| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* School of Biochemistry and Immunology, Trinity College, Dublin, Ireland;
Northern Ireland Histocompatibility and Immunogenetics Laboratory, Belfast City Hospital, Belfast, Northern Ireland; and
Department of Structural Biology, Stanford University, Stanford, CA 94305
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
HLA class I genes are highly polymorphic, and most of the variability resides in the Ag-binding groove comprised of the 
1 and 2 domains of the H chain (6, 7). This variability affects the peptide that can bind and therefore influences recognition of Ag by the immune system (8). To cope with diversity inherent in HLA, NK cell receptors target relatively conserved epitopes within HLA. HLA-B alleles are characterized by having either a Bw4 or a Bw6 epitope at residues 77–84 of the 1 H chain (9). Although there is no known receptor for Bw6, approximately one-third of HLA-B alleles have the Bw4 epitope that is recognized by the KIR3DL1 (3DL1) receptor on NK cells (10). Although highly conserved, there is some limited variability within the Bw4 epitope and at least four different amino acid sequences are known (11). This diversity has the potential to influence NK cell recognition through 3DL1.
KIR genes are characterized by diversity at many levels including polygeny, polymorphism, and expression characteristics (5). This is a reflection of their recent and rapid evolution (12). We hypothesized that given the strong pressure on KIR to diversify, polymorphism present in individual genes would have functional consequences within the human immune system. As our prototype gene we investigated 3DL1, which we have previously shown to be highly polymorphic (13). Most of the alleles of the 3DL1 locus encode for inhibitory receptors, of which 3DL1*001 and 3DL1*002 are the most common (13). We therefore chose these receptors for investigation along with the distinctive KIR3SD1 (3DS1) allele.
3DS1 is present in 
38% of the population (14). It is highly homologous to 3DL1 in its extracellular domains (ECD) but resembles activatory KIR in the intracellular portion of the molecule. Activatory KIR have no inherent signaling capacity because they have a truncated cytoplasmic tail (5). However, upon receptor ligation, they can recruit positive signaling adaptor molecules that result in NK cell activation (15, 16, 17). No serological reagents for 3DS1 have been described to date, and this has hampered biochemical and functional characterization of this receptor. 3DS1 is of particular interest because it has been reported that, in combination with HLA-Bw4 molecules with isoleucine at position 80 (Bw4–80Ile), its expression is associated with delayed progression to AIDS (17). This association was only seen in the presence of both 3DS1 and Bw4–80Ile, suggesting that in these patients, these receptors interact functionally. One attractive hypothesis is that 3DS1+ NK cells recognize and kill HLA Bw4–80Ile HIV-infected targets, allowing control of infection. Due to the very high degree of similarity to 3DL1 extracellularly, 3DS1 is expected to have similar ligand specificity, but neither this nor definitive cell surface expression have been demonstrated.
In this study, we demonstrate that polymorphism within 3DL1 influences recognition by the HLA-Bw4 epitope and, in turn, polymorphism within HLA-B contributes to altered recognition of 3DL1. In addition, we demonstrate that 3DS1 is expressed at the cell surface, where it is recognized by the Z27 Ab. However, despite a significant genetic association with delayed disease progression in HIV-infected patients (17), we did not detect any functional interaction between 3DS1 and HLA-Bw4.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
The T cell line Jurkat, the MHC class I-deficient EBV-transformed B cell line 721.221, and its transfectants 721.221B*0702, 721.221B*2705, 721.221B*3801, 721.221B*5101, and 721.221B*5801 (10) were maintained in RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS (PAA Laboratories). Transfectants with similar levels of protein expression were used in experiments.
Generation of NK cell cultures
Blood samples were drawn from normal healthy individuals from whom written consent was obtained. PBMCs were isolated using Lymhoprep (Axis-Shield) gradient. DNA was isolated using Wizard Genomic DNA isolation kit (Promega), and 3DL1 allelic typing analysis was performed as described previously (13). NK cells were isolated by magnetic bead isolation using NK Isolation kit II (Miltenyi Biotec) according to the manufacturer’s instructions. NK cells were stained with anti-CD56FITC Ab (BD Biosciences), anti-3DL1PE Ab (Beckman Coulter), and anti-CD3PerCP Ab (BD Biosciences), and CD56-positive, CD3-negative, 3DL1-positive cells were sorted on a BD FACS Aria (BD Biosciences). Polyclonal cultures were maintained in CellGro medium (CellGenix) supplemented with 5% human AB serum (Sigma-Aldrich), 200 U/ml human recombinant IL-2 (Biological Resources Branch, National Cancer Institute), 50 ng/ml OKT3 (eBioscience), and 0.5 x 106 irradiated PBMCs/ml. NK cell clones were generated by limited dilution as described in Ref. 18 . NK cells were characterized by FACS with anti-CD56FITC Ab, anti-3DL1PE (Z27) (Beckman Coulter), anti-CD3PerCP Ab, anti-leukocyte Ig-like receptor (LILR)B1 Ab (Beckman Coulter), anti-CD94 Ab (DakoCytomation), and anti-NKG2A Ab (Beckman Coulter). LILRB1-negative clones were preferentially chosen for analysis.
RT-PCR
Total RNA was extracted from Z27-negative and Z27-dim-sorted NK cell populations with Tri Reagent (Molecular Research Centre). cDNA was generated with random hexamers using ImProm-II 
everse Transcription System (Promega). PCR was conducted on cDNA samples with the following primers: 2DL4RT (forward (F), CTGTCCCTGAGCTCTACAA and reverse (R), CACTGAGTACCTAATCACAG) to ensure quality of the cDNA; and 3SD1RT (F, GGCACCCAGCAACCCCA and R, AAGGGCACGCATCATGGA) for the presence of 3DS1 mRNA using TaqDNA polymerase (Invitrogen Life Technologies).
CD107a/CD69 activation
Purified NK cells were plated at 1 x 106 cell/ml and stimulated with 721.221 cell lines at a stimulator:responder ratio of 1:5 (CD107a) or 1:1 (CD69). Anti-CD107a FITC Ab and 10 µM monensin (Sigma-Aldrich) were added at time of stimulation for the CD107a experiment. Cells were incubated at 37°C for 6 h (CD107a) or 18 h (CD69), and then stained with anti-3DL1PE (Z27) and anti-CD56PECy5 (BD Biosciences). CD69 samples were stained with anti-CD69 Ab (BD Biosciences).
51Cr release cytotoxicity assay
Target cell lines (721.221 and transfectants) were labeled with 50 µCi of Na51CrO4 for 1 h at 37°C. Cells were then washed twice in complete medium and incubated with effector cells (NK cell clones, NK cell polyclonal cultures) at an E:T ratio of 6:1. After 4 h at 37°C, a sample of supernatant was counted on a Microbeta Trilux scintillation counter (PerkinElmer). Percentage cytotoxicity was calculated using the formula (experimental – spons)/(maximum – spons) x 100%, where spons = release from targets incubated with medium alone and maximum = release from targets by 5% Triton X-100 (Sigma-Aldrich). Blocking with anti-3DL1 DX9 Ab (BD Biosciences), Z27 (Immunotech), or with anti-CD94 Ab (Serotec) was conducted at 10 µg/ml.
Generation of KIR3DS1 FLAG
Total RNA was isolated from PBMCs of a 3DS1-positive individual using Tri Reagent (Molecular Research Center). cDNA was generated with random hexamer primers using ImProm-II Reverse Transcription System (Promega). Full-length 3DS1 was amplified with primers that contained NotI and EcoRI restriction sites for subcloning (F, 5'-ccgaatgcggccgcaccggcagcaccatgt-3' and R, 5'-atgcatgaattctttctctgtgtgaaaacacagtgttccaatta-3'). PCR products were cloned into TOPO cloning kit (Invitrogen Life Technologies) and sequenced. An error-free clone was digested and subcloned into the expression vector pcDEFIII. Leader-FLAG (F, 5'-ccgaatgcggccgcaccggcagcaccatgt-3' and R, 5'-cttatcgtcgtcgtcatccttgtaatct ggaccggccctctggaccaa-3') and FLAG-D0 (F, 5'-gattacaaggatgacgacgataagcacatgggtggtcaggacaa-3' and R, 5'-caccacagcgctgggccagg-3') sequences were amplified by PCR. Recombinant PCR was used to generate a leader-FLAG-D0 construct. This construct and the full-length 3DS1 construct were digested using NotI and Eco47III, and the leader-FLAG-D0 sequence was ligated into the 3DS1 construct.
Generation of KIR3DL1ECD/CD3
-expressing cell lines
Chimeric constructs consisting of the ECD of different 3DL1 linked with the intracellular CD3 chain were generated by recombinant PCR using a similar strategy to that described previously (19). Briefly, error-free clones of 3DL1*001, 3DL1*002, and 3DS1 were used as templates for first round PCR, which generated a product containing a -chain overlap. Similarly, first-round PCR from a -chain-containing plasmid generated a -chain with a 3DL1 overlap. Second-round PCR created a chimeric construct encoding 3DL1 in ECD and CD3 in cytoplasmic domain. PCR products were cloned into a GFP-expressing plasmid such that GFP was in frame at the C terminus of the 3DL1/CD3 chimeric protein. Subsequently, error-free clones of 3DL1/CD3/GFP chimeras were amplified using primers containing new restrictions sites (NotI and XbaI) and subcloned into the pcDEF vector. Jurkat cells were then transfected by electroporation and cultured in G418 (Sigma-Aldrich) at 2 mg/ml. After selection, GFP-expressing cells were sorted to generate stable cell lines expressing different allelic variants of 3DL1. These variants were named KIR3DL1*001ECD, KIR3DL1*002ECD, and KIR3DS1ECD for 3DL1*001, 3DL1*002, and 3DS1 alleles, respectively. They expressed protein at similar levels as measured by flow cytometry.
Transfection
Transfection of Jurkat cells was performed using a Bio-Rad Gene Pulser II electroporator. A total of 15 µg of plasmid DNA (KIR3DS1FLAG, KIR3DL1/CD3, or NFAT-luciferase construct) was transfected into 107 Jurkat cells in 250 µl of cytomix electroporation buffer (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/KH2PO4, 25 mM HEPES, 2 mM EGTA, 2 mM ATP, and 5 mM glutathione (pH 7.6)) in a 2-mm gap cuvette. The cuvette was then subjected to two pulses, each 240 V and 100 µF, 30 s apart.
Reporter assay
A total of 107 KIR3DL1ECD/CD3 Jurkat cells was transfected with 15 µg of NFAT-luciferase plasmid. Transfected Jurkat cells were plated at a concentration of 1 x 106 cells/ml, and stimulator cells (721.221 cell line and its transfectants) were added to give a stimulator:responder ratio of 1:5. CD3/CD28 Dynabeads (Dynal Biotech) (3 beads/cell) were added to positive wells. Cells were incubated for 18 h at 37°C with 5% CO2, after which they were harvested, and the cells were lysed for 15 min on a shaker at room temperature with 50 µl of 1x Passive Lysis Buffer (Promega). Firefly luciferase activity was assayed by the addition of 40 µl of luciferase assay mix (20 mM tricine, 0.26 mM (MgCO3)4Mg(OH)2.5H2O, 2.67 mM MgSO4, 0.1 M EDTA, 33.3 mM DTT, 270 µM CoA, 470 mM luciferin, 530 µM ATP) to the sample; luminescence was read using the Reporter microplate luminometer (Turner Designs) and expressed relative to unstimulated control.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
3DL1 recognizes the subgroup of HLA-B molecules that express the Bw4 serological epitope. We wished to investigate whether natural variability within the Bw4 epitope of HLA-B alleles affects recognition by 3DL1. To address this question, genetic constructs were generated that consisted of the ECD of different alleles of 3DL1 linked to the CD3 -chain intracellularly. These were transfected into the Jurkat T cell line, which we know to be KIR negative, to create a panel of Jurkat cells expressing single 3DL1 alleles in isolation. 3DL1*001 (KIR3DL1*001ECD), 3DL1*002 (KIR3DL1*002ECD), and 3DS1 (KIR3DS1ECD) expressing cells were identified by GFP staining and cell sorted to generate stably transfected cell lines. Ligation of 3DL1 on the cell surface leads to positive signaling through NFAT, which can then be measured by a standard reporter assay. To identify receptor specificity, we used a panel of stimulator cells (721.221 cell line) transfected with individual HLA alleles. This reductionist system allows interactions between 3DL1 and HLA to be studied in isolation from the complexities of multiple receptor expression. Incubation of KIR3DL1*001ECD-transfected Jurkat cell line with stimulator 721.221 cell lines expressing Bw4, but not Bw6 HLA-B allotypes, led to the generation of a NFAT signal as expected (Fig. 1A). Clear and consistent differences in the strength of signal generated from different HLA-B allotypes were observed, even when the amino acid sequence of the HLA-Bw4 epitopes were similar (see Table I). Interaction of 3DL1*001 with B*5101 consistently produced a stronger inhibitory signal than any other HLA-B allotype tested, whereas B*2705 generated only a very weak signal.
|
|
Primary, bulk populations of peripheral blood NK cells were purified from two 3DL1*001 homozygous donors and incubated with the panel of 721.221 transfectants, after which activation (CD69) and degranulation (CD107a) markers were examined. Double staining with the anti-3DL1 Ab Z27 allowed for identification of the 3DL1-positive NK cells. Incubation of NK cells with the 721.221 parental cell line led to a dramatic increase in CD69 expression in both KIR-positive and KIR-negative NK cells (Fig. 2). Quantification of the reduction in the percentage of CD69 and CD107a-positive 3DL1*001-positive NK cells produced a hierarchy that is consistent with that obtained from the Jurkat transfectant and clonal cytoxicity assays. B*5101 is consistently the strongest ligand for 3DL1*001 followed by B*3801 and B*5801. Although B*3801 appears to be significantly stronger than B*5801 in both the Jurkat and clone assays, the difference is less clear with freshly isolated NK cells. B*2705 is also capable of inhibiting CD69 and particularly CD107a expression in this assay. Thus, using a number of approaches, it is clear that HLA-B Bw4 variability impacts on 3DL1 recognition.
|
We next examined whether differences between the 3DL1*001 and 3DL1*002 allotypes affected their interaction with the panel of HLA-B allotypes. Using the Jurkat assay, both 3DL1 alleles showed recognition of HLA-B Bw4 allotypes but not of the parental or Bw6-positive cell line as expected. Although both 3DL1 allotypes showed a preference for B*5101, their interactions with B*2705 and B*5801 were markedly different. Although B*2705 appears to be a weak ligand for 3DL1*001, with only a marginal increase over the Bw6 allotype HLA-B*0702, it is a much stronger ligand for 3DL1*002 (Fig. 3). The reverse is true for HLA-B*5801. Thus, polymorphism present in the 3DL1 receptor affects NK cell recognition of HLA-Bw4.
|
3DS1, a short-tailed allele of 3DL1 that is predicted to be activatory, is highly homologous to other 3DL1 alleles extracellularly. Although 3DS1 mRNA is transcribed, 3DS1 does not bind to the anti-3DL1 Ab DX9 and cell surface expression of the 3DS1 protein has not been demonstrated. To address this question, we generated a full-length 3DS1 construct that contained a FLAG epitope at the N terminus by inserting the FLAG sequence between the leader sequence and the first coding exon. This construct was then transfected into the Jurkat cell line and stained extracellularly using an anti-FLAG Ab. As shown in Fig. 4A, cells that were transfected with the FLAG-tagged 3DS1 construct stained with the anti-FLAG Ab whereas the mock-transfected cells did not, indicating that 3DS1 is expressed on the cell surface where it may be functionally active.
|
construct. These transfected cells bound Z27 to a level that clearly distinguished them from untransfected cells (Fig. 4D). In summary, these results demonstrate that 3DS1 is expressed at cell surfaces and can be recognized by an anti-3DL1 Ab. KIR3DS1 does not recognize HLA-B on EBV-transformed B cells
To investigate the interaction of cell surface 3DS1 with HLA-B, we used the KIR3DS1ECD Jurkat cell line in the reporter assay as described above. We first demonstrated that our 3DS1 chimera was capable of transducing signal by cross-linking the receptor with the Z27 Ab (Fig. 5A, left panel). However, no interaction between 3DS1 and any of the HLA-B alleles tested was detected (Fig. 5A). Confocal microscopy imaging (data not shown) and Z27 Ab staining (Fig. 4D) of the Jurkat transfectant show cell surface expression of the KIR3DS1ECD/CD3 construct, suggesting that intracellular retention of the construct is not responsible for the lack of interaction seen. Our finding that the Z27 dim population represented 3DS1-positive cells allowed us to generate a polyclonal culture of 3DS1-positive NK cells by sorting and expanding Z27 dim NK cells. RT-PCR analysis confirmed 3DS1 expression in the Z27 dim but not in Z27-negative population (Fig. 5B). Polyclonal cultures of 3DS1-positive NK cells were used as effectors against a panel of 721.221 transfectants in a cytotoxicity assay. If 3DS1 is activated by HLA-B allotypes, we would expect that 721.221 cells transfected with HLA-B alleles would be killed to a greater degree than HLA-negative cells by 3DS1-positive cultures and that this effect could be reversed with Z27 Ab blocking. Although some differences were seen between 3DS1-positive and -negative cultures, these were only very slight and, more importantly, blocking of 3DS1 with the Z27 Ab did not alter killing of any of the target cell lines examined (Fig. 5C). These data agree with the Jurkat transfectant data and further support that 3DS1-positive NK cells are not activated by HLA-B.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
3DL1 is highly polymorphic, and we have previously demonstrated that heterogeneity in flow cytometry staining patterns reflected allelic diversity at the 3DL1 locus (13). Particular alleles of 3DL1 (3DL1*001 and *002) had a bright peak when stained with the DX9 Ab, whereas others (3DL1*005) had a dim staining profile. Individuals who were heterozygous for combinations of these patterns had a characteristic bimodal pattern of staining. There were two allotypes identified in our study that did not react with the DX9 Ab: 3DL1*004 and 3DS1. It was subsequently demonstrated that 3DL1*004 was found to be poorly expressed at the cell surface, which explained its staining pattern (25). In this study, we have definitively demonstrated that 3DS1 protein is expressed at the NK cell surface. It is not recognized by DX9 and in support of the suggestion in Ref. 26 , we have defined Z27 as an Ab that recognizes 3DS1 with a characteristic very dim staining profile by flow cytometry. The low intensity of Z27 Ab staining may be due to a lower Ab affinity for 3DS1 relative to other alleles of 3DL1 or possibly a lower level of cell surface expression. Although Z27 and DX9 Abs have very similar staining profiles of 3DL1, their exact epitopes differ (19). Tyr200 has been defined as an amino acid important for DX9 but not Z27 recognition of 3DL1. This residue is common to all 3DL1/S1 alleles and is therefore not directly involved in Z27 discrimination of 3DS1. It is possible that amino acid residue 199, in close proximity, may contribute to differential Ab recognition because Pro is present in all 3DL1 alleles whereas Leu is present in 3DS1. In general, the intensity of Z27 Ab staining is consistently higher than that seen with DX9 staining of 3DL1. Using the Z27 Ab to stain NK cells of a panel of normal donors, we have found that individuals homozygous for 3DS1 express this receptor on a higher proportion of NK cells compared with 3DS1 heterozygotes. Although this may have an as yet unidentified functional significance, it may simply reflect a gene dose effect for inhibitory alleles of 3DL1, as recently observed by Yawata et al. (24).
Although 3DS1 appears to segregate as an allele of 3DL1, it differs from other inhibitory 3DL1 alleles in a number of respects. Most striking, in terms of its structure, is its similarity in the transmembrane and cytoplasmic tail regions to activatory KIR receptors (13). 3DS1 is very similar to 3DL1 in its extracellular region, prompting the assumption that it would also recognize HLA-Bw4 ligand. We have shown that 3DS1, either on polyclonal NK cell cultures or present on the Jurkat transfectants, did not recognize any HLA-Bw4 allotype tested. Although 3DS1 is very similar to 3DL1 extracellularly, the patterns of amino acid substitutions differ from other alleles. Although inhibitory alleles of 3DL1 tend to share polymorphic substitutions in a "patchwork pattern" of substitutions, 3DS1 is unusual because it has six unique amino acid substitutions in its ECD (13). Our data suggest that these changes may result in differences in ligand specificity compared with other 3DL1 alleles.
It is also possible that peptide may play a role in restricting recognition of HLA-Bw4 by 3DS1. Presentation of peptide Ag by HLA class I to TCR-restricted T lymphocytes has been well characterized. However, data are beginning to emerge to support a possible role for the presentation of peptide to NK cells. Under normal conditions, NK cells recognize HLA class I Ag through inhibitory receptors on the cell surface. During a viral infection, removal of the inhibitory signal through down-regulation or absence of HLA class I Ag, provides a mechanism of NK cell activation (16). In addition, the presence of foreign peptide presented by HLA class I Ag can perturb inhibitory receptor ligation on the NK cell, which can result in its activation. This has previously been demonstrated in a gene therapy setting where T cells transduced with a retroviral vector became susceptible to autologous NK cell lysis (27). T cells presented foreign peptide on a HLA-Bw4 background, perturbing 3DL1 inhibitory signals to autologous NK cells that caused recognition and cytotoxicity of the T cells.
In terms of activatory KIR, it is not surprising that 3DS1 does not recognize HLA-Bw4 because NK cells should not be activated during normal homeostasis. However, we predict that 3DS1 will recognize HLA-Bw4 in a peptide-specific manner. A precedent for this comes from KIR3DL2, where the interaction between KIR3DL2 and HLA-A3 or HLA-A11 has been shown to be highly peptide specific; HLA-A3 or HLA-A11 tetramers folded in the presence of an EBV, but not self or HIV peptides, allowing binding (28). It is possible that there is a similar specificity with 3DS1 (although because we tested 3DS1 using EBV-transformed cell lines, it is unlikely to be EBV specific) with the presentation of specific, perhaps infection-associated, peptides by HLA-Bw4 required for recognition. Recognition of HIV-specific peptide by 3DS1 may provide the molecular basis for the genetic association between coexpression of 3DS1 and HLA-Bw4, and long-term nonprogression in HIV (17). Our understanding of the functional specificities of KIR is in its relative infancy compared with our knowledge of their genetics. Our findings in this study expand our knowledge of the functional consequences of KIR alleleic diversity and adds another level of complexity that must be considered when investigating interactions between KIR and their HLA ligands.
|
Acknowledgment |
|---|
|
Disclosures |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Footnotes |
|---|
1 This work was supported by an Irish Health Research Board Project grant. 
2 Address correspondence and reprint requests to Dr. Clair Gardiner, School of Biochemistry and Immunology, Trinity College, Dublin 2, Ireland. E-mail address: clair.gardiner{at}tcd.ie
3 Abbreviations used in this paper: KIR, killer cell Ig-like receptor; ECD, extracellular domain; LILR, leukocyte Ig-like receptor; F, forward; R, reverse.
Received for publication May 31, 2006. Accepted for publication October 4, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Alter, S. Rihn, K. Walter, A. Nolting, M. Martin, E. S. Rosenberg, J. S. Miller, M. Carrington, and M. Altfeld HLA Class I Subtype-Dependent Expansion of KIR3DS1+ and KIR3DL1+ NK Cells during Acute Human Immunodeficiency Virus Type 1 Infection J. Virol., July 1, 2009; 83(13): 6798 - 6805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Morvan, C. Willem, K. Gagne, N. Kerdudou, G. David, V. Sebille, G. Follea, J.-D. Bignon, and C. Retiere Phenotypic and Functional Analyses of KIR3DL1+ and KIR3DS1+ NK Cell Subsets Demonstrate Differential Regulation by Bw4 Molecules and Induced KIR3DS1 Expression on Stimulated NK Cells J. Immunol., June 1, 2009; 182(11): 6727 - 6735. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Norman, L. Abi-Rached, K. Gendzekhadze, J. A. Hammond, A. K. Moesta, D. Sharma, T. Graef, K. L. McQueen, L. A. Guethlein, C. V.F. Carrington, et al. Meiotic recombination generates rich diversity in NK cell receptor genes, alleles, and haplotypes Genome Res., May 1, 2009; 19(5): 757 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Pende, S. Marcenaro, M. Falco, S. Martini, M. E. Bernardo, D. Montagna, E. Romeo, C. Cognet, M. Martinetti, R. Maccario, et al. Anti-leukemia activity of alloreactive NK cells in KIR ligand-mismatched haploidentical HSCT for pediatric patients: evaluation of the functional role of activating KIR and redefinition of inhibitory KIR specificity Blood, March 26, 2009; 113(13): 3119 - 3129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. N. Bimber, A. J. Moreland, R. W. Wiseman, A. L. Hughes, and D. H. O'Connor Complete Characterization of Killer Ig-Like Receptor (KIR) Haplotypes in Mauritian Cynomolgus Macaques: Novel Insights into Nonhuman Primate KIR Gene Content and Organization J. Immunol., November 1, 2008; 181(9): 6301 - 6308. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Foley, D. D. Santis, E. Van Beelen, L. J. Lathbury, F. T. Christiansen, and C. S. Witt The reactivity of Bw4+ HLA-B and HLA-A alleles with KIR3DL1: implications for patient and donor suitability for haploidentical stem cell transplantations Blood, July 15, 2008; 112(2): 435 - 443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Iannello, O. Debbeche, S. Samarani, and A. Ahmad Antiviral NK cell responses in HIV infection: I. NK cell receptor genes as determinants of HIV resistance and progression to AIDS J. Leukoc. Biol., July 1, 2008; 84(1): 1 - 26. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Sharkey, L. Gardner, S. Hiby, L. Farrell, R. Apps, L. Masters, J. Goodridge, L. Lathbury, C. A. Stewart, S. Verma, et al. Killer Ig-Like Receptor Expression in Uterine NK Cells Is Biased toward Recognition of HLA-C and Alters with Gestational Age J. Immunol., July 1, 2008; 181(1): 39 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Long, L. C. Ndhlovu, J. R. Oksenberg, L. L. Lanier, F. M. Hecht, D. F. Nixon, and J. D. Barbour Conferral of Enhanced Natural Killer Cell Function by KIR3DS1 in Early Human Immunodeficiency Virus Type 1 Infection J. Virol., May 15, 2008; 82(10): 4785 - 4792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Thomas, E. Yamada, G. Alter, M. P. Martin, A. A. Bashirova, P. J. Norman, M. Altfeld, P. Parham, S. K. Anderson, D. W. McVicar, et al. Novel KIR3DL1 Alleles and Their Expression Levels on NK Cells: Convergent Evolution of KIR3DL1 Phenotype Variation? J. Immunol., May 15, 2008; 180(10): 6743 - 6750. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Foley, D. De Santis, L. Lathbury, F. Christiansen, and C. Witt KIR2DS1-mediated activation overrides NKG2A-mediated inhibition in HLA-C C2-negative individuals Int. Immunol., April 1, 2008; 20(4): 555 - 563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kim, J. B. Sunwoo, L. Yang, T. Choi, Y.-J. Song, A. R. French, A. Vlahiotis, J. F. Piccirillo, M. Cella, M. Colonna, et al. HLA alleles determine differences in human natural killer cell responsiveness and potency PNAS, February 26, 2008; 105(8): 3053 - 3058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Alter, M. P. Martin, N. Teigen, W. H. Carr, T. J. Suscovich, A. Schneidewind, H. Streeck, M. Waring, A. Meier, C. Brander, et al. Differential natural killer cell mediated inhibition of HIV-1 replication based on distinct KIR/HLA subtypes J. Exp. Med., November 26, 2007; 204(12): 3027 - 3036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Pascal, E. Yamada, M. P. Martin, G. Alter, M. Altfeld, J. A. Metcalf, M. W. Baseler, J. W. Adelsberger, M. Carrington, S. K. Anderson, et al. Detection of KIR3DS1 on the Cell Surface of Peripheral Blood NK Cells Facilitates Identification of a Novel Null Allele and Assessment of KIR3DS1 Expression during HIV-1 Infection J. Immunol., August 1, 2007; 179(3): 1625 - 1633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Chewning, C. N. Gudme, K. C. Hsu, A. Selvakumar, and B. Dupont KIR2DS1-Positive NK Cells Mediate Alloresponse against the C2 HLA-KIR Ligand Group In Vitro J. Immunol., July 15, 2007; 179(2): 854 - 868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ravet, D. Scott-Algara, E. Bonnet, H. K. Tran, T. Tran, N. Nguyen, L. X. Truong, I. Theodorou, F. Barre-Sinoussi, G. Pancino, et al. Distinctive NK-cell receptor repertoires sustain high-level constitutive NK-cell activation in HIV-exposed uninfected individuals Blood, May 15, 2007; 109(10): 4296 - 4305. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
