The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carmody, R. J.
Right arrow Articles by Chen, Y. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carmody, R. J.
Right arrow Articles by Chen, Y. H.
The Journal of Immunology, 2007, 178: 186-191.
Copyright © 2007 by The American Association of Immunologists, Inc.

Essential Roles of c-Rel in TLR-Induced IL-23 p19 Gene Expression in Dendritic Cells1

Ruaidhrí J. Carmody*, Qingguo Ruan*, Hsiou-Chi Liou{dagger} and Youhai H. Chen2,*

* Department of Pathology and Laboratory Medicine, School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; and {dagger} Department of Medicine, Cornell University Medical College, New York, NY 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-23 plays crucial roles in both immunity against pathogens and autoimmunity against self. Although it is well recognized that IL-23 expression is restricted to the myeloid lineage and is tightly regulated at the transcriptional level, the nature of transcription factors required for IL-23 expression is poorly understood. We report, in this study, that murine dendritic cells deficient in c-Rel, a member of the NF-{kappa}B family, are severely compromised in their ability to transcribe the p19 gene, one of the two genes that encode the IL-23 protein. The p19 gene promoter contains three putative NF-{kappa}B binding sites, two of which can effectively bind c-Rel as determined by chromatin immunoprecipitation and EMSA. Unexpectedly, mutation of either of these two c-Rel binding sites completely abolished the p19 promoter activity induced by five TLRs (2, 3, 4, 6, and 9) and four members of the NF-{kappa}B family (c-Rel, p65, p100, and p105). Based on these observations, we conclude that c-Rel controls IL-23 p19 gene expression through two {kappa}B sites in the p19 promoter, and propose a c-Rel-dependent enhanceosome model for p19 gene activation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin-23 is a newly described cytokine important for both immunity against pathogens and autoimmunity against self (1). IL-23 consists of an IL-12 p40 chain and a novel IL-23 p19 chain (2, 3, 4). p19 shares sequence homology with the IL-12 p35 chain (2). The formation of a biologically active p19p40 heterodimer requires the synthesis of both subunits within the same cell. The p19p40 interaction is stabilized by an interchain disulfide bond. Similar to IL-12, IL-23 stimulates IFN-{gamma} production by, and proliferation of, T cells. Recent studies indicate that IL-23 also induces strong proliferation of memory T cells, whereas IL-12 preferentially induces proliferation of naive T cells (2, 3, 4). Like IL-12, IL-23 also activates STAT4 in T cells (2, 3, 4). Despite these similarities, IL-12 and IL-23 appear to play different roles in vivo. Targeted gene mutations of p35, p40, and p19 result in distinct phenotypes in mice. For example, p19 mutation, but not that of p35, significantly abolished autoimmune encephalomyelitis and arthritis, whereas p40 mutation led to an intermediate phenotype (2, 3, 4). IL-23 is associated with the differentiation of Th cells into a ThIL-17 phenotype, characterized by the production of IL-17, IL-6, and TNF-{alpha} (5). In contrast, IL-12, but not IL-23, plays a major role in Th1 cell differentiation (2, 3, 4). Deficiency in either IL-23 or IL-12 significantly compromises the host’s ability to eliminate pathogens (1).

In the past decade, much has been learned about the regulation of p40 and p35 genes. It is now known that their expression is tightly regulated at the transcriptional level by several transcription factors, including NF-{kappa}B, C/EBP, ets-2, PU.1, and AP-1. However, because of the short history of the p19 research, very little is known about the regulation of p19, and for that matter, of the new cytokine IL-23. Like IL-12, IL-23 is primarily produced by dendritic cells (DCs)3 and monocytes (1). Using several complementary approaches, we show in this study that NF-{kappa}B and its binding sites in the p19 promoter are essential for TLR-induced activation of the p19 gene. This is the first characterization of the p19 promoter and its regulation by NF-{kappa}B.

The mammalian NF-{kappa}B family consists of five members: c-Rel, RelA (p65), RelB, NF-{kappa}B1 (p50/p105), and NF-{kappa}B2 (p52/p100). These proteins share a highly conserved 300-aa Rel homology domain at their NH2 termini, which encompasses sequences required for DNA binding, protein dimerization, and nuclear localization. The C termini of these proteins are less conserved, with those of c-Rel, RelA, and RelB containing transcriptional trans activation domains. All of the members of the NF-{kappa}B family are constitutively expressed in a variety of cell types as inactive homo- or heterodimeric proteins in association with the inhibitory protein I{kappa}B. A wide variety of stimuli, including TLR ligands, cytokines, Ags, and stress factors, can activate NF-{kappa}B. Activation of NF-{kappa}B involves phosphorylation and subsequent proteolytic degradation of I{kappa}B through the specific I{kappa}B kinase complex. Once activated, the free NF-{kappa}B dimers enter the nucleus, and bind to the 9- to 10-bp {kappa}B sites of gene promoters. The exact number and identity of NF-{kappa}B target genes in various cell types are not clear. For lymphoid and myeloid cells, only ~42 NF-{kappa}B target genes have been identified by either promoter trans activation or chromatin immunoprecipitation (ChIP) (6, 7). Of these, 11 were confirmed for c-Rel and 30 were confirmed for p50. To date, at least 122 NF-{kappa}B target genes have been identified in various mammalian cell types by either ChIP or promoter trans activation, and the total number of NF-{kappa}B target genes in the mouse or human genome is estimated to be in the range of 250–300 (6, 7). Identifying the NF-{kappa}B target genes in various physiological and pathological conditions is crucial for understanding the functions of NF-{kappa}B in health and disease. We report in this study that p19 is a novel target gene of NF-{kappa}B in DCs following TLR activation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Reagents and cell culture

LPS from Escherichia coli (O55:B5) was purchased from Sigma-Aldrich. Pam3CSK4, peptidoglycan (PGN), zymosan, and poly(I:C) were obtained from InvivoGen. The CpG oligonucleotide 1826 was obtained from IDT. The murine macrophage cell line RAW 264.7 was cultured in DMEM supplemented with 10% FCS. Bone marrow-derived DCs were generated from mouse bone marrow cells after culturing them for 7 days in RPMI 1640 containing 10% FCS, 20 ng/ml GM-CSF, 10 ng/ml IL-4 (PeproTech), 100 µg/ml streptomycin, and 10 U/ml penicillin.

Mice

Normal C57BL/6 mice were obtained from The Jackson Laboratory. c-Rel-deficient C57BL/6 mice were generated by inserting the neo resistance cassette into the fifth exon of the c-Rel gene, as described previously (8). The mice used in this study have been backcrossed to the C57BL/6 background for >10 generations. All animal procedures were preapproved by the University of Pennsylvania Animal Care and Use Committee.

Luciferase assay

The p19 promoter containing the genomic fragment –1180 to +110 of the p19 gene was amplified by PCR from C57BL/6 genomic DNA and cloned into the pGL3-basic vector (Promega). Putative NF-{kappa}B binding sites were identified using the Transcriptional Element Search System program (www.cbil.upenn.edu/tess/). Site-directed mutagenensis of identified NF-{kappa}B binding sites was performed using the QuickChange kit (Stratagene), according to manufacturer’s instructions. RAW cells were transfected with reporter constructs using FuGene-6 reagent (Roche). The luciferase activities of whole cell lysates were analyzed using the dual-luciferase reporter assay system (Promega). Cotransfection of the Renilla-luciferase expression vector pRL-TK (Promega) was used as an internal control for all reporter assays. For all samples, the data were normalized for transfection efficiency by dividing firefly luciferase activity by that of the Renilla luciferase.

Western blot

To prepare whole cell lysates, cells were lysed in radioimmunoprecipitation assay buffer containing 50 mM Tris-HCl (pH 7.4), 1% Nonidet P-40, 0.25% deoxycholate, 1.50 mM NaCl, 1 mM EDTA, 1 mM sodium orthovanadate, and 1x Complete Protease Inhibitors (Roche). Equal quantities of whole cell lysates were resolved by electrophoresis on a denaturing SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. Following immunoblotting, the membrane was developed using Pierce SuperSignal reagent (Pierce). The Abs used for immunoblotting include anti-c-Rel Ab (Santa Cruz Biotechnology), anti-beta-actin Ab (Sigma- Aldrich), and anti-IL-23p19 mAb (R&D Systems).

EMSA

A total of 5 µg of nuclear protein was used for each sample. NF-{kappa}B consensus (5'-AGTTGAGGGGACTTTCCCAGG-3') double-stranded oligonucleotides were purchased from Santa Cruz Biotechnology. Oligonucleotides were end labeled with [{gamma}-32P]ATP (Amersham Biosciences) using the T4 polynucleotide kinase (Promega). Binding reactions were prepared using 5 µg of nuclear extract with 50,000 cpm of oligonucleotide in a 25- µl reaction volume containing 10 mM HEPES-KOH (pH 7.9), 50 mM KCl, 2.5 mM MgCl2, 1 mM DTT, 10% glycerol, 1 µg DNase-free BSA, and 2.5 µg of poly(d(I-C)) at room temperature for 30 min. For supershift assay, Abs were added to the reaction mixture on ice for 20 min before the addition of radiolabeled probes. Binding reactions were resolved on a 4% nondenaturing polyacrylamide gel at 22 mA for 3 h at 4°C in 1x TBE (0.089 M Tris-base, 0.089 M boric acid, and 0.002 M EDTA). Gels were subsequently dried, exposed to a phosphor screen, and visualized on a phosphor imager (Amersham Biosciences).

Semiquantitative and real-time RT-PCR

Total RNA was isolated using RNeasy kits (Qiagen), according to manufacturer’s instructions. RNA was primed with oligo(dT) oligonucleotides and reversely transcribed with Moloney murine leukemia virus reverse transcriptase (BD Clontech). Semiquantitative PCR of p19 and beta-actin cDNAs were performed using the following oligonucleotides: p19, 5'-AAGTTCTCTCCTCTTCCCTGTCGC-3' and 5'-TCTTGTGGAGCAGCAGATGTGAG-3'; beta-actin, 5'-GTGGGCCGCTCTAGGCACCAA-3' and 5'-CTCTTTGATGTCACGCACGATTTC-3'. PCR products were analyzed by agarose electrophoresis. Real-time RT-PCR was performed with Universal PCR Master Mix (Applied Biosystems) using 18S rRNA and p19 probe sets purchased from Applied Biosystems. Data were analyzed on ABI Prism 7900 (Applied Biosystems).

ChIP

ChIP was performed using the ChIP assay kit, per the manufacturer’s instructions (Upstate Biotechnology). Briefly, cells were fixed with 1% formaldehyde at room temperature for 10 min and lysed in lysis buffer. DNA was then fragmented by sonication. After preclearance for 1 h at 4°C with salmon sperm DNA-saturated protein A-agarose, chromatin solutions were immunoprecipitated overnight at 4°C using 1 µg of rabbit anti-mouse c-Rel IgG (Santa Cruz Biotechnology), or control rabbit IgG. Input and immunoprecipitated chromatin were incubated for 4 h at 65°C to reverse cross-links. After proteinase K digestion, DNA was extracted with phenol/chloroform and precipitated with ethanol.

To determine the identity of the c-Rel target genes, ChIP DNA was further analyzed by PCR. Genomic DNA or input DNA was used as a positive control. The following primer sets were used: IL-2 promoter (IL-2-promoter-forward (F), CATACAGAAGGCGTTCATTG; IL-2-promoter-reverse (R), TACCTGTGTGGCAGAAAGC); p19 {kappa}1 site (p19-promoter-F1, CCCGACCTAGGCCTCTAGC; p19-promoter-R1, TTCCAGGGACGTGACATTCC); p19 {kappa}2 site (p19-promoter-F2, ACTGTAGGCTAAGCAGGCTG; p19-promoter-R2, AAAACTTCCACTATCTTCGG). The PCR products were then analyzed on 2% agarose gels.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
c-Rel is essential for TLR-induced IL-23 p19 gene expression

Previous studies have demonstrated a critical role for the transcription factor c-Rel in the inducible expression of the IL-12 p35 and p40, the latter of which can bind to IL-23 p19 to form IL-23 (1). To determine what role c-Rel may play in the regulation of IL-23 p19 expression, we examined the effect of c-Rel deficiency on p19 gene expression. Thus, bone marrow-derived DCs from wild-type (WT) and c-Rel–/– C57BL/6 mice were stimulated for 6 h with LPS. Using standard RT-PCR techniques, we observed strong p19 signals in WT DCs, but a near complete absence of p19 mRNA in c-Rel–/– DCs (Fig. 1A). Quantitative p19 expression analysis was then performed using real-time PCR following stimulation of DCs with five different TLR ligands, including LPS (for TLR4), PGN (for TLR2/6), CpG oligonucleotide 1826 (for TLR9), poly(I:C) (for TLR3), and Pam3CSK4 (for TLR2). All TLR ligands tested in this study robustly induced p19 expression in WT cells, although considerable variation was evident in the levels of induction for different ligands (Fig. 1B). PGN was the most potent inducer of p19 (~615-fold over the unstimulated control), whereas poly(I:C) was the least effective (~15-fold over the unstimulated control), a difference that may have important ramifications on the roles of IL-23 in host defenses against bacterial vs viral infections. Remarkably, c-Rel–/– DCs failed to produce high levels of p19 mRNA following stimulation with any of these TLR ligands (Fig. 1B). The absence of c-Rel led to a 6-fold reduction of p19 mRNA in response to PGN stimulation, and ~3-fold reductions in responses to LPS, CpG, Pam3CSK4, and and poly(I:C). Western blot analysis revealed that high levels of p19 protein were produced in WT, but not c-Rel–/– DCs following stimulation with either LPS or PGN, further confirming the c-Rel requirement for p19 expression (Fig. 1C). These results demonstrate that c-Rel is essential for p19 gene expression in DCs following TLR stimulation, and that other transcription factors, including other members of the NF-{kappa}B family, cannot compensate for the roles of c-Rel.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 1. Essential roles of c-Rel in TLR-induced p19 gene expression. A, Bone marrow-derived DCs from WT or c-Rel knockout (c-Rel–/–) mice were stimulated with 100 ng/ml LPS. Six hours later, total RNA was extracted and used to generate cDNA. RT-PCR was conducted using primers specific for murine p19 gene (p19) and beta-actin. B, WT and c-Rel–/– DCs were either left untreated (UNT) or stimulated with the TLR ligands LPS (100 ng/ml), PGN (10 µg/ml), CpG DNA (1 µM), Pam3CSK4 (PAM; 100 ng/ml), and poly(I:C) (p(I:C); 50 µg/ml). Six hours later, total RNA was extracted and used to generate cDNA. Quantitative real-time PCR was then performed using probes specific for mouse p19. Data are presented as mRNA levels relative to untreated DCs. The differences between WT and knockout groups for all stimulated cultures are statistically significant, as determined by Student’s t test (p < 0.01). Results are representative of three independent experiments. C, Bone marrow-derived DCs from WT or c-Rel knockout mice were cultured with 100 ng/ml LPS or 10 µg/ml PGN, or left untreated (Unt). Four hours later, 3 µM monensin was added, and cells were cultured for an additional 16 h. Whole cell extracts were then prepared and analyzed for p19, c-Rel, and beta-actin (as a control) expression by Western blot using specific Abs.

 
TLRs effectively activate the IL-23 p19 promoter

We next examined the promoter sequence and activity of the IL-23 p19 gene. Sequence analysis of the proximal 4-kb nucleotides of the murine p19 promoter region using the Transcriptional ElementSystem Search revealed three putative NF-{kappa}B binding sites at 95, 600, and 935 bp upstream of the translational start site (Fig. 2A). These sequences share close homology to those binding sites found in the promoters of genes regulated by the classical or canonical pathway of the NF-{kappa}B activation, which appear to be different from those used by the alternative or noncanonical pathway. The p19 {kappa}2 site sequence is identical with the {kappa}B site sequence of the CD95 (Fas) promoter. Similarly, human genomic sequences upstream of the p19 gene contain two conserved putative {kappa}B sites, suggesting a shared regulatory mechanism for murine and human p19 gene (data not shown). Additionally, this region of the genomic DNA contains putative binding sites for C/EBP, AP-1, and IFN regulatory factor (IRF)-1 transcription factors (Fig. 2).


Figure 2
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 2. Structure and function of the p19 promoter. A, Promoter sequence encompassing nt –1180 to +110 of the murine p19 gene. The three putative NF-{kappa}B sites are boxed; a putative AP-1 site is shown in bold; a C/EBP putative site is underlined; a putative IRF site is shown in italicized bold; the translation start site is indicated with an arrow; and a TATA-like sequence is shown in dashed underline. B, Schematic representation of the murine p19 promoter region (top panel) and the luciferase reporter construct generated (bottom panel). The NF-{kappa}B sites designated {kappa}1, {kappa}2, and {kappa}3 are 95, 600, and 935 bp, respectively, upstream of the translation start site. The luciferase reporter construct (pLucp19) contains all three putative NF-{kappa}B sites upstream of the firefly luciferase open reading frame. C, TLR ligands activate the p19 promoter. The RAW 264.7 cells were transiently transfected with the pLucp19 plasmid for 24 h, and cultured with or without 100 ng/ml LPS, 10 µg/ml PGN, 1 µM CpG DNA, and 50 µg/ml poly(I:C), for an additional 8 h before luciferase activity was measured. To normalize the transfection efficiency across all samples, the Renilla luciferase expression vector pRLTK was used as an internal control. Reporter activity is presented as luciferase units (left y-axis) and fold increase over untreated (UNT) cells (right y-axis). Data presented are mean ± SEM of triplicate cultures and are representative of three independent experiments.

 
To evaluate the activity of the putative p19 promoter region, we next generated a luciferase reporter plasmid designated pLucp19. The reporter plasmid carries the murine genomic DNA fragment 1180 bp upstream and 110 bp downstream of the p19 translation start site containing all three putative {kappa}B sites, which is fused to the firefly luciferase gene (Fig. 2B). Transient transfection of RAW 264.7 cells (a murine macrophage cell line) with this reporter plasmid demonstrated efficient induction of the reporter activity in response to stimulation with LPS, PGN, CpG oligonucleotide 1826, and poly(I:C). Interestingly, the relative levels of the p19 promoter activity induced by different TLRs in RAW cells differed from those seen in DCs (Fig. 2C). This difference may be due to variations in TLR signal transduction between these cell types or may reflect a divergence in the regulation of episomal vs genomic DNA promoter regions. Nonetheless, the inducibility of the pLucp19 reporter by TLRs demonstrates its suitability for the study of p19 promoter activity.

Two proximal NF-{kappa}B sites in the IL-23 p19 promoter are both required for TLR-induced IL-23 p19 expression

Our observation that c-Rel–/– DCs produce little or no p19 indicates that c-Rel is required for the activation of the p19 promoter. To directly test this theory, we transiently cotransfected RAW cells with the pLucp19 reporter plasmid and increasing amounts of a c-Rel expression vector. Subsequent analysis of the luciferase activity in transfected cells demonstrated a clear dose-dependent induction of reporter activity by c-Rel (Fig. 3A). The near complete abrogation of p19 gene expression in c-Rel–/– DCs as shown in Fig. 1 is striking because c-Rel is only one of the five members of the NF-{kappa}B family. To determine whether p19 promoter can also be activated by other members of the NF-{kappa}B family, we transfected RAW cells with expression vectors for p65, NF-{kappa}B1 (p105), NF-{kappa}B2 (p100), and RelB. We found that in addition to c-Rel, p65, p105, and p100, but not RelB, significantly induced the p19 reporter activity (Fig. 3B). Cotransfection with c-Rel and another member of the NF-{kappa}B family revealed that only p105 could significantly synergize with c-Rel to increase the reporter activity (Fig. 3C), indicating that the c-Rel:p50 heterodimer might be the most effective c-Rel containing transcriptional activator of p19 gene. c-Rel:p65 dimer may also be effective in activating p19 promoter, although it may be less so than the p65 homodimer.


Figure 3
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 3. Two essential NF-{kappa}B binding sites in the p19 promoter required for its activation by NF-{kappa}B and TLR. A, c-Rel activates the p19 promoter in a dose-dependent manner. The RAW 264.7 cells were transiently transfected with the pLucp19 plasmid along with empty expression vector or increasing amounts of expression vector of c-Rel. The total amount of plasmid was kept constant across all samples by adjusting the amount of the empty vector used. Reporter activity is presented as fold increase over cells transfected with pLucp19 and empty expression vector (0). B, c-Rel, p65, p100, p105, but not RelB activate the p19 promoter. The RAW 264.7 cells were transiently transfected with the pLucp19 plasmid along with empty expression vector or expression vectors containing murine c-Rel, p65 (RelA), p105 (NF-{kappa}B1), p100 (NF-{kappa}B2), and RelB. The pLucp19 reporter activity is presented as fold increase over cells transfected with pLucp19 plasmid and empty expression vector (mock). C, c-Rel synergizes with p105 to activate the p19 promoter. The RAW 264.7 cells were transiently transfected with the pLucp19 plasmid along with c-Rel expression vector alone or with expression vectors containing the p65, p105, p100, and RelB. The pLucp19 reporter activity is presented as fold increase over cells transfected with pLucp19 plasmid and empty expression vector (Empty). D, Nucleotide sequences of the three NF-{kappa}B sites in the p19 promoter (WT) and the base pair alterations in the mutant reporter constructs (mutant). E, LPS-induced activation of the p19 promoter is completely dependent on the {kappa}1 and {kappa}2, but not {kappa}3 site of the promoter. RAW 264.7 cells were transiently transfected with pLucp19 plasmid or pLucp19 plasmid containing mutations in one of the NF-{kappa}B sites, {kappa}1 ({kappa}1mut), {kappa}2 ({kappa}2mut), or {kappa}3 ({kappa}3mut), and stimulated with 100 ng/ml LPS for 8 h before luciferase activity was measured. Reporter activity is presented as fold increase over unstimulated cells transfected with pLucp19. F, NF-{kappa}B-induced activation of the p19 promoter requires the {kappa}1 and {kappa}2 sites of the promoter. RAW 264.7 cells were transiently transfected with the pLucp19 plasmid or pLucp19 plasmid containing mutations in one of the NF-{kappa}B sites, {kappa}1 ({kappa}1mut) or {kappa}2 ({kappa}2mut), along with empty expression vector or expression vectors containing c-Rel, p65, p105, p100, and RelB. Reporter activity is presented as fold increase over cells transfected with pLucp19 and empty expression vector (p19, Mock). For all transfection experiments in this figure, the Renilla luciferase expression vector pRLTK was used as an internal control for the normalization of transfection efficiency across samples. All luciferase data presented are mean ± SEM of triplicate cultures and are representative of three independent experiments.

 
To directly test the role of the three putative NF-{kappa}B sites in the p19 promoter region, we next generated pLucp19 reporter constructs in which one of the three sites was mutated (Fig. 3D). RAW cells were transfected with the control pLucp19 plasmid or the pLucp19 plasmid containing mutations in one of the three NF-{kappa}B binding sites ({kappa}1, –95 bp; {kappa}2, –600 bp; {kappa}3, –935 bp) and then stimulated with 100 ng/ml LPS for 8 h. Unexpectedly, we found that both NF-{kappa}B binding sites located at –95 and –600 bp, designated {kappa}1 and {kappa}2, respectively, were essential for LPS-induced p19 reporter activity, whereas the NF-{kappa}B site most distal from the transcriptional start site, {kappa}3 (–935 bp), was dispensable (Fig. 3E). Similar results were observed in the promoter trans activation assay in which p19 promoter was activated by enforced expression of c-Rel, p65, p105, or p100 (Fig. 3F). Mutations in either the {kappa}1 or {kappa}2 site of the p19 promoter completely abrogated the promoter activity. The inability of LPS or NF-{kappa}B members to activate the pLucp19 reporter when either the {kappa}1 or {kappa}2 site is mutated reveals a critical, nonredundant role for these sites in TLR-induced, NF-{kappa}B-mediated p19 gene expression.

c-Rel binds to the {kappa}1 and {kappa}2 sites of the IL-23 p19 promoter following TLR activation

To establish whether c-Rel physically interacts with {kappa}1 and {kappa}2 sites of the p19 promoter, we used two independent approaches. The first approach is the EMSA, which enables the visualization of protein:DNA interaction in vitro. Thus, nuclear extracts from LPS-treated RAW cells were first incubated with radiolabeled oligonucleotides containing the {kappa}1 and {kappa}2 sites and then resolved on a nondenaturing polyacrylamide gel. As Fig. 4A shows, both {kappa}1 and {kappa}2 sites displayed significant NF-{kappa}B-binding activities, with the {kappa}1 site demonstrating a higher binding activity than {kappa}2. To examine whether the binding activity of these two sites is mediated by NF-{kappa}B, we performed a supershift assay, using Abs specific for c-Rel, p65, and p50. This supershift assay revealed a c-Rel-binding component in the complexes associated with both {kappa}B sites. Comparison of the supershifted complexes between samples incubated with anti-c-Rel Ab and Abs directed against p65 or p50 indicates that the {kappa}1- and {kappa}2-containing oligonucleotides also bind p50- and p65-containing complexes (Fig. 4A).


Figure 4
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 4. c-Rel binding to the {kappa}1 and {kappa}2 sites of the p19 promoter as determined by EMSA and ChIP. A, Nuclear extracts from RAW 264.7 cells that had been treated with (+) or without (–) 100 ng/ml LPS for 2 h were incubated with 32P-radiolabeled oligonucleotides corresponding to the p19 {kappa}1 and {kappa}2 sites, resolved on 5% nondenaturing polyacrylamide gel, dried, and exposed overnight to a phosphor storage screen. Components of the NF-{kappa}B DNA-binding complexes were identified using specific Abs against p65, c-Rel, and p50. Control EMSA reactions were also performed in the absence of nuclear extracts with or without anti-c-Rel Ab (probe only). B, Binding of endogenous c-Rel protein to IL-23 p19 promoter in bone marrow-derived DCs. DCs from WT and c-Rel knockout (c-Rel–/–) mice were either untreated (UNT) or stimulated with LPS for 6 h and then fixed in 1% formaldehyde. Soluble, fragmented chromatin was immunoprecipitated with 1 µg of Ab specific for c-Rel or control IgG, as indicated. DNA was purified, and one-tenth of it was amplified by PCR using primers specific for the {kappa}1 and {kappa}2 sites of the mouse IL-23 p19 promoter. The input sample contains total fragmented DNA not treated with anti-c-Rel Ab.

 
Although these results indicate that NF-{kappa}B is capable of binding oligonucleotides containing the {kappa}1 or {kappa}2 sites of the p19 promoter, they do not prove that this interaction occurs in vivo, i.e., inside the cell. To address this issue, a second approach, which is based on ChIP, was used. ChIP is the most direct way for identifying target genes of transcription factors because it measures the in vivo interaction of endogenous transcription factors with their target promoters. Thus, WT and c-Rel–/– DCs were cultured with 100 ng/ml LPS for 6 h and ChIP was performed using a c-Rel-specific Ab. PCR amplification of the resulting immunoprecipitates using primers flanking the {kappa}1 and {kappa}2 sites of the p19 promoter region revealed c-Rel-binding activity at both of these sites in WT DCs (Fig. 4B). As expected, no binding was detected in c-Rel–/– DCs, serving as a control for the specificity of the ChIP.

In parallel experiments, we also examined c-Rel binding to p19 promoter by ChIP in splenocytes of mice treated with LPS i.v. As shown in Fig. 5A, little c-Rel was detected in the nuclear extracts of splenocytes before the treatment. The c-Rel nuclear level was dramatically increased following a single injection of LPS. The c-Rel nuclear signal was reduced to the background level 15 h after the treatment, reflecting the short duration of the LPS effect. To identify c-Rel target genes in this system, PCR was performed following ChIP with a c-Rel-specific Ab using primers flanking c-Rel binding sites in candidate target genes. IL-2, a known target gene of c-Rel, was used as a positive control. As shown in Fig. 5B, both p19 and IL-2 promoter DNAs were specifically precipitated by anti-c-Rel Ab, indicating that they are specific targets of c-Rel. Taken together, these results establish that c-Rel binds to the p19 promoter both in vivo and in vitro.


Figure 5
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 5. c-Rel binding to the IL-2 and IL-23 p19 promoters in vivo. A, C57BL/6J mice were injected i.v. with LPS (10 µg/mouse) and anti-CD3 mAb (10 µg/mouse). Mice were sacrificed either before (0 h) or 2, 3, 9, 15, or 24 h after the injection. Nuclear extracts of splenocytes were then prepared and analyzed by Western blot using an anti-c-Rel Ab. B, Mice were treated, and their splenocytes were collected, as described in A. ChIP-PCR was performed, as described in Materials and Methods. PCR were analyzed on 2% agarose gels. Lane 1, ChIP was performed with anti-c-Rel mAb on untreated splenocytes (collected at 0 h). Lane 2, ChIP was performed with anti-c-Rel mAb on treated splenocytes (collected at second, third, and ninth hours and mixed together before ChIP). Lane 3, ChIP was performed using control rabbit IgG on treated splenocytes. Lane 4, Genomic DNA of treated splenocytes was used for PCR as a positive control. Both IL-2 and p19 ChIP-PCR results are shown. The p19 primer set used amplifies the {kappa}1 site of the p19 promoter.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Results reported in this study establish that p19 gene expression is absolutely dependent on c-Rel and its two {kappa}B binding sites, and that other transcription factors, including other members of the NF-{kappa}B family, are unable to compensate for the c-Rel function. These results raise the following basic questions: 1) How is c-Rel specificity determined at the NF-{kappa}B binding sites? 2) Why are two c-Rel binding sites required for the expression of p19 gene in response to TLR signaling?

The absolute requirement for c-Rel binding at two distinct sites of the p19 promoter prompted us to propose a c-Rel-dependent enhanceosome model of p19 gene transcription. The enhanceosome model states that gene transcription is the result of multiple transcription factors and cofactors occupying and functionally interacting on the promoter/enhancer region of the gene (9). It argues that a specific gene would be selected for activation only if all enhanceosome components are present in the same nucleus (9). This model may explain cell- and signal-specific gene regulation, as the presence of factors common to multiple cell types and/or signaling pathways is insufficient to drive gene expression. With regard to p19, although multiple transcription factors may bind to its promoter (the p19 promoter contains putative binding sites for several transcription factors, including AP-1, C/EBP, and IRF proteins), it is not activated unless c-Rel binds to both of its {kappa}B sites. Therefore, two distinct and nonredundant interactions between c-Rel and p19 {kappa}B sites are absolutely required for p19 activation. This model also argues that the functional interactions between other transcription factors and NF-{kappa}B required for transcription of the p19 gene may only be provided by c-Rel-containing NF-{kappa}B complexes. Indeed, our EMSA analysis of the {kappa}1 and {kappa}2 binding sites suggests a preference toward particular c-Rel-containing complexes at both of these sites, indicating that subunit specificity may be encoded in the NF-{kappa}B binding sites and the flanking sequences.

Such sequence specificity has also been noted in recent studies using cells deficient in one or more members of the NF-{kappa}B family. Besides dictating which NF-{kappa}B dimer binds with the highest affinity, the sequence of the {kappa}B sites may affect with which coactivator NF-{kappa}B complexes can functionally interact. Grumont et al. (10) and Sanjabi et al. (11) reported that unlike other members of the NF-{kappa}B family, c-Rel is essential for the activation of the IL-12 p35 and p40 promoters in DCs and macrophages, respectively. Thus, c-Rel may be a specific transcriptional regulator of both IL-12 and IL-23. Other studies using NF-{kappa}B-deficient mice also indicate that the roles of NF-{kappa}B in vivo may be member specific. Thus, mice deficient in c-Rel develop normally and acquire a structurally normal immune system (8, 12). However, T cells derived from these mice fail to respond to activation signals mediated by the TCR, and produce much reduced levels of IL-2, IL-3, IFN-{gamma}, and GM-CSF. In addition, the induction of IL-2R{alpha} is also decreased, whereas apoptosis is increased in c-Rel-deficient cells. By contrast, mice deficient in RelA die in utero, presumably due to enhanced hepatocyte apoptosis. RelB-deficient mice develop normally, but suffer from severe disorders ranging from splenomegaly to chronic microbial infections. Similarly, NF-{kappa}B1 (p50)-deficient mice do not have any developmental defects, but are more susceptible to intracellular and extracellular Gram-positive bacterial infections, and are partially compromised in their B cell responses to LPS (13). Surprisingly, they are resistant to viral and Gram-negative bacterial infections (13). In contrast, NF-{kappa}B2-deficient mice suffer from severe developmental defects. Both their spleens and lymph nodes are bereft of B lymphocytes, undermining their capacity to form germinal centers. These results have led to the recognition that members of the NF-{kappa}B family perform nonoverlapping functions, and that a loss-of-function mutation of a NF-{kappa}B gene cannot be fully compensated for by other members of this family.

In addition to its well-documented roles in immunity against pathogens, recent studies from several laboratories, including ours, indicate that NF-{kappa}B plays indispensable roles in the development of autoimmune diseases (14, 15). In both mice and humans, development of type 1 diabetes is associated with heightened NF-{kappa}B activation in DCs, monocytes, and tissues infiltrated by these cells (16, 17). Conversely, inhibiting NF-{kappa}B activity is effective in suppressing type 1 diabetes in NOD mice (18), CD1 mice (19), and C57BL/6 mice (20). Additionally, modulating NF-{kappa}B activity in islet beta cells significantly affects their viability in vitro (21). To directly test the roles of NF-{kappa}B in the development of autoimmune diseases, we and others have recently studied autoimmune diabetes, arthritis, and encephalomyelitis in c-Rel- and NF-{kappa}B1-deficient mice (14, 22, 23, 24). These studies have led to the discovery that both c-Rel and NF-{kappa}B1 play indispensable roles in the development of autoimmune diseases. Because IL-23 is crucial for the development of autoimmune diseases, our demonstration that its production in c-Rel-deficient mice is blocked indicates that it may be a major mediator of the c-Rel effect in these diseases. Therefore, strategies targeting the c-Rel-IL-23 axis should be effective for the treatment of these disorders.


   Acknowledgments
 
We thank Dr. Brendan Hilliard, Dr. Christopher Hunter, Dr. Li Li, and Stacey Garrett for valuable discussions and technical support.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AI50059, AI055934, and AI55934. Back

2 Address correspondence and reprint requests to Dr. Youhai H. Chen, Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, 421 Curie Boulevard, 614 Biomedical Research Building II/III, Philadelphia, PA 19104. E-mail address: yhc{at}mail.med.upenn.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; ChIP, chromatin immunoprecipitation; IRF, IFN regulatory factor; PGN, peptidoglycan; WT, wild type; F, forward; R, reverse. Back

Received for publication June 14, 2006. Accepted for publication October 24, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Langrish, C. L., B. S. McKenzie, N. J. Wilson, R. de Waal Malefyt, R. A. Kastelein, D. J. Cua. 2004. IL-12 and IL-23: master regulators of innate and adaptive immunity. Immunol. Rev. 202: 96-105. [Medline]
  2. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13: 715-725. [Medline]
  3. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, et al 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744-748. [Medline]
  4. Belladonna, M. L., J. C. Renauld, R. Bianchi, C. Vacca, F. Fallarino, C. Orabona, M. C. Fioretti, U. Grohmann, P. Puccetti. 2002. IL-23 and IL-12 have overlapping, but distinct, effects on murine dendritic cells. J. Immunol. 168: 5448-5454. [Abstract/Free Full Text]
  5. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: 233-240. [Abstract/Free Full Text]
  6. Pahl, H. L.. 1999. Activators and target genes of Rel/NF-{kappa}B transcription factors. Oncogene 18: 6853-6866. [Medline]
  7. Natoli, G., S. Saccani, D. Bosisio, I. Marazzi. 2005. Interactions of NF-{kappa}B with chromatin: the art of being at the right place at the right time. Nat. Immunol. 6: 439-445. [Medline]
  8. Liou, H. C., Z. Jin, J. Tumang, S. Andjelic, K. A. Smith, M. L. Liou. 1999. c-Rel is crucial for lymphocyte proliferation but dispensable for T cell effector function. Int. Immunol. 11: 361-371. [Abstract/Free Full Text]
  9. Merika, M., D. Thanos. 2001. Enhanceosomes. Curr. Opin. Genet. Dev. 11: 205-204. [Medline]
  10. Grumont, R., H. Hochreina, M. O’Keeffea, R. Gugasyana, C. Whitea, I. Caminschia, W. Cooka, S. Gerondakisa. 2001. c-Rel regulates interleukin 12 p70 expression in CD8+ dendritic cells by specifically inducing p35 gene transcription. J. Exp. Med. 194: 1021-1032. [Abstract/Free Full Text]
  11. Sanjabi, S., A. Hoffmann, H. C. Liou, D. Baltimore, S. T. Smale. 2000. Selective requirement for c-Rel during IL-12 P40 gene induction in macrophages. Proc. Natl. Acad. Sci. USA 97: 12705-12710. [Abstract/Free Full Text]
  12. Gerondakis, S., A. Strasser, D. Metcalf, G. Grigoriadis, J. Y. Scheerlinck, R. J. Grumont. 1996. Rel-deficient T cells exhibit defects in production of interleukin 3 and granulocyte-macrophage colony-stimulating factor. Proc. Natl. Acad. Sci. USA 93: 3405-3409. [Abstract/Free Full Text]
  13. Sha, W. C., H. C. Liou, E. I. Tuomanen, D. Baltimore. 1995. Targeted disruption of the p50 subunit of NF-{kappa}B leads to multifocal defects in immune responses. Cell 80: 321-330. [Medline]
  14. Hilliard, B., E. B. Samoilova, T. T. Liu, A. M. Rostami, Y. Chen. 1999. Experimental autoimmune encephalomyelitis in nuclear factor-{kappa}B-deficient mice: roles of nuclear factor-{kappa}B in the activation and differentiation of autoreactive T cells. J. Immunol. 163: 2937-2943. [Abstract/Free Full Text]
  15. Campbell, I. K., S. Gerondakis, K. O’Donnell, I. P. Wicks. 2000. Distinct roles for the NF-{kappa}B1 (p50) and c-Rel transcription factors in inflammatory arthritis. J. Clin. Invest. 105: 1799-1806. [Medline]
  16. Bierhaus, A., S. Schiekofer, M. Schwaninger, M. Andrassy, P. M. Humpert, J. Chen, M. Hong, T. Luther, T. Henle, I. Kloting, et al 2001. Diabetes-associated sustained activation of the transcription factor nuclear factor-{kappa}B. Diabetes 50: 2792-2808. [Abstract/Free Full Text]
  17. Weaver, D. J., Jr, B. Poligone, T. Bui, U. M. Abdel-Motal, A. S. Baldwin, Jr, R. Tisch. 2001. Dendritic cells from nonobese diabetic mice exhibit a defect in NF-{kappa}B regulation due to a hyperactive I{kappa}B kinase. J. Immunol. 167: 1461-1468. [Abstract/Free Full Text]
  18. Ma, L., S. Qian, X. Liang, L. Wang, J. E. Woodward, N. Giannoukakis, P. D. Robbins, S. Bertera, M. Trucco, J. J. Fung, L. Lu. 2003. Prevention of diabetes in NOD mice by administration of dendritic cells deficient in nuclear transcription factor-{kappa}B activity. Diabetes 52: 1976-1985. [Abstract/Free Full Text]
  19. Ho, E., G. Chen, T. M. Bray. 1999. Supplementation of N-acetylcysteine inhibits NF{kappa}B activation and protects against alloxan-induced diabetes in CD-1 mice. FASEB J. 13: 1845-1854. [Abstract/Free Full Text]
  20. Ho, E., G. Chen, T. M. Bray. 2000. {alpha}-Phenyl-tert-butylnitrone (PBN) inhibits NF{kappa}B activation offering protection against chemically induced diabetes. Free Radical Biol. Med. 28: 604-614. [Medline]
  21. Heimberg, H., Y. Heremans, C. Jobin, R. Leemans, A. K. Cardozo, M. Darville, D. L. Eizirik. 2001. Inhibition of cytokine-induced NF-{kappa}B activation by adenovirus-mediated expression of a NF-{kappa}B super-repressor prevents beta-cell apoptosis. Diabetes 50: 2219-2224. [Abstract/Free Full Text]
  22. Lamhamedi-Cherradi, S. E., S. Zheng, B. A. Hilliard, L. Xu, J. Sun, S. Alsheadat, H. C. Liou, Y. H. Chen. 2003. Transcriptional regulation of type I diabetes by NF-{kappa}B. J. Immunol. 171: 4886-4892. [Abstract/Free Full Text]
  23. Mabley, J. G., G. Hasko, L. Liaudet, F. Soriano, G. J. Southan, A. L. Salzman, C. Szabo. 2002. NF{kappa}B1 (p50)-deficient mice are not susceptible to multiple low-dose streptozotocin-induced diabetes. J. Endocrinol. 173: 457-464. [Abstract]
  24. Hilliard, B., N. Mason, L. Xu, J. Sun, S.-E. Lamhamedi-Cherradi, H.-C. Liou, C. Hunter, Y. Chen. 2002. Critical roles of c-Rel in autoimmune inflammation and helper T cell differentiation. J. Clin. Invest. 110: 843-850. [Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
T. Chino, K. E. Draves, and E. A. Clark
Regulation of dendritic cell survival and cytokine production by osteoprotegerin
J. Leukoc. Biol., October 1, 2009; 86(4): 933 - 940.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Wang, T. Syrovets, D. Kess, B. Buchele, H. Hainzl, O. Lunov, J. M. Weiss, K. Scharffetter-Kochanek, and T. Simmet
Targeting NF-{kappa}B with a Natural Triterpenoid Alleviates Skin Inflammation in a Mouse Model of Psoriasis
J. Immunol., October 1, 2009; 183(7): 4755 - 4763.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
W. Liu, X. Ouyang, J. Yang, J. Liu, Q. Li, Y. Gu, M. Fukata, T. Lin, J. C. He, M. Abreu, et al.
AP-1 Activated by Toll-like Receptors Regulates Expression of IL-23 p19
J. Biol. Chem., September 4, 2009; 284(36): 24006 - 24016.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y.-C. Lu, I. Kim, E. Lye, F. Shen, N. Suzuki, S. Suzuki, S. Gerondakis, S. Akira, S. L. Gaffen, W.-C. Yeh, et al.
Differential Role for c-Rel and C/EBP{beta}/{delta} in TLR-Mediated Induction of Proinflammatory Cytokines
J. Immunol., June 1, 2009; 182(11): 7212 - 7221.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Skarica, T. Wang, E. McCadden, D. Kardian, P. A. Calabresi, D. Small, and K. A. Whartenby
Signal Transduction Inhibition of APCs Diminishes Th17 and Th1 Responses in Experimental Autoimmune Encephalomyelitis
J. Immunol., April 1, 2009; 182(7): 4192 - 4199.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Al-Salleeh and T. M. Petro
Promoter Analysis Reveals Critical Roles for SMAD-3 and ATF-2 in Expression of IL-23 p19 in Macrophages
J. Immunol., October 1, 2008; 181(7): 4523 - 4533.
[Abstract] [Full Text] [PDF]

Home page
 JDRHome page
S.L. Gaffen and G. Hajishengallis
A New Inflammatory Cytokine on the Block: Re-thinking Periodontal Disease and the Th1/Th2 Paradigm in the Context of Th17 Cells and IL-17
Journal of Dental Research, September 1, 2008; 87(9): 817 - 828.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Wang, B. H. Rickman, T. Poutahidis, K. Schlieper, E. A. Jackson, S. E. Erdman, J. G. Fox, and B. H. Horwitz
c-Rel Is Essential for the Development of Innate and T Cell-Induced Colitis
J. Immunol., June 15, 2008; 180(12): 8118 - 8125.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Muhlbauer, P. M. Chilton, T. C. Mitchell, and C. Jobin
Impaired Bcl3 Up-regulation Leads to Enhanced Lipopolysaccharide-induced Interleukin (IL)-23P19 Gene Expression in IL-10-/- Mice
J. Biol. Chem., May 23, 2008; 283(21): 14182 - 14189.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Mise-Omata, E. Kuroda, J. Niikura, U. Yamashita, Y. Obata, and T. S. Doi
A Proximal {kappa}B Site in the IL-23 p19 Promoter Is Responsible for RelA- and c-Rel-Dependent Transcription
J. Immunol., November 15, 2007; 179(10): 6596 - 6603.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carmody, R. J.
Right arrow Articles by Chen, Y. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carmody, R. J.
Right arrow Articles by Chen, Y. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS