitor equal RNA loading. B, CCL19, CCL20, CXCL10, and IFN-{gamma} protein production from cell culture supernatants (blood donors were analyzed separately) was determined by ELISA. Error bars represent SD of the means.

 
Next, CCL19, CCL20, CXCL10, and IFN-{gamma} protein levels from cell culture supernatants were determined by ELISA (Fig. 1B). The results are well in line with the mRNA expression data. In monocyte-derived DCs, Salmonella appeared to be a better inducer of all analyzed chemokine genes and IFN-{gamma} as compared with Sendai virus. Typically, some constitutive CCL19 production was detected in uninfected DCs.

Cell signaling pathway inhibitors reduce CCL19 production in DCs

To determine which intracellular signal transduction pathways are required for CCL19 production in DCs, we treated the cells with chemical inhibitors. PD98059 selectively blocks the activity of ERK MAPK and has no effect on the activation of p38 or JNK (43, 44), whereas SB202190 inhibits the action of p38 MAPK (45). PDTC and DEM are widely used as inhibitors of NF-{kappa}B activation (46, 47, 48), and CsA blocks the action of NFAT family of transcription factors (49). DCs were treated with these inhibitors 30 min before infection with Salmonella and total cellular RNA was collected at 9 h. As shown in Fig. 2A, Salmonella-induced CCL19 mRNA levels were down-regulated to some extent in response to all inhibitors tested. In contrast, CCL20 mRNA levels were clearly affected by DEM and CsA. To further investigate the differential effects of PDTC and DEM on CCL19 and CCL20 mRNA levels, we performed a similar experiment as described above, and included CXCL10 and IFN-{gamma} in the analysis to monitor the overall effects of the inhibitors (Fig. 2B). Consistent with the above results, CCL19 mRNA level was down-regulated dose dependently in response to PDTC and DEM also at 24 h. However, we detected nonspecific up-regulation of CCL20 mRNA in response to the highest PDTC concentration. CXCL10 and IFN-{gamma} mRNA levels were partially down-regulated as expected, demonstrating the importance of the NF-{kappa}B sites in both of these genes (12, 50).


Figure 2
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 2. The effect of intracellular signaling pathway inhibitors on CCL19, CCL20, CXCL10, and IFN-{gamma} gene expression in DCs. Cells were left untreated or treated with inhibitors 30 min before infection with Salmonella. A, PD98059, SB202190, PDTC/DEM, and CsA were used to block ERK MAPK, p38 MAPK, NF-{kappa}B, and NFAT pathways, respectively. The expression of CCL19 and CCL20 mRNAs was analyzed by Northern blotting. Total cellular RNA was pooled from four individual blood donors. beta-Actin probing was used to monitor equal RNA loading. A representative experiment of three is shown. B, DCs were treated with NF-{kappa}B inhibitors PDTC or DEM with indicated concentrations and infected with Salmonella. Inhibitors were added at the 10-h time point to ensure sufficient inhibitor concentration throughout the experiment. mRNA expression was studied as in A at 24 h after infection using also CXCL10 and IFN-{gamma} probes. The Northern blotting results were quantitated by measuring the band intensities and normalized by beta-actin levels. Relative mRNA levels as compared with Salmonella 9 h (A) or Salmonella 24 h (B) are shown below the corresponding probings.

 
The human CCL19 promoter

To characterize transcription factors that could be involved in regulating CCL19 gene expression, we analyzed the CCL19 promoter region using Vector NTI suite and MatInspector programs. The detailed sequence of the promoter region is presented in Fig. 3. We identified two putative NF-{kappa}B binding sites located between nt –62 to –52 and nt –363 to –354 (relative to the transcription start site) referred to as NF-{kappa}B(1) and NF-{kappa}B(2) hereafter. In addition, a potential consensus ISRE element was identified further upstream between nt –851 to –842. Other putative transcription factor binding sites displaying less significant similarity with the transcription factor consensus sequences were found by the programs, but we focused on the three sites described above, because it is expected that these elements would be of greatest importance in regulating microbe-induced CCL19 gene expression in DCs.


Figure 3
View larger version (51K):
[in this window]
[in a new window]

 
FIGURE 3. Nucleotide sequence of the 5'-flanking promoter region of the human CCL19 gene (essentially the same as the sequence derived from accession no. AL162231). A fragment of the CCL19 promoter encompassing nucleotide residues from –1437 to +41 relative to the +1 transcription start site was cloned to a luciferase reporter vector and confirmed by sequencing. The sequence was compiled from the sequenced clone and the data in accession no. AL162231. The program Vector NTI Suite was used to analyze the sequence for putative transcription factor binding sites. Previously identified transcription and translation initiation sites are marked with arrows, and a putative TATA-box is underlined. Core sequences of the potential transcription factor binding sites are typed in bold face, and boxed sequences indicate oligonucleotides used for DNA affinity binding experiments.

 
Functionality of NF-{kappa}B and ISRE elements in DCs

To analyze the functionality of the putative CCL19 promoter NF-{kappa}B sites in DCs, we performed DNA affinity binding experiments. DCs were infected with Salmonella or Sendai virus followed by isolation of cells and preparation of nuclear extracts for promoter element binding experiments. Proteins binding to biotinylated oligonucleotides spanning the CCL19 promoter NF-{kappa}B(1) and NF-{kappa}B(2) elements were pulled down and identified by Western blotting using NF-{kappa}B-specific Abs. Both NF-{kappa}B(1) (Fig. 4A) and NF-{kappa}B(2) (Fig. 4B) elements bound the classical pathway NF-{kappa}B components, p50 and p65, with similar efficiency (upper two blots). The binding of p65 was clearly increased during infection with Salmonella or Sendai virus. Homodimers of p50 (and likely p52) are constitutively transported into the nucleus, where they may function as suppressors of gene expression (51, 52). Basal binding of p50 was seen in uninfected cells, but its binding was also increased simultaneously with p65 binding in response to Salmonella or Sendai virus infection. In addition, both NF-{kappa}B(1) and NF-{kappa}B(2) promoter elements were able to bind p52 and RelB (Fig. 4; lower two blots). c-Rel binding to NF-{kappa}B(1) and NF-{kappa}B(2) elements could not be detected, and no significant differences in binding of NF-{kappa}B components were seen at later time points (48 h; data not shown).


Figure 4
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 4. Salmonella and Sendai virus infection enhances NF-{kappa}B binding to CCL19 promoter DNA elements in DCs. Nuclear extracts were prepared from DCs infected with Salmonella or Sendai virus for indicated times. Proteins binding to CCL19 promoter NF-{kappa}B(1) (A) and NF-{kappa}B(2) (B) DNA elements were pulled down by DNA affinity binding assay, separated on 10% SDS-PAGE, and analyzed by Western blotting with anti-p65, anti-p50, anti-RelB, and anti-p52 Abs. The results were quantitated by determining the band intensities. Relative binding of NF-{kappa}B components, compared with 3 h control, is shown on the right panels. This experiment was performed three times with similar results.

 
We then studied the functionality of the putative ISRE binding site upstream of the NF-{kappa}B sites. First, we characterized by direct Western blotting whether the expression of IRF proteins was altered during Salmonella or Sendai virus infection in DCs. In Salmonella-infected cells the expression of IRF1, IRF7, IRF9, and STAT2 proteins was induced to a different degree, whereas IRF3, IRF5, and STAT1 protein levels remained virtually unchanged (Fig. 5A). Sendai virus also induced the expression of IRF1, IRF7, and IRF9, but to a lesser extent than Salmonella. In the case of IRF3, a slower migrating form of IRF3 (representing the phosphorylated form, see below) is detected at the 3-h time point. STAT1 protein expression was weakly reduced in Sendai virus-infected cells.


Figure 5
View larger version (51K):
[in this window]
[in a new window]

 
FIGURE 5. Multiple IRF and STAT transcription factors bind to the CCL19 promoter ISRE element in DCs. A, Expression of IRF and STAT proteins in microbe-infected DCs. Whole cell extracts were prepared from Salmonella or Sendai virus-infected DCs, separated on 10% SDS-PAGE, and analyzed by direct Western blotting with anti-IRF or anti-STAT-specific Abs. Actin staining shows equal protein loading. B, Nuclear extracts were prepared from DCs, and proteins binding to the CCL19 ISRE element were pulled down by DNA affinity binding assay. Bound proteins were separated on 10% SDS-PAGE (8% for detection of P-IRF3, IRF5, STAT1, and STAT2), and analyzed by Western blotting with specific Abs as indicated in the figure.

 
Next, we performed DNA affinity binding experiments using CCL19 ISRE element oligonucleotides. Interestingly, the ISRE element bound multiple IRFs, STAT1, and STAT2 (Fig. 5B). Induced IRF1 binding was detected in response to Salmonella at 9 and 24 h. Sendai virus, in contrast, increased IRF1 binding already at 3 h. It was of interest that the m.w. of microbe-induced ISRE-bound IRF1 was somewhat lower as compared with that found in uninfected cells. This difference could be due to degradation or differential phosphorylation of IRF1. Basal IRF3 binding to the promoter element was clearly detectable, but an activated form of IRF3 upon Sendai stimulus was detected using a specific anti-phospho-S396-IRF3. Also in case of IRF5, some basal binding of IRF5 to the promoter element was observed in untreated cells. However, no microbe-induced enhancement of IRF5 binding to ISRE oligonucleotide could be detected (Fig. 5B). Strong IRF7 and moderate IRF9 binding to the promoter element was observed in response to Salmonella. IRF7 binding to the promoter element was also induced in Sendai virus-infected cells, whereas no detectable increase in IRF9 binding could be seen. Finally, both Salmonella and Sendai virus increased the binding of STAT1 and STAT2 to the CCL19 ISRE element, although STAT2 binding was decreased rapidly after 3 h of Sendai virus infection.

Cytokine inducibility of CCL19 expression in DCs

As observed above, both bacterial and viral stimulation of DCs is able to turn on CCL19 gene expression. Because CCL19 promoter had functional ISRE and NF-{kappa}B sites, we studied whether cytokine stimulation is sufficient to induce CCL19 production. We stimulated DCs with STAT-activating cytokines IFN-{alpha} or IFN-{gamma}, or with NF-{kappa}B-activating IL-1beta or TNF-{alpha}. For comparison, we also infected the cells with Salmonella or Sendai virus with different MOIs. None of the cytokine treatments alone could induce significant production of CCL19 as measured by ELISA (Fig. 6). However, the production of CCL20 could be seen after IL-1beta stimulation but not by TNF-{alpha}. This is contradictory to the previous reports that indicate CCL20 as a gene up-regulated by TNF-{alpha} via a NF-{kappa}B-dependent mechanism (53, 54). However, when IFNs were combined with IL-1beta or TNF-{alpha}, elevated levels of CCL19 and CCL20 were detected in DC supernatants. In contrast, as compared with the cytokine treatments, Salmonella-infected DCs secreted higher levels of CCL19 and CCL20. In the case of CCL19, Salmonella MOI 100 was toxic for the cells and the production of CCL20 was no longer dose responsive. As compared with Salmonella, Sendai virus was a weaker inducer of chemokine production at all tested MOIs.


Figure 6
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 6. Cytokine-stimulated DCs are capable of producing CCL19 and CCL20. Monocyte-derived DCs were stimulated with purified IFN-{alpha} (100 IU/ml), IFN-{gamma} (100 IU/ml), TNF-{alpha} (10 ng/ml), or IL-1beta (10 ng/ml) alone, or in different combinations as shown in the figure. For comparison, DCs were also infected with Salmonella or Sendai virus at indicated MOIs. Cell culture supernatants were collected at 24 h and analyzed for CCL19 and CCL20 production by ELISA. The results are the means (±SD) of DCs from four blood donors analyzed separately.

 
Regulation of CCL19 transcription through NF-{kappa}B and ISRE sites

To better characterize the role of NF-{kappa}B and ISRE sites in CCL19 gene expression, we PCR-cloned the CCL19 promoter region encompassing nucleotide residues from –1437 to + 41 bp relative to the transcription start site (Fig. 3). The promoter fragment was cloned into pGL3basic luciferase reporter vector and was named as CCL19promWT. We also created NF-{kappa}B and ISRE site mutant forms of the promoter as shown in Fig. 7A. Because primary DCs are not suitable for conventional transfections, we transiently transfected HEK293 cells with CCL19promWT reporter and NF-{kappa}B expression plasmids and examined the ability of the promoter construct to drive the expression of the firefly luciferase gene.


Figure 7
View larger version (26K):
[in this window]
[in a new window]

 
FIGURE 7. NF-{kappa}B and IRF family members regulate CCL19 promoter activity. A, WT and mutated sequences of human CCL19 promoter region containing the NF-{kappa}B(1), NF-{kappa}B(2), and ISRE elements (mutations shown in lower case). B, HEK293 cells were transfected with pGL3-basic backbone vector, CCL19promWT, or different CCL19 promoter NF-{kappa}B mutant constructs with or without NF-{kappa}B expression plasmids as shown in the figure. The luciferase activities indicating transcriptional activity were measured in cell extracts collected at 18 h after transfection. C, HEK293 cells were transfected with pGL3-basic backbone vector, CCL19promWT, or an ISRE mutant construct alone, or in combination with IRF expression plasmids. After overnight transfection, the cells were infected with Sendai virus for 24 h, after which luciferase activities were measured. Luciferase levels were normalized with Renilla activities and then plotted as fold induction (test plasmid/pGL3basic) with pGL3basic activity normalized to value 1. Experiments were performed with four replicates and repeated three times with similar results. Representative experiments of three are shown. TF, Transcription factors; Sv, Sendai virus.

 
CCL19promWT transfected alone did not result in reporter gene expression in HEK293 cells. However, the expression of NF-{kappa}B components p50+p65 or p52+RelB led to strongly enhanced, 325- or 70-fold activation of the promoter construct, respectively (Fig. 7B). These results demonstrate that either p50+p65 or p52+RelB dimers can activate transcription of the CCL19 gene. Proximal NF-{kappa}B(1) mutant construct lost a significant proportion of its response to cotransfected p50+p65 or p52+RelB (~80%). However, mutation of NF-{kappa}B(2) site interfered with the promoter activity to a lesser extent; 54 or 30% of the activity was lost with NF-{kappa}B(2) mutant in the presence of overexpressed p50+p65 or p52+RelB, respectively. A promoter construct containing mutations in both NF-{kappa}B(1) and NF-{kappa}B(2) sites showed an inhibition of transcription comparable to that of the NF-{kappa}B(1) mutant. These results suggest that the proximal NF-{kappa}B(1) site is the major NF-{kappa}B-responsive element in the human CCL19 promoter.

Next, we studied the role of IRFs in the induction of CCL19 promoter activity. Because HEK293 cells transiently transfected with CCL19promWT and IRF1, IRF3, or IRF7 expression plasmids did not result in significant induction of promoter activity (Fig. 7C), we used Sendai virus as an activator of IRFs. Sendai virus has extensively been used in studies concerning the regulatory role of IRF1, IRF3, and IRF7 in cytokine gene expression (13, 14, 21). The activation of IRF5, however, has been shown to occur, e.g., by vesicular stomatitis virus or Newcastle disease virus, but not by Sendai virus (17). In the presence of Sendai virus infection, all IRFs were able to activate the CCL19promWT 14- to 20-fold, depending on the IRF protein. The greatest activation of the CCL19 promoter was seen in response to IRF3 expression. As expected, the expression of IRF5 during Sendai virus infection did not induce CCL19 promoter activity (data not shown). Moreover, IRF5 did not activate CCL19 promoter in response to vesicular stomatitis virus infection (data not shown). The role of ISRE site (located upstream of the two NF-{kappa}B sites) was examined by using the ISRE mutant CCL19 promoter construct (Fig. 7A). As a result, clear inhibition of IRF-associated CCL19 promoter activity was seen in Sendai virus-infected cells (Fig. 7C).

RIG-I and TLR pathway signaling components activate CCL19 promoter

Having identified the transcription factors involved in the regulation of CCL19 transcription, we determined which signaling molecules upstream of IRFs would induce CCL19 promoter activation. RIG-I has been shown to act as a cytoplasmic detector of dsRNA synthesized by viruses. RIG-I associates with another CARD-domain containing protein, CARDIF (CARD adaptor inducing IFN-beta, also known as IPS-1/MAVS/VISA), which is associated with mitochondria. RIG-I and CARDIF signal downstream to TBK1 and IKK{epsilon} that directly phosphorylate IRF3 and IRF7. In contrast, MyD88, a central TLR adaptor molecule, transmits a signal in a complex pathway leading to the activation of MAPKs and NF-{kappa}B. The MyD88-independent pathway triggered by TLRs is governed by TRIF. TLR3/4-activated TRIF is also able to activate TBK-1 and IKK{epsilon}, leading to enhanced expression of type I IFN genes (55).

The involvement of these signaling components in the activation of CCL19 promoter was examined using HEK293 cell transfection approach. Plasmids encoding RIG-I, or its constitutively active form {Delta}RIG-I, CARDIF, TRIF, MyD88, IKK{epsilon}, or TBK1 were introduced in the cells together with the CCL19 promoter, and the cells were left uninfected or infected with Sendai virus. The full-length RIG-I-dependent activation of CCL19 promoter required Sendai virus infection, whereas {Delta}RIG-I could activate the promoter independently of virus infection (Fig. 8). Interestingly, overexpression of TRIF also activated the promoter efficiently and independently of virus infection. Ectopic expression of CARDIF, MyD88, IKK{epsilon}, or TBK-1 directly stimulated CCL19 promoter activity, but the promoter-inducing activity was also clearly enhanced by Sendai virus infection (Fig. 8). As a whole, our experiments indicate that CCL19 promoter activity can be activated by both the RIG-I and the TLR pathways.


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 8. RIG-I and TLR pathways are involved in the activation of the CCL19 promoter transcription. HEK293 cells were transfected with pGL3basic or CCL19promWT alone or together with RIG-I, {Delta}RIG-I (constitutively active form), CARDIF, TRIF, MyD88, IKK{epsilon}, or TBK1 expression plasmids. After overnight transfection, the cells were infected with Sendai virus for 24 h, after which luciferase activities were measured. Luciferase levels were normalized with Renilla activities and then plotted as fold induction (test plasmid/pGL3basic) with pGL3basic activity normalized to value 1. The data shown are the means (±SD) of triplicate determinations. A representative experiment is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
DCs play an essential role in regulating the activation of both innate and adaptive immunity during microbial infections. DC maturation triggered by microbes is associated with the production of CCL19 and enhanced expression of its specific receptor, CCR7. CCL19 thus regulates the migration of mature DCs, and it is also involved in recruiting naive T cells to the vicinity of mature DCs in the T cell zones of local lymph nodes (1, 2, 3). Although CCL19 has many important functions in DC biology, the molecular mechanisms regulating its gene expression have remained largely uncharacterized. In this study, we conducted a detailed analysis on the mechanisms of Salmonella or Sendai virus-induced expression of CCL19 gene in human monocyte-derived DCs. In addition, we cloned the CCL19 promoter and characterized its functionality in transfection experiments. We observed that multiple intracellular signal transduction pathways are involved in the regulation of CCL19 gene expression.

To obtain an insight into which signaling pathways are important for CCL19 gene expression in DCs, we used chemical inhibitors that could interfere with the activation of NF-{kappa}B, MAPK, and NFAT pathways. Our results showed that the inhibition of the NF-{kappa}B pathway with PDTC or DEM efficiently blocked Salmonella-induced CCL19 expression. These inhibitors also reduced Salmonella-induced CXCL10 and IFN-{gamma} expression, because these genes are at least partially NF-{kappa}B-regulated genes (12, 50). CCL20 gene expression, instead, was partially inhibited by DEM, but high concentrations of PDTC led to up-regulation of the gene. We cannot fully explain this observation, but it may reflect the differential requirements of gene regulation in human DCs as compared with cell lines that have been used by other investigators studying CCL20 gene regulation (53, 54). PD98059, SB202190, and CsA, inhibitors of ERK MAPK, p38 MAPK, and NFAT pathways, respectively, partially blocked CCL19 production. Experiments with chemical inhibitors suggested that, in addition to NF-{kappa}B, which is likely to be one of the major CCL19 gene regulatory pathways, MAPK and NFAT pathways may also contribute to microbe-induced CCL19 mRNA expression in human DCs.

With computer analysis, we identified two NF-{kappa}B sites in the proximal part of the CCL19 promoter. To study the functionality of these sites we performed DNA affinity binding experiments. We found out that both NF-{kappa}B promoter elements were capable of binding NF-{kappa}B p50 and p65 proteins upon Salmonella or Sendai virus infection. Furthermore, the same elements also bound the alternative pathway NF-{kappa}B proteins, p52 and RelB. Our results are consistent with the chromatin immunoprecipitation analyses conducted by Saccani and Natoli (29) in LPS-stimulated DCs. They observed that the CCL19 promoter region, encompassing the NF-{kappa}B(1) element of the present study, rapidly binds p50+p65 containing dimers, but these factors are later replaced by more slowly activated p52/RelB dimers. Neither they nor we detected c-Rel binding to the CCL19 promoter NF-{kappa}B sites.

NF-{kappa}B(1) and NF-{kappa}B(2) promoter elements showed practically equal protein binding capacities in oligonucleotide binding experiments. However, by using mutated CCL19 promoter reporter constructs, we were able to determine the relative importance of the two sites for transcription efficiency. Transfection experiments in HEK293 cells suggested that the proximal NF-{kappa}B(1) site was more important in transcription, because the mutations in the NF-{kappa}B(1) site reduced transcription activity more than the ones in the NF-{kappa}B(2) site. Although the relative importance of CCL19 promoter NF-{kappa}B sites was different in regulating transcription, both sites clearly contributed to the transcription in a positive fashion.

We also identified an ISRE site located upstream of the two NF-{kappa}B sites. This ISRE site turned out to be very interesting because it was able to bind multiple IRF family members as well as STAT1 and STAT2. Before analyzing IRF or STAT binding to the putative CCL19 ISRE site, we studied whether the expression of IRF or STAT proteins was changed in response to Salmonella or Sendai virus infection. It was of interest that Salmonella efficiently induced the expression of IRF1, IRF7, IRF9, and STAT2. By using sensitive oligonucleotide binding assays, these factors as well as constitutively expressed IRF3 and STAT1 were found to bind to the CCL19 ISRE site at later times of infection. To our knowledge, induction of such broad-spectrum binding of IRF and STAT protein to cytokine/chemokine promoter IRF/ISRE sites has not previously been described for Salmonella or any other bacteria. Altogether, our results suggest that Salmonella is likely to activate a wide array of NF-{kappa}B, IRF, and STAT-responsive genes in human DCs. Sendai virus is a well-known activator of IRFs and other transcription factors involved in cytokine gene expression (13, 14, 21, 24, 37). However, in Sendai virus-infected cells, the expression of IFN-inducible IRF1, IRF7, IRF9, STAT1, and STAT2 remained clearly at a lower level as compared with Salmonella-infected DCs. This is likely due to the effect of Sendai virus C proteins that efficiently interfere with IFN signaling by targeting STAT proteins (56). Thus, the binding of Sendai virus-activated IRFs to the CCL19 promoter ISRE site remained at a relatively low level. The only exception was IRF3, which was rapidly and efficiently activated by Sendai virus and its binding was clearly stronger than the one seen in Salmonella-infected DC extracts.

Unlike ectopically expressed NF-{kappa}B dimers, which in the absence of their inhibitors (I{kappa}Bs) are constitutively in an active form, IRF3 and IRF7 require additional virus-induced phosphorylations before they are transcriptionally active (57). Therefore, in transfection experiments we had to use Sendai virus infection to induce IRF activation. Consistent with the DNA binding experiments, we found that in transfected HEK293 cells, IRF1, IRF3, or IRF7 induced CCL19 promoter activity, and this activity was dependent on the functional ISRE site located upstream of the two NF-{kappa}B sites. However, we found no evidence that IRF5, which has been described to regulate the expression of many cytokine genes (17, 18), would be involved in CCL19 gene expression in human monocyte-derived DCs or in promoter reporter assays.

Further experimental analyses of the pathways upstream of IRFs revealed that the activation of both TLR and RIG-I pathways regulate CCL19 gene expression. Expression of the crucial receptor/adapter components of the TLR3/4 pathway (MyD88, TRIF, IKK{epsilon}, or TBK1) or the RIG-I pathway (RIG-I, {Delta}RIG-I, CARDIF, IKK{epsilon}, or TBK1) lead to efficient transcription of the CCL19 promoter reporter construct. The data indicate that the common pathways activated by Gram-negative bacteria (TLR4) or RNA viruses (TLR3 or RIG-I) led to the activation of multiple IRF family members, which together with NF-{kappa}B regulate CCL19 gene expression.

In this study we demonstrate that, in human monocyte-derived DCs, both bacteria and viruses can induce CCL19 gene expression. Efficient activation of CCL19 production correlates with the ability of a given microbe to induce DC maturation and cytokine gene expression in general. Detailed analysis of the intracellular signal transduction pathways indicated that the CCL19 promoter is regulated by multiple transcriptional systems, at least by NF-{kappa}B, IRFs, and STATs. We cannot rule out the possibility that MAPK cascades and NFAT transcription factors are also involved, because pharmacological inhibitors of these pathways also reduced CCL19 gene expression to some extent. It was also of interest that NF-{kappa}B- and STAT-activating cytokines, IL-1beta or TNF-{alpha} together with IFNs, were also able to induce CCL19 production in DCs albeit in low levels. The data suggest that signals, whether they are bacteria, viruses, or cytokines, which are able to activate NF-{kappa}B, IRF, and/or STAT family transcription factors in DCs can also activate the CCL19 promoter in a quantitatively, qualitatively, and timely regulated fashion.


    Acknowledgments
 
We thank Mari Aaltonen, Hanna Valtonen, and Johanna Lahtinen for expert technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Medical Research Council of the Academy of Finland and the Sigrid Juselius Foundation. Back

2 Address correspondence and reprint requests to Dr. Taija E. Pietilä, Department of Viral Diseases and Immunology, National Public Health Institute, Mannerheimintie 166, FI-00300 Helsinki, Finland. E-mail address: taija.pietila{at}ktl.fi Back

3 Abbreviations used in this paper: DC, dendritic cell; IRF, IFN regulatory factor; ISRE, IFN-stimulated response element; ISGF3, IFN-stimulated gene factor 3; MOI, multiplicity of infection; PDTC, pyrrolidine dithiocarbamate; DEM, diethyl maleate; CsA, cyclosporin A; IKK{epsilon}, inducible I{kappa}B kinase; TBK1, Tank binding kinase 1; TRIF, Toll/IL-1R homology domain containing adaptor protein-inducing IFN-beta. Back

Received for publication May 24, 2006. Accepted for publication October 9, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245-252. [Medline]
  2. Dieu, M. C., B. Vanbervliet, A. Vicari, J. M. Bridon, E. Oldham, S. Ait-Yahia, F. Briere, A. Zlotnik, S. Lebecque, C. Caux. 1998. Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J. Exp. Med. 188: 373-386. [Abstract/Free Full Text]
  3. Sallusto, F., B. Palermo, D. Lenig, M. Miettinen, S. Matikainen, I. Julkunen, R. Forster, R. Burgstahler, M. Lipp, A. Lanzavecchia. 1999. Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol. 29: 1617-1625. [Medline]
  4. Luther, S. A., H. L. Tang, P. L. Hyman, A. G. Farr, J. G. Cyster. 2000. Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion of the ELC gene in the plt/plt mouse. Proc. Natl. Acad. Sci. USA 97: 12694-12699. [Abstract/Free Full Text]
  5. Gunn, M. D., S. Kyuwa, C. Tam, T. Kakiuchi, A. Matsuzawa, L. T. Williams, H. Nakano. 1999. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med. 189: 451-460. [Abstract/Free Full Text]
  6. Nakano, H., M. D. Gunn. 2001. Gene duplications at the chemokine locus on mouse chromosome 4: multiple strain-specific haplotypes and the deletion of secondary lymphoid-organ chemokine and EBI-1 ligand chemokine genes in the plt mutation. J. Immunol. 166: 361-369. [Abstract/Free Full Text]
  7. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99: 23-33. [Medline]
  8. Chen, L. F., W. C. Greene. 2004. Shaping the nuclear action of NF-{kappa}B. Nat. Rev. Mol. Cell Biol. 5: 392-401. [Medline]
  9. Beinke, S., S. C. Ley. 2004. Functions of NF-{kappa}B1 and NF-{kappa}B2 in immune cell biology. Biochem. J. 382: 393-409. [Medline]
  10. Natoli, G., S. Saccani, D. Bosisio, I. Marazzi. 2005. Interactions of NF-{kappa}B with chromatin: the art of being at the right place at the right time. Nat. Immunol. 6: 439-445. [Medline]
  11. Taniguchi, T., K. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19: 623-655. [Medline]
  12. Ohmori, Y., T. A. Hamilton. 1993. Cooperative interaction between interferon (IFN) stimulus response element and {kappa}B sequence motifs controls IFN{gamma}- and lipopolysaccharide-stimulated transcription from the murine IP-10 promoter. J. Biol. Chem. 268: 6677-6688. [Abstract/Free Full Text]
  13. Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, J. Hiscott. 1999. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol. Cell. Biol. 19: 959-966. [Abstract/Free Full Text]
  14. Genin, P., M. Algarte, P. Roof, R. Lin, J. Hiscott. 2000. Regulation of RANTES chemokine gene expression requires cooperativity between NF-{kappa}B and IFN-regulatory factor transcription factors. J. Immunol. 164: 5352-5361. [Abstract/Free Full Text]
  15. Veckman, V., P. Osterlund, R. Fagerlund, K. Melen, S. Matikainen, I. Julkunen. 2006. TNF-{alpha} and IFN-{alpha} enhance influenza-A-virus-induced chemokine gene expression in human A549 lung epithelial cells. Virology 345: 96-104. [Medline]
  16. Liu, J., X. Guan, X. Ma. 2005. Interferon regulatory factor 1 is an essential and direct transcriptional activator for interferon {gamma}-induced RANTES/CCl5 expression in macrophages. J. Biol. Chem. 280: 24347-24355. [Abstract/Free Full Text]
  17. Barnes, B. J., M. J. Kellum, A. E. Field, P. M. Pitha. 2002. Multiple regulatory domains of IRF-5 control activation, cellular localization, and induction of chemokines that mediate recruitment of T lymphocytes. Mol. Cell. Biol. 22: 5721-5740. [Abstract/Free Full Text]
  18. Takaoka, A., H. Yanai, S. Kondo, G. Duncan, H. Negishi, T. Mizutani, S. Kano, K. Honda, Y. Ohba, T. W. Mak, T. Taniguchi. 2005. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature 434: 243-249. [Medline]
  19. Kanno, Y., B. Z. Levi, T. Tamura, K. Ozato. 2005. Immune cell-specific amplification of interferon signaling by the IRF-4/8-PU.1 Complex. J. Interferon Cytokine Res. 25: 770-779. [Medline]
  20. Majumder, S., L. Z. Zhou, P. Chaturvedi, G. Babcock, S. Aras, R. M. Ransohoff. 1998. p48/STAT-1{alpha}-containing complexes play a predominant role in induction of IFN-{gamma}-inducible protein, 10 kDa (IP-10) by IFN-{gamma} alone or in synergy with TNF-{alpha}. J. Immunol. 161: 4736-4744. [Abstract/Free Full Text]
  21. Matikainen, S., J. Pirhonen, M. Miettinen, A. Lehtonen, C. Govenius-Vintola, T. Sareneva, I. Julkunen. 2000. Influenza A and sendai viruses induce differential chemokine gene expression and transcription factor activation in human macrophages. Virology 276: 138-147. [Medline]
  22. Veckman, V., M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen, I. Julkunen. 2004. Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce maturation and production of Th1-type cytokines and chemokines in human monocyte-derived dendritic cells. J. Leukocyte Biol. 75: 764-771. [Abstract/Free Full Text]
  23. Pietila, T. E., V. Veckman, P. Kyllonen, K. Lahteenmaki, T. K. Korhonen, I. Julkunen. 2005. Activation, cytokine production, and intracellular survival of bacteria in Salmonella-infected human monocyte-derived macrophages and dendritic cells. J. Leukocyte Biol. 78: 909-920. [Abstract/Free Full Text]
  24. Osterlund, P., V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, I. Julkunen. 2005. Gene expression and antiviral activity of {alpha}beta interferons and interleukin-29 in virus-infected human myeloid dendritic cells. J. Virol. 79: 9608-9617. [Abstract/Free Full Text]
  25. Marriott, I., T. G. Hammond, E. K. Thomas, K. L. Bost. 1999. Salmonella efficiently enter and survive within cultured CD11c+ dendritic cells initiating cytokine expression. Eur. J. Immunol. 29: 1107-1115. [Medline]
  26. Niedergang, F., J. C. Sirard, C. T. Blanc, J. P. Kraehenbuhl. 2000. Entry and survival of Salmonella typhimurium in dendritic cells and presentation of recombinant antigens do not require macrophage-specific virulence factors. Proc. Natl. Acad. Sci. USA 97: 14650-14655. [Abstract/Free Full Text]
  27. Cheminay, C., M. Schoen, M. Hensel, A. Wandersee-Steinhauser, U. Ritter, H. Korner, M. Rollinghoff, J. Hein. 2002. Migration of Salmonella typhimurium: harboring bone marrow-derived dendritic cells towards the chemokines CCL19 and CCL21. Microb. Pathog. 32: 207-218. [Medline]
  28. Saccani, S., G. Natoli. 2002. Dynamic changes in histone H3 Lys 9 methylation occurring at tightly regulated inducible inflammatory genes. Genes Dev. 16: 2219-2224. [Abstract/Free Full Text]
  29. Saccani, S., S. Pantano, G. Natoli. 2003. Modulation of NF-{kappa}B activity by exchange of dimers. Mol. Cell 11: 1563-1574. [Medline]
  30. Bonizzi, G., M. Bebien, D. C. Otero, K. E. Johnson-Vroom, Y. Cao, D. Vu, A. G. Jegga, B. J. Aronow, G. Ghosh, R. C. Rickert, M. Karin. 2004. Activation of IKK{alpha} target genes depends on recognition of specific {kappa}B binding sites by RelB:p52 dimers. EMBO J. 23: 4202-4210. [Medline]
  31. Veckman, V., M. Miettinen, S. Matikainen, R. Lande, E. Giacomini, E. M. Coccia, I. Julkunen. 2003. Lactobacilli and streptococci induce inflammatory chemokine production in human macrophages that stimulates Th1 cell chemotaxis. J. Leukocyte Biol. 74: 395-402. [Abstract/Free Full Text]
  32. Ronni, T., T. Sareneva, J. Pirhonen, I. Julkunen. 1995. Activation of IFN-{alpha}, IFN-{gamma}, MxA, and IFN regulatory factor 1 genes in influenza A virus-infected human peripheral blood mononuclear cells. J. Immunol. 154: 2764-2774. [Abstract]
  33. Rossi, D. L., A. P. Vicari, K. Franz-Bacon, T. K. McClanahan, A. Zlotnik. 1997. Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3{alpha} and MIP-3beta. J. Immunol. 158: 1033-1036. [Abstract]
  34. Sareneva, T., J. Pirhonen, K. Cantell, N. Kalkkinen, I. Julkunen. 1994. Role of N-glycosylation in the synthesis, dimerization and secretion of human interferon-{gamma}. Biochem. J. 303: 831-840. (Pt. 3). [Medline]
  35. Melen, K., P. Keskinen, T. Ronni, T. Sareneva, K. Lounatmaa, I. Julkunen. 1996. Human MxB protein, an interferon-{alpha}-inducible GTPase, contains a nuclear targeting signal and is localized in the heterochromatin region beneath the nuclear envelope. J. Biol. Chem. 271: 23478-23486. [Abstract/Free Full Text]
  36. Melen, K., L. Kinnunen, I. Julkunen. 2001. Arginine/lysine-rich structural element is involved in interferon-induced nuclear import of STATs. J. Biol. Chem. 276: 16447-16455. [Abstract/Free Full Text]
  37. Lin, R., C. Heylbroeck, P. M. Pitha, J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18: 2986-2996. [Abstract/Free Full Text]
  38. Zhang, L., J. S. Pagano. 1997. IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency. Mol. Cell. Biol. 17: 5748-5757. [Abstract]
  39. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5: 730-737. [Medline]
  40. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, J. Hiscott. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300: 1148-1151. [Abstract/Free Full Text]
  41. Matikainen, S., T. Ronni, M. Hurme, R. Pine, I. Julkunen. 1996. Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells. Blood 88: 114-123. [Abstract/Free Full Text]
  42. Servant, M. J., N. Grandvaux, B. R. tenOever, D. Duguay, R. Lin, J. Hiscott. 2003. Identification of the minimal phosphoacceptor site required for in vivo activation of interferon regulatory factor 3 in response to virus and double-stranded RNA. J. Biol. Chem. 278: 9441-9447. [Abstract/Free Full Text]
  43. Cobb, M. H., E. J. Goldsmith. 1995. How MAP kinases are regulated. J. Biol. Chem. 270: 14843-14846. [Free Full Text]
  44. Dudley, D. T., L. Pang, S. J. Decker, A. J. Bridges, A. R. Saltiel. 1995. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc. Natl. Acad. Sci. USA 92: 7686-7689. [Abstract/Free Full Text]
  45. Davies, S. P., H. Reddy, M. Caivano, P. Cohen. 2000. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem. J. 351: 95-105. [Medline]
  46. Schreck, R., B. Meier, D. N. Mannel, W. Droge, P. A. Baeuerle. 1992. Dithiocarbamates as potent inhibitors of nuclear factor {kappa}B activation in intact cells. J. Exp. Med. 175: 1181-1194. [Abstract/Free Full Text]
  47. Ziegler-Heitbrock, H. W., T. Sternsdorf, J. Liese, B. Belohradsky, C. Weber, A. Wedel, R. Schreck, P. Bauerle, M. Strobel. 1993. Pyrrolidine dithiocarbamate inhibits NF-{kappa}B mobilization and TNF production in human monocytes. J. Immunol. 151: 6986-6993. [Abstract]
  48. Horton, N. D., S. S. Biswal, L. L. Corrigan, J. Bratta, J. P. Kehrer. 1999. Acrolein causes inhibitor {kappa}B-independent decreases in nuclear factor {kappa}B activation in human lung adenocarcinoma (A549) cells. J. Biol. Chem. 274: 9200-9206. [Abstract/Free Full Text]
  49. Rao, A., C. Luo, P. G. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15: 707-747. [Medline]
  50. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 272: 30412-30420. [Abstract/Free Full Text]
  51. Fagerlund, R., L. Kinnunen, M. Kohler, I. Julkunen, K. Melen. 2005. NF-{kappa}B is transported into the nucleus by importin {alpha}3 and importin {alpha}4. J. Biol. Chem. 280: 15942-15951. [Abstract/Free Full Text]
  52. Zhong, H., M. J. May, E. Jimi, S. Ghosh. 2002. The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/p300 or HDAC-1. Mol. Cell 9: 625-636. [Medline]
  53. Harant, H., S. A. Eldershaw, I. J. Lindley. 2001. Human macrophage inflammatory protein-3{alpha}/CCL20/LARC/Exodus/SCYA20 is transcriptionally upregulated by tumor necrosis factor-{alpha} via a non-standard NF-{kappa}B site. FEBS Lett. 509: 439-445. [Medline]
  54. Sugita, S., T. Kohno, K. Yamamoto, Y. Imaizumi, H. Nakajima, T. Ishimaru, T. Matsuyama. 2002. Induction of macrophage-inflammatory protein-3{alpha} gene expression by TNF-dependent NF-{kappa}B activation. J. Immunol. 168: 5621-5628. [Abstract/Free Full Text]
  55. Akira, S., S. Uematsu, O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783-801. [Medline]
  56. Gotoh, B., T. Komatsu, K. Takeuchi, J. Yokoo. 2002. Paramyxovirus strategies for evading the interferon response. Rev. Med. Virol. 12: 337-357. [Medline]
  57. tenOever, B. R., S. Sharma, W. Zou, Q. Sun, N. Grandvaux, I. Julkunen, H. Hemmi, M. Yamamoto, S. Akira, W. C. Yeh, R. Lin, J. Hiscott. 2004. Activation of TBK1 and IKKvar{epsilon} kinases by vesicular stomatitis virus infection and the role of viral ribonucleoprotein in the development of interferon antiviral immunity. J. Virol. 78: 10636-10649. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. T. Bates, S. Uematsu, S. Akira, and S. B. Mizel
Direct Stimulation of tlr5+/+ CD11c+ Cells Is Necessary for the Adjuvant Activity of Flagellin
J. Immunol., June 15, 2009; 182(12): 7539 - 7547.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. M. Makela, M. Strengell, T. E. Pietila, P. Osterlund, and I. Julkunen
Multiple signaling pathways contribute to synergistic TLR ligand-dependent cytokine gene expression in human monocyte-derived macrophages and dendritic cells
J. Leukoc. Biol., April 1, 2009; 85(4): 664 - 672.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. M. Anis, S. A. Fulton, S. M. Reba, Y. Liu, C. V. Harding, and W. H. Boom
Modulation of Pulmonary Dendritic Cell Function during Mycobacterial Infection
Infect. Immun., February 1, 2008; 76(2): 671 - 677.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. I. Osterlund, T. E. Pietila, V. Veckman, S. V. Kotenko, and I. Julkunen
IFN Regulatory Factor Family Members Differentially Regulate the Expression of Type III IFN (IFN-{lambda}) Genes
J. Immunol., September 15, 2007; 179(6): 3434 - 3442.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pietilä, T. E.
Right arrow Articles by Julkunen, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pietilä, T. E.
Right arrow Articles by Julkunen, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS