|
|
||||||||
Rs Inhibits Primate Lentivirus Replication in Human Macrophages1
,
,

,
* Unité de Régulations des Infections Rétrovirales, Institut Pasteur, Paris, France;
Unité dAllergologie Moléculaire et Cellulaire, Institut Pasteur, Paris, France;
Institut National de la Santé et de la Recherche Médicale Unité 760, Paris, France;
Unité Postulante Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris, France; and
¶ Laboratoire de Biotechnologies et de Pharmacologie génétique Appliquée-Centre National de la Recherche Scientifique, Unité Mixte de Recherche 8113, Ecole Normale Supérieure de Cachan, Cachan, France
| Abstract |
|---|
|
|
|---|
RI, Fc
RIIA, and Fc
RIIIare responsible for the inhibition. MDM stimulation through Fc
Rs induces activation signals and the secretion of HIV-1 modulatory cytokines, such as M-CSF, TNF-
, and macrophage-derived chemokine. However, none of these cytokines contribute to HIV-1 suppression. HIV-1 entry and postintegration steps of viral replication are not affected, whereas reduced levels of reverse transcription products and of integrated proviruses, as determined by real-time PCR analysis, account for the suppression of HIV-1 gene expression in Fc
R-activated MDMs. We found that Fc
R-dependent activation of MDMs also inhibits the replication of HIV-2, SIVmac, and SIVagm, suggesting a common control mechanism for primate immunodeficiency lentiviruses in activated macrophages. | Introduction |
|---|
|
|
|---|
Macrophages play a major role in mounting innate and adaptive immune responses to pathogens. Macrophages react to HIV-1 infection by secreting cytokines, chemokines, and other molecules having antiviral activity or can directly control HIV-1 replication (15). However, HIV-1 infection may affect essential macrophage functions, such as Ag presentation, intracellular killing, and phagocytosis (16). Therefore, the regulation of HIV-1 and related lentivirus replication in monocytes and macrophages might affect the host susceptibility to infection and could help to control viral dissemination and pathogenesis in infected individuals. In a SCID mouse model, virus spread and pathology was abolished by suppressing macrophage infection with anti-nerve growth factor Abs (17).
We previously showed that the incubation of macrophages with i.v. Ig (IVIg)3 bound on culture plates potently inhibits HIV-1 replication independently of viral tropism (18). Inhibition was not observed when macrophages were incubated with IVIg-F(ab')2, suggesting that it was mediated by receptor(s) for the Fc portion of IgG (Fc
R) (18). Fc
Rs are a group of integral membrane proteins that bind to the Fc portion of IgG (19), which can either activate or inhibit cell activation when engaged by IgG immune complexes. Activating Fc
Rs include the high-affinity receptor Fc
RI (CD64), which can bind monomeric IgG, and the low-affinity receptors Fc
RIIA/C (CD32) and Fc
RIIIA (CD16), which do not bind monomeric IgG but bind IgG aggregates and Ag-Ab immune complexes (ICs) with a high avidity. Activating Fc
Rs possess ITAMs that become phosphorylated upon Fc
R clustering. ITAM phosphorylation promotes the recruitment of cytosolic protein tyrosine kinases. These kinases phosphorylate other proteins involved in signaling pathways, leading to the activation of PI3K and MAPKs (19). Inhibitory Fc
Rs consist of Fc
RIIB, which contains an ITIM. This motif enables Fc
RIIB to negatively regulate cell activation triggered by ITAM-containing receptors when coengaged with them.
In this study, we aimed at identifying which Fc
R(s) is(are) involved in viral inhibition. We quantitatively analyzed Fc
R-mediated inhibition of HIV-1 replication using real-time PCR (rtPCR). We also determined whether Fc
R-mediated inhibition was limited to HIV-1 or was a general antiretroviral mechanism by studying the effect of Fc
R cross-linking on the replication of other primate lentiviruses in human macrophages.
| Materials and Methods |
|---|
|
|
|---|
Human monocytes were isolated from buffy coats of healthy seronegative donors (Centre de Transfusion Sanguine Ile-de-France, Rungis and Hôpital de la Pitié-Salpêtrière, Paris, France) using lymphocyte separation medium (PAA Laboratories) density gradient centrifugation and plastic adherence as previously described (18). Monocytes were then differentiated into macrophages by 711 day culture in MDM medium (RPMI 1640 medium supplemented with 200 mM L-glutamine, 100 U of penicillin, 100 µg of streptomycin, 10 mM HEPES, 10 mM sodium pyruvate, 50 µM 2-ME, 1% MEM vitamins, and 1% nonessential amino acids) supplemented with 15% of human AB serum in hydrophobic Teflon dishes (Lumox; Dominique Dutscher) as previously described (18). MDM were then harvested, washed, and resuspended in MDM medium containing 10% heat-inactivated FCS for experiments. The purity of CD14+ macrophages was usually >95% as assessed by immunofluorescent staining and flow cytometry analysis. Fc
RI (CD64), Fc
RII (CD32), and Fc
RIII (CD16) were all expressed on the MDM surface but the proportion of cells expressing each receptor varied with different donors and MDM preparations.
LPS content in the medium and all the reagents used for culture and stimulation of MDM was below the limit of detection of the QCL1000 Limulus amebocyte lysate test (BioWhittaker).
Antibodies
mAbs against Fc
Rs (CD64, clone 32.2; CD32, clones IV.3 and AT.10; CD16, clone 3G8) were purified from hybridoma supernatants. F(ab')2 from mAbs was generated by pepsin digestion (ImmunoPure F(ab')2 Preparation kit; Pierce). Anti-CD64 F(ab')2 10.1 was from Ancell. Isotype-matched uncoupled or FITC- or PE-coupled irrelevant control mAbs or F(ab')2 were from Sigma-Aldrich. All F(ab')2 preparations used for stimulating MDM were passed through a polymyxin B-column (Detoxi-Gel Endotoxin Removing Gel; Pierce) to eliminate potential endotoxin contamination and were then verified as LPS-free by the Limulus amebocyte lysate test.
Human Fc
RIIA-specific and Fc
RIIB-specific polyclonal Abs were generated in rabbits immunized with GST fusion proteins containing the intracytoplasmic domain of either human Fc
RIIA (ICIIA) or Fc
RIIB2 (ICIIB). Briefly, cDNAs encoding the intracytoplasmic domains of human Fc
RIIA and Fc
RIIB2 were amplified by PCR using the following primers: Fc
RIIA, forward: CGCGGATCCGCGAATTCCACTGATCCTGTGAAG, reverse: CGGAATTCCGTTAGTTATTACTGTTGACATGGTC; Fc
RIIB2, forward: GCGGATCCGCGAATCCCACTAATCCTGATGAG, reverse: CGGAATTCCCTAAATACGGTTCTGGTCATC.
Purified amplicons were ligated into the PGEX4T1 vector (Pharmacia Biotech 27-4580-01) and expressed in Escherichia coli DH5
cells. GST-ICIIA and GST-ICIIB were purified on glutathione-agarose gel and were then used to immunize rabbits (one 200-µg injection in CFA followed 3 wk later by three 200-µg injections in IFA every 2 wk). Serum IgG were purified by affinity chromatography on protein A-Sepharose (Pharmacia Biotech). IgG from rabbits immunized with GST-ICIIA were absorbed by two passages through GST-ICIIB-coated Sepharose 4B beads (Pharmacia Biotech), whereas IgG from rabbits immunized with GST-ICIIB were absorbed by passage through GST-ICIIA-coated Sepharose 4B beads, to remove anti-GST and any possibly cross-reacting Abs. Anti-Fc
RIIA Abs recognized Fc
RIIA, but not Fc
RIIB, in rat basophilic leukemia (RBL) transfectants, whereas anti-Fc
RIIB Abs recognized Fc
RIIB but not Fc
RIIA in the same transfectants, as assessed by Western blotting analysis and intracellular immunofluorescence.
The above-described Fc
RIIA- and Fc
RIIB2-specific primers were used to analyze the receptor transcripts in RNA preparations from MDM by RT-PCR. RNA was extracted using RNeasy kit (Qiagen). cDNA was synthesized from 0.5 µg of total cell RNA using the TaqMan Reverse Transcription Reagents kit (Applied Biosystem). One-fifth, one-fiftieth, and one-five hundredth of the volume of the reaction mixture were used for PCR amplification (30 cycles), using Taq (Invitrogen Life Technologies) in a GeneAmp PCR9700 (Applied Biosystems). The PCR products were analyzed by gel electrophoresis on 2% agarose gel.
Anti-TNF-
rabbit IgG (gift from J.-M. Cavaillon, Institut Pasteur, Paris, France), anti-M-CSF goat IgG, or anti-macrophage-derived chemokine (MDC) chicken IgYs (both from R&D Systems) were used for TNF-
, M-CSF, or MDC neutralization, respectively. Isotypic controls were rabbit, goat, or chicken irrelevant Abs. Commercial Abs were detoxified by passage through polymyxin B columns before use. TNF-
, M-CSF, and MDC levels in culture supernatants were measured by using quantikine ELISAs (R&D Systems).
The following Abs were also used: unconjugated mouse anti-phosphotyrosine mAb 4G10: purified from hybridoma supernatant on protein G-Sepharose; rabbit anti-phospho-phospholipase C (PLC)-
1(tyrosine 783) Abs (Santa Cruz Biotechnology); rabbit anti-ERK1/2 and rabbit anti-phospho-ERK1/2 (Thr202/Tyr204) Abs (Cell Signaling); fluorochrome-conjugated CD11b-PE (clone Bear1) and CD4-PE (clone 13B8.2) (both obtained from Beckman Coulter); CD14-FITC (clone Leu M3) and CD3-FITC (clone Leu3) (both obtained from BD Biosciences).
Flow cytometry analysis
Cells were stained either with FITC-conjugated or PE-conjugated mAbs or with unconjugated mAbs or F(ab')2 followed by secondary FITC-goat anti-mouse IgG F(ab')2 or FITC-goat anti-mouse Fab F(ab')2 (Immunotech) and analyzed using a FACSCalibur flow cytometer (Beckman Coulter).
Immunoblotting
For tyrosine phosphorylation analysis, cells were lysed by three cycles of incubation for 1 min in liquid nitrogen followed by 1 min at 37°C in lysis buffer at pH 8.0 (50 mM Tris, pH 8, 150 mM NaCl, 1% Triton X-100, 1 mM Na3VO4, 5 mM NaF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 10 µg/ml pepstatin, and 1 mM PMSF). For Fc
RII expression analysis, cells were lysed by boiling 5 min in 10 mM Tris (pH 7.4), 1% SDS. Proteins were quantified using a Bio-Rad protein assay. A total of 40 µg of proteins for tyrosine phosphorylation analysis or 10 µg of proteins for Fc
RII analysis was boiled in sample buffer, fractionated by SDS-PAGE and then transferred onto Immobilon-P membranes (Millipore). The membranes were saturated with either 5% BSA (Sigma-Aldrich) or 5% skimmed milk (Régilait) diluted in Western buffer (150 mM NaCl, 10 mM Tris, and 0.5% Tween 20 (Merck) (pH 7.4) and incubated with the indicated Abs and then incubated with HRP-conjugated goat anti-rabbit or goat anti-mouse Ig Abs. Labeled Abs were detected using an ECL kit (Amersham Biosciences). Blots for Fc
RII analysis were first probed with the anti-Fc
RIIB Ab, then stripped with stripping buffer (reblot+; Chemicon International) as indicated by the manufacturer, and reprobed with the anti-Fc
RIIA Ab.
MDM stimulation
MDM were stimulated using three different methods: 1) immobilized IVIg stimulation was conducted with human IgG for therapeutic use (IVIg) (Endobuline; Baxter) (0.1 mg/ml in PBS) as previously described (18). 2) Stimulation with preformed ICs was as follows: DNP groups were conjugated to LPS-free BSA (Sigma-Aldrich) using dinitrobenzene sulfonate (Eastman Kodak) in alkaline medium and then dialyzed against PBS. Culture plates were coated with 0.1 mg/ml DNP-BSA Ag by incubation for 2 h at 37°C, washed with PBS, saturated by incubation with 1 mg/ml BSA in PBS for 30 min at 37°C and then incubated with 30 µg/ml rabbit anti-DNP Abs (Sigma-Aldrich) for 1 h at 37°C to form ICs. MDMs were stimulated by plating on IC-coated wells.
In some experiments, 3 µm of polystyrene beads (Polysciences) opsonized with DNP-anti-DNP ICs were used for MDM stimulation. Polystyrene beads were absorbed with 400 µg/ml DNP-BSA in PBS according to the manufacturers instructions, washed, and incubated with 100 µg/ml rabbit anti-DNP Abs in PBS-BSA (IC-beads) or with PBS-BSA alone (Ag-beads). MDM were plated on 96-well plates and incubated with 100 µl of medium containing IC beads or Ag beads at a bead:cell ratio of 10:1 and 30:1 and immediately infected.
3) Each Fc
R was separately cross-linked on an MDM surface by incubating MDMs with the appropriate specific F(ab')2 (5 µg F(ab')2 per 106 MDM) for 30 min at 4°C. The MDMs were then washed with PBS and seeded on plates previously coated with 0.2 mg/ml goat anti-mouse Fab F(ab')2 (Sigma-Aldrich) and saturated with 1 mg/ml BSA. MDMs were incubated in parallel with irrelevant mouse F(ab')2 as controls.
Cell viability was not affected in IgG or IC-stimulated MDM cultures, as evaluated by a WST-1-based colorimetric assay (data not shown).
Viruses and MDM infection
HIV-1 infections. The following viral strains were used for productive infections: HIV-1Bal, HIV-2SBL, SIVmac251, SIVagmGril. Strains were propagated in PHA-activated human PBMCs (except SIVagm, propagated on SupT1 cells) and the culture supernatants were collected at times of peak p24 (HIV-1) or p27 (HIV-2, SIV) production. p24 and p27 were measured with commercial ELISA kits (Beckman Coulter). Viral stocks were titrated on PHA-activated human PBMCs except SIVagm, which was titrated on SupT1 cells. Multiplicities of infection (m.o.i.) used in this study were between 102 and 2 x 102.
For single-round infections, HIV-1 particles containing the luc reporter gene and pseudotyped with the VSV-G envelope protein (HIV-1VSV-G) that allows HIV receptor-independent entry into cells were used. HIV-1VSV-G virions were produced by transiently cotransfecting (SuperFect; Qiagen) 293T cells with the proviral pNL-Luc-ER+ (20) vector and the VSV-G expression vector pCMV-G, as previously described (18). Supernatants were harvested 72 h after transfection, and p24gag levels were measured using a commercial ELISA kit (Beckman Coulter) with MDMs. Between 3 x 101 and 3 x 102 m.o.i. were used for MDM infection. Mock infections with equivalent amounts of p24 from supernatants from 293T cells transfected with pNL-Luc-ER+ only were conducted in parallel as controls.
MDMs (0.8 x 1051 x 105 cells/well in 96-well plates or 106 cells/well in 12-well plates) were infected either with viral strains or with pseudotyped particles by incubating cells with viral inoculum 1 h at 37°C, or by a spinoculation protocol (1 h centrifugation at room temperature at 1200 x g followed by 1 h incubation at 37°C), to increase the efficiency of infection (21). MDMs were then washed with PBS and cultured in MDM medium.
In the experiments for detecting HIV DNA by PCR, HIV-1VSV-G preparations were previously treated with DNase I (Roche Diagnostics).
In cytokine/chemokine neutralization experiments, IVIg-stimulated or unstimulated MDMs were infected in triplicate with HIV-1Bal, and then cultured in 96-well-plates in the presence of neutralizing concentrations of the each specific Ab (anti-TNF-
, 1/150 dilution; anti-M-CSF, 7,5 µg/ml, anti-MDC, 10 µg/ml) or equal concentrations of the appropriate control Ab. Half-culture supernatant was changed with fresh medium containing the appropriate concentrations of each Ab each 2 days.
West Nile (WN) virus infection.
Production of WN virus strain IS-98-ST1 (GenBank accession no. AF 481864) from mosquito Aedes pseudoscutellaris AP61 cell monolayers and virus titration on AP61 cells by focus immunodetection assay were performed as previously described (22). Infectivity titers were expressed as focus-forming units. RPMI 1640 medium supplemented with 2% FCS was used for washing, infection, and culture. MDM were washed three times and infected with 1 m.o.i of WN virus for 1 h at 37°C. MDM were then washed twice and incubated at 37°C for 72 h, then cell culture supernatants were harvested and processed for viral titration. As a control for inhibition of WN virus replication, MDM were exposed to 10 IU/ml human recombinant IFN-
A/D (BioSource International), during and after infection.
Measure of luciferase activity in cell lysates
At various times after infection with pseudotyped HIV-1 virions, each well of MDMs was lysed with 100 µl of luciferase cell culture lysis reagent (Promega). The luciferase activity was quantified in 20 µl of each lysate using the Promega Luciferase reporter 1000 Assay System and an LUMAT LB9501 luminometer (Berthold Technologies).
rtPCR quantification of HIV-1 cDNA forms
At different times after infection, MDMs were washed in PBS and total DNA was extracted using the DNeasy Tissue kit (Qiagen). The HIV-1 DNA forms R-U5, U5-Gag, and 2-LTR were quantified using rtPCR with an ABI PRISM 7000 instrument (Applied Biosystems Applera). For all the rtPCR, we used 100 ng of template DNA per reaction, corresponding to
2 x 104 MDMs. DNA loading was controlled by concurrently amplifying the albumin gene by rtPCR and quantifying with reference to a control human genomic DNA (Roche). The reaction mixture contained 1x TaqMan Universal PCR master mix, 300 nM of each primer (except R-U5 primers, 200 nM) and 200 nM of the appropriate fluorogenic probe, in a final volume of 30 µl. PCR cycle conditions were: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. Copy numbers of R-U5 and U5-Gag were determined with reference to a standard curve prepared by concurrent amplification of serial dilutions of 8E5 cells containing one integrated copy of HIV-1 per cell (23). The copy number of 2-LTR was determined with reference to standard curves generated by serial dilutions of CEM cells infected with HIV-1NL43. The number of 2-LTR copies/per CEM cell was previously quantified against a standard curve generated by dilution of cloned DNA with matching sequences (pSLL-IIIb, gift of A. Brussel, Institut Pasteur, Paris, France) (24). R-U5 primers are described elsewhere (25), the probe was (FAM)-AGACGGGCACACACTA-(MGB). Primers and probes for U5-Gag (26), 2-LTR (27), and albumin (28) have been reported.
Integrated HIV-1 DNA was quantified by real time Alu-Gag nested PCR using primers and probes supplied by N. Yamamoto (Tokyo Medical and Dental University, Tokyo, Japan). The first round of amplification was conducted on a Gene Amp PCR system 9700 (Applied Biosystems). Integrated HIV-1 sequences were amplified with the expand high fidelity kit (Roche) using an Alu primer (NY1F) and a Gag primer extended with an artificial tag sequence at the 5' end of the oligonucleotide (NY1R). The reaction mixture contained 100 ng of DNA, 0.2 mM dNTP, 300 nM primers, 1x buffer with 1.5 mM MgCl2, and 1.05 U of polymerase. Reaction conditions were as follows: 95°C for 2 min, 15 cycles of 95°C for 15 s, 57°C for 30 s and 72°C for 3 min, and 72°C for 2 min. Real-time nested PCR was conducted on the ABI PRISM 7000 system (Applied Biosystems) using 10 µl of 1/20 dilution of the first-round PCR product as a template with 300 nM LTR primer (NY2F), 300 nM tag sequence primer (NY2R), and 200 nM Alu-LTR probe (NY2ALU) and with 1x TaqMan Universal PCR master mix. The integrated HIV-1 DNA copy number was determined with reference to a standard curve generated by concurrent amplifications of a standard HeLa R7 Neo cell DNA. The HeLa R7 Neo cell line was generated as described (29). Briefly, HeLa cells were infected with a VSV-G pseudotyped HIV-1 R7 Neo virus (gift from A. Brussel) containing a neomycin-resistance gene and cultured for five weeks in the presence of G418. For each sample, a whole nested PCR procedure omitting the Alu primer in the first round PCR was conducted in parallel, showing a very low background. The number of integrated HIV-1 DNA copies was then adjusted by subtracting the copy number measured in the absence of the Alu primer in the first-round PCR from the copy number measured in the presence of Alu primer. Primers and probes for the Alu-Gag nested PCR are as follows: NY1 forward, GGCTGAGGCAGGAGAATGG; NY1 reverse, CAATATCATACGCCGAGAGTGCGCGCTTCAGCAAG; NY2 forward, AATAAAGCTTGCCTTGAGTGCTC; NY2 reverse, CAATATCATACGCCGAGAGTGC; NY2ALU, (FAM)-AGTGTGTGCCCGTCTGTTGTGTGACTC-(TAMRA).
| Results |
|---|
|
|
|---|
We reported previously that HIV-1 replication is inhibited in macrophages stimulated with immobilized IVIg, but not by F(ab')2 of the same IVIg preparations (18). This observation suggested that Ag-Ab complexes might regulate viral infection by interacting with macrophage Fc
Rs. To confirm this interpretation, MDMs were plated onto immobilized ICs made of DNP-BSA and IgG anti-DNP, and infected with HIV-1VSV-G pseudotype. We used HIV-1VSV-G pseudotyped viruses to assess the impact of IC stimulation of MDM on a single cycle of viral replication. HIV-1 replication was dose-dependently inhibited in MDMs exposed to ICs, compared with unstimulated MDMs, but not in MDMs exposed to Ag or Ab alone (Fig. 1A). In some experiments, MDM were incubated with IC-opsonized polystyrene beads, which are readily phagocytosed by macrophages and may mimic Ab-opsonized bacteria or cell debris. IC-coated polystyrene beads, but not beads coated with Ag only, inhibited HIV-1VSV-G replication in a dose-dependent manner (Fig. 1B). However, inhibition induced by immobilized ICs was more reproducible (data not shown) and as efficient as when induced by immobilized IVIg (Fig. 1C). The levels of IC- or IVIg-induced viral inhibition vary in parallel in MDM preparations from different donors (Fig. 1C). Replication-competent viruses, including HIV-1 Bal, were also inhibited by immobilized ICs (data not shown).
|
R.
Inhibition of HIV-1 replication is mediated by activating Fc
Rs
Human macrophages express several Fc
Rs. To identify which Fc
R(s) account(s) for IC-induced inhibition of HIV-1 replication, we investigated first the effect of engaging separately the three activating receptors known to be expressed on macrophages, and for which specific Abs are available, i.e., Fc
RI, Fc
RIIA, and Fc
RIIIA. MDMs were incubated with F(ab')2 of mAbs specific for each receptor or with irrelevant mouse F(ab')2, and seeded onto wells coated with F(ab')2 of goat anti-mouse Fab Abs. MDMs were then infected with HIV-1 BaL, and viral replication was evaluated by measuring p24 production. The incubation of MDMs with each of the Fc
R-specific F(ab')2, but not with control F(ab')2, decreased p24 production, compared with unstimulated MDMs. Anti-Fc
RIIA IV.3 F(ab')2 induced the strongest inhibition (Fig. 2). These results indicated that cross-linking activating receptors can induce an inhibition of HIV-1 replication. The level of viral suppression induced by F(ab')2 of Abs against activating Fc
Rs was, however, generally lower than that induced by either IVIg or ICs (Fig. 2 and data not shown).
|
RIIB, we investigated next the expression and the potential role of this receptor in HIV-1 inhibition. Because there are no available Abs that recognize specifically the extracellular domain of Fc
RIIB, we generated Fc
RIIB-specific and, as controls, Fc
RIIA-specific polyclonal Abs by immunizing rabbits with peptides corresponding to the intracytoplasmic domain of each receptor. By Western blotting, anti-Fc
RIIA Abs recognized proteins of the expected MW in lysates of cells stably transfected with cDNA encoding Fc
RIIA but not in lysates of cells stably transfected with cDNA encoding Fc
RIIB (Fig. 3A, left). Conversely, anti-Fc
RIIB Abs recognized proteins of the expected m.w. in lysates of cells stably transfected with cDNA encoding Fc
RIIB, but not in lysates of cells transfected with cDNA encoding Fc
RIIA (Fig. 3A, left). We used these Abs to evaluate the expression of Fc
RIIA and Fc
RIIB in monocytes and macrophages. As a control, we also examined B lymphocytes which express Fc
RIIB. As expected, Fc
RIIB was readily detected in B lymphocytes by the anti-Fc
RIIB Ab (Fig. 3A, right). In contrast, Fc
RIIB was undetectable in monocyte or macrophage lysates at concentrations that showed very strong Fc
RIIA signals (Fig. 3A, right). The same results were found with MDMs from four different donors. Thus, Fc
RIIB was not detectably expressed in MDMs under our experimental conditions. When analyzed by RT-PCR with Fc
RIIB- or Fc
RIIA-specific primers, Fc
RIIB transcripts were detected in MDM RNA, but in lower amounts than Fc
RIIA transcripts (Fig. 3B). Indeed, when analyzing three 10-fold dilutions of MDM cDNA, Fc
RIIB transcripts were clearly detected in the first dilution and barely detected in the second dilution, whereas Fc
RIIA transcripts were detected in all three dilutions (Fig. 3B). The same results were found with MDMs from two different donors. Altogether, Western blotting and RT-PCR results indicate that Fc
RIIA is the predominant Fc
RII in MDMs. To assess whether, although undetected by Western blotting, Fc
RIIB could modulate Fc
RIIA-mediated inhibition of HIV-1 replication, we compared the effect of IV.3 F(ab')2, which recognize the extracellular domain of Fc
RIIA but not that of Fc
RIIB, and the effect of AT10 F(ab')2, which recognize the extracellular domains of Fc
RIIA, Fc
RIIB, and Fc
RIIC. Similar percentages of positive cells and similar mean fluorescence intensities were found when MDM were stained with either AT10 or IV.3 F(ab')2 (Fig. 3C). AT10 and IV.3 F(ab')2 induced comparable HIV-1 inhibition in infected MDM (Fig. 3D).
|
Rs, account for the IC-induced inhibition of HIV-1 replication in MDM.
MDM stimulation through Fc
R induces activation signals and cytokine secretion
We then investigated the signaling events induced by Fc
Rs in MDMs and their consequences on infection by HIV-1VSV-G. As expected, tyrosine phosphorylation of a number of intracellular proteins, including PLC-
and ERK1/2, increased in IVIg-stimulated MDMs (Fig. 4A). PLC-
phosphorylation was transient whereas ERK1/2 phosphorylation was sustained in noninfected MDMs (Fig. 4, A and C). HIV-1VSV-G infection did not detectably modify the phosphorylation patterns or kinetics (Fig. 4B), even when examined over an extended period of time (Fig. 4C).
|
R-mediated signaling on HIV-1 inhibition in IC-stimulated MDMs, we used piceatannol, reported as an inhibitor of the tyrosine kinase Syk that is recruited by phosphorylated ITAMs in Fc
R aggregates (30). Piceatannol concentrations of 2040 µM partially but significantly (p = 0.001) removed viral suppression in IC-stimulated MDM infected with HIV-1VSV-G (data not shown). However, piceatannol treatment also caused a dose-dependent inhibition of HIV-1 replication in unstimulated MDM, which was almost complete at concentrations higher than 50 µM (data not shown), possibly because of the inhibition of phosphorylation pathways involved in HIV-1 replication. Indeed piceatannol can inhibit not only Syk but also numerous tyrosine and serine-threonine kinases (31, 32, 33).
MDM stimulation by either IVIg or ICs induced chemokine and cytokine secretion, including M-CSF, MDC, and TNF-
(Ref. 18 and data not shown). Cross-linking of activating Fc
R with anti-Fc
R F(ab')2 on MDMs also induced the secretion of M-CSF (Fig. 4D) and other cytokines (data not shown). Whether using IVIg or ICs or anti-Fc
R F(ab')2, in all cases the amounts of cytokines secreted by Fc
R-activated MDMs, and particularly M-CSF, correlated with the magnitude of inhibition of HIV-1 replication (Figs. 2 and 4A, Ref. 18 , and data not shown). However, we previously reported that HIV-1 suppression could not be induced by exposing MDMs to cytokine-containing supernatants from IVIg-stimulated MDMs and that MDC neutralization in IVIg-stimulated MDM cultures did not restore HIV-1 replication (18). These results indicate that neither MDC nor other secreted factors are responsible for Fc
R-mediated HIV-1 inhibition. Supporting this conclusion, anti-M-CSF or anti-TNF-
neutralizing Abs reduced, rather than enhanced, HIV-1 infection in unstimulated MDMs, and increased IVIg-induced inhibition (data not shown).
HIV-1 cDNA and integrated proviruses are decreased in Fc
R-activated macrophages
To identify the steps in the HIV-1 replicative cycle that are inhibited in Fc
R-activated MDMs, we measured the intermediate products of HIV-1 replication using rtPCR in single-round infections with HIV-1VSV-G from entry to integration. We used primers and probes amplifying early (R-U5) and late (U5-Gag) products of reverse transcription (RT), 2-LTR circles (2-LTR), and integrated proviruses (Alu-LTR). We found similar HIV-1 replication inhibition profiles in MDMs activated either by IVIg or by ICs in MDMs from three different donors. A representative experiment is shown in Fig. 5. Luciferase activity in cell lysates was much lower in IC-activated MDMs (90% inhibition at 96 h) than in unstimulated MDMs (Fig. 5A). Similar levels of R-U5 products were found by rtPCR in unstimulated and in IC-stimulated MDMs at 4 and 24 h postinfection (p.i.) (Fig. 5B). At these early times, R-U5 products essentially reflect the input virus entered into the cells and the initial synthesis of the first products of retrotranscription. However, at later times p.i., the levels of both early and late RT products were decreased in IC-activated MDMs compared with unstimulated MDMs (Fig. 5, B and C). Among the nuclear forms of HIV-1 cDNA, 2-LTR circles were only slightly less abundant in IC-activated MDMs than in unstimulated MDMs (Fig. 5D), whereas the number of integrated copies, determined from Alu-LTR levels, progressively decreased over time in IC-activated MDMs (64 and 76% inhibition at 48 and 96 h p.i., respectively) (Fig. 5E). Accordingly, the ratio between 2-LTR circles and integrated forms was higher in IC-activated MDMs than in control MDMs and increased over time (2-LTR copies were at 6% and 2.6% of Alu-LTR copies at 48 h p.i. and at 38% and 15% at 96 h p.i. in IC-activated and in unstimulated MDMs, respectively) (Fig. 5F). This result suggests that unintegrated viral forms accumulate in Fc
R-activated MDM while integrated forms decrease.
|
R-activated macrophages
We then determined whether Fc
R-mediated activation of macrophages could affect HIV-1 postintegration steps, including transcription. MDMs were infected with HIV-1VSV-G and cells were kept in suspension for 72 or 96 h before they were plated onto IVIg-coated or uncoated wells. Under these conditions, MDMs activation was triggered after most of the viral DNA should be integrated (Fig. 5 and results not shown). Forty-eight hours after activation, similar levels of luciferase activity were found in lysates from unstimulated and from IVIg-stimulated MDMs (Fig. 6). By contrast, the same MDM preparation activated at the same time as infection showed a luciferase activity 82% lower in IVIg-stimulated MDMs than in unstimulated cells (Fig. 6). These results indicate that HIV-1 transcription and protein synthesis are not affected by Fc
R-mediated activation in macrophages.
|
R-mediated activation of macrophages inhibits the replication of primate lentiviruses
All lentiviruses can complete integration in nondividing cells and can thus replicate in macrophages. Therefore, we wondered whether other primate lentiviruses would also be susceptible to Fc
R-mediated inhibition in human macrophages. MDMs were infected with HIV-2SBL, SIVmac, or SIVagm, plated onto wells coated with ICs, and viral p27 levels were measured in culture supernatants every 3 days for 23 days (Fig. 7, AC). All three lentiviruses replicated efficiently in control MDMs, with p27 production becoming >1 µg/ml. p27 levels were markedly reduced in the cultures of MDMs infected with each of the three viruses and stimulated with ICs (Fig. 7, AC). Fc
R-mediated inhibition of viral infection is therefore not limited to HIV-1 but affects other primate lentiviruses.
|
R-mediated inhibition affects HIV-1 reverse transcription and integration that are peculiar features of retroviral replication. Therefore, we investigated whether Fc
R-mediated activation of MDMs could affect other viruses. For this experiment, we used the WN virus, an unrelated macrophagotropic Flaviviridae virus. WN virus replication in unstimulated MDMs was compared with that in Fc
R-stimulated MDMs (Fig. 7D). As a control for inhibition, MDMs were treated with IFN-
(34, 35, 36). MDMs were infected with WN virus IS-98-ST1 strain at 1 m.o.i. No cytopathic effect was observed in any condition (not shown). After 72 h, titers of virus produced in cell culture supernatants were determined. No difference was observed in the virus titer between unstimulated and stimulated MDMs (Fig. 7D). However, as expected, virus titer was strongly decreased in IFN-
-treated MDMs. These results suggest therefore that Fc
R-mediated inhibition selectively affects lentiviruses. | Discussion |
|---|
|
|
|---|
Rs account for HIV-1 inhibition, but that Fc
R-induced cytokines are not responsible for HIV-1 inhibition; 3) that inhibition affects neither viral entry nor postintegration steps, but causes a reduction of viral cDNA and blocks viral integration; 4) that Fc
R-mediated suppression is not only limited to HIV-1 but also affects other primate lentiviruses.
We showed that the three known ITAM-bearing Fc
Rs can mediate HIV-1 replication inhibition. Although the levels of HIV-1 inhibition varied depending on the MDM preparation, it was consistently higher upon Fc
RIIA cross-linking than upon Fc
RI or Fc
RIIIA cross-linking (Fig. 2). Whether this difference is due to a higher expression of Fc
RIIA on MDMs, to specific properties of this receptor, or to a higher affinity of the anti-Fc
RIIA mAb used is not known. Inhibition of HIV-1 correlated with MDM activation, as judged by M-CSF and MDC secretion. Accordingly, the partial recovery of HIV-1 replication by piceatannol in IC-stimulated MDM may suggest that blocking signaling pathways downstream activating Fc
Rs can remove HIV-1 inhibition. However, the significance of this result was obscured by a direct inhibitory effect of piceatannol on HIV-1 replication. Both inhibition of HIV-1 and MDM activation were generally lower when induced by anti-Fc
R F(ab')2 than when induced by IVIg or ICs. This is consistent with previous studies showing that Fc
R cross-linking with immobilized IgG induces TNF secretion by human monocytes, whereas cross-linking with anti-Fc
R Abs does not (37). It also indicates that ICs or IVIg are more efficient at aggregating Fc
Rs than anti-Fc
R Abs.
We found no evidence that Fc
RIIB contributes to IC-induced HIV-1 inhibition in MDMs. On possible reason is the low expression of Fc
RIIB in these cells. We did not detect Fc
RIIB proteins by Western blotting, but we found relatively low levels of Fc
RIIB transcripts by RT-PCR, in MDMs. These results are consistent with previous reports where Fc
RIIB detection by Western blotting required very high amounts of monocytes (38, 39). Fc
RIIB is highly regulated by culture conditions and the presence of cytokines, including IL-4 (38, 39, 40). Culture conditions used for macrophages differentiation, i.e., culture medium supplemented with human serum but with no added cytokines, may not be optimal for Fc
RIIB expression. Our data, however, do not exclude that, if expressed at sufficient levels, Fc
RIIB could negatively regulate HIV-1 replication inhibition by activated Fc
Rs. The coengagement of Fc
RIIA/C and Fc
RIIB by AT10 F(ab')2, however, had the same effect on HIV-1 replication as the engagement of Fc
RIIA alone by IV.3 F(ab')2.
Fc
Rs have been involved in either enhancement or inhibition of HIV-1 infection when engaged by anti-HIV-1 Abs. Fc
RI has been suggested to contribute to the control of infection in HIV-1-infected patients by favoring the internalization of HIV-1-IgG complexes and the degradation of the virus in macrophages (41). Likewise, bispecific Abs that could target HIV-1 to macrophage activating Fc
Rs inhibited HIV-1 infection (42). On the contrary, Fc
RI or Fc
RIII have been suggested to enhance the entry of Ab-opsonized HIV-1 virions into macrophages (43, 44, 45). Whatever the effects of activating Fc
Rs when engaged by HIV-anti-HIV immune complexes, we consistently found that activating Fc
Rs inhibited HIV-1 infection when engaged by irrelevant IgG immune complexes. It was recently reported that Fc
RIIA/IIIA polymorphisms which confer higher avidity binding to ICs are associated with protection against HIV infection, but, on the contrary, these same polymorphisms are associated with the likelihood of infection in HIV gp120-vaccinated individuals (46). Based on these data, one may speculate that in the presence of preexistent HIV-gp120-specific Abs induced by vaccination, higher avidity for ICs may be deleterious favoring Ab-dependent enhancement of HIV infection. In contrast, in the absence of preexistent HIV-1 Abs, higher avidity of Fc
Rs for circulating ICs may favor protection against incoming infection by limiting viral replication in IC-activated macrophages.
Macrophage activation by Fc
Rs affects the mechanisms that eventually lead to proviral integration. Previous qualitative PCR analysis of IVIg-stimulated MDMs infected with a replication competent virus detected a reduction in integrated proviral DNA but not in RT products (18). Using one-round infections, which avoid overlapping replication cycles, and quantitative PCR, we now show that, whereas reverse transcription was not affected at the earliest times p.i., the levels of both early and late cDNA products were eventually reduced in activated MDMs (Fig. 5). Levels of integrated proviruses were further inhibited in either IVIg or IC-stimulated MDMs. By contrast, the ratio of circular 2-LTR forms to integrated forms was higher in activated macrophages than in controls (Fig. 5F). 2-LTR circles are unintegrated nuclear forms of HIV-1 DNA (47, 48, 49) and thus reflect the translocation of viral transcripts into the nucleus of infected cells. Our results suggest that unintegrated HIV-1 DNA accumulates because of an inhibition of integration, as observed with anti-integrase drugs (50). The level of HIV-1-integrated forms in Fc
R-activated MDMs decreased to levels similar as viral replication inhibition levels, as shown by reduced luciferase activity (Fig. 5 and data not shown), suggesting that the postintegration steps of replication are unaffected. We confirmed this hypothesis by showing that Fc
R-stimulation did not alter viral gene expression, once integration was achieved (Fig. 6).
The activation of PI3K or of the MAPK pathways has been shown to be essential for an efficient replication of HIV-1 (51, 52, 53). Therefore, one expects early signaling events triggered by activating Fc
R cross-linking to favor HIV-1 replication rather than to exert an antiviral effect. We thus suggest that Fc
R-induced late signaling events, which need to be identified in future work, are involved in HIV-1 inhibition. These might include the mobilization, the neosynthesis or the suppression of molecules that are critical for RT and/or integration. Fc
R-activated MDMs secrete several cytokines, such as M-CSF, TNF-
, and MDC, which either up- or down-regulate HIV-1 infection in macrophages (54, 55, 56). Neutralization of these cytokines in MDM cultures showed that the inhibitory mechanisms induced by Fc
R-aggregation overcome the enhancing effects of M-CSF and TNF-
on HIV-1 replication and are not linked to MDC (data not shown and Ref. 18). The preintegration inhibition induced by Fc
R stimulation is reminiscent of the inhibitory effects of IFN-
(57). IFN-
was, however, not detected in Fc
R-activated MDM supernatant (18). In addition, WN virus infection, which is inhibited by IFN-
and
(Fig. 7B and Refs. 34 and 35), was not affected in Fc
R-activated MDM. The participation of type I IFNs in HIV-1 inhibition in Fc
R-activated MDM is therefore unlikely.
Two distinct inhibition mechanisms may be operating: one affecting the retrotranscription process, and another inhibiting viral integration after nuclear translocation of HIV-1 cDNA. A single mechanism may however inhibit both steps of the viral cycle. An increased degradation of reverse transcripts by endonucleases, as suggested for APOBEC3G (58), or of incoming viral proteins by the proteasome (59, 60), would reduce both the levels of reverse transcripts and the RT products available for integration. Alternatively, mechanisms that hinder HIV-1 integrase activity and/or affect the preintegration complex stability would have a negative impact on both integration and reverse transcription. Indeed, although reverse transcription and integration occur in distinct cellular compartments, they take place in the same molecular environment formed by the preintegration complex (61). Moreover, HIV-1 integrase was involved in different steps of the HIV-1 life cycle, including RT (62, 63).
Remarkably, Fc
R-mediated antiviral activity is not limited to HIV-1 as it also affects other primate lentiviruses. By contrast, unrelated macrophage-tropic viruses such as the WN virus were not affected, suggesting that Fc
R-mediated antiviral activity is not a general antiviral defense mechanism. If it targets highly conserved lentiviral proteins and/or their functions, such as RT and integration, one would expect inhibition to affect other HIV-1-related lentiviruses. It would be interesting to study the effect of Fc
R-mediated activation of macrophages on the replication of lentiviruses in their natural hosts in more distant animal systems. This would be especially relevant for diseases caused by lentiviruses having a restricted tropism for macrophages, such as the caprine arthritis and encephalitis virus or the Maedi-Visna virus.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Agence Nationale de Recherches sur le SIDA, France. ![]()
2 Address correspondence and reprint requests to Dr. Gianfranco Pancino, Unité de Régulations des Infections Rétrovirales, Institut Pasteur, 25, rue du Docteur Roux, 75726 Paris Cedex 15, France. E-mail address: gpancino{at}pasteur.fr ![]()
3 Abbreviations used in this paper: IVIg, i.v. Ig; IC, immune complex; rtPCR, real-time PCR; MDM, monocyte-derived macrophage; RBL, rat basophilic leukemia; MDC, macrophage-derived chemokine; PLC, phospholipase C; m.o.i., multiplicity of infection; WN, West Nile; RT, reverse transcription; p.i., postinfection. ![]()
Received for publication February 15, 2006. Accepted for publication August 7, 2006.
| References |
|---|
|
|
|---|
-mediated suppression of human immunodeficiency virus type 1 replication in primary human macrophages. J. Virol. 77: 4081-4094.
R1-mediated signaling and effector function by the Syk-selective inhibitor, piceatannol. J. Biol. Chem. 269: 29697-29703.
B activation and NF-
B-mediated gene expression through suppression of I
B
kinase and p65 phosphorylation. J. Immunol. 169: 6490-6497.
-2b and ribavirin against West Nile virus in vitro. Emerg. Infect. Dis. 8: 107-108. [Medline]
/
Interferon protects against lethal West Nile virus infection by restricting cellular tropism and enhancing neuronal survival. J. Virol. 79: 13350-13361.
RI and Fc
RII induces secretion of tumor necrosis factor by human monocytes, requiring high affinity Fc-Fc
R interactions: functional activation of Fc
RII by treatment with proteases or neuraminidase. J. Immunol. 144: 1304-1310. [Abstract]
receptors on human monocytes by Th1 and Th2 cytokines. J. Immunol. 166: 531-537.
RIIb in human monocytic cells. J. Biol. Chem. 277: 5082-5089.
receptors in human monocytes. J. Leukocyte Biol. 77: 767-776.
RI (CD64) in the mechanism of HIV-1 inhibition by polyclonal IgG purified from infected patients in cultured monocyte-derived macrophages. J. Immunol. 173: 6274-6283.
Rs) on human monocytes and macrophages are not infectivity receptors for human immunodeficiency virus type 1 (HIV-1): studies using bispecific antibodies to target HIV-1 to various myeloid cell surface molecules, including the Fc
R. Proc. Natl. Acad. Sci. USA 88: 9593-9597.
RIII, independently of CD4. AIDS Res. Hum. Retroviruses 11: 343-352. [Medline]
receptor IIa and IIIa polymorphisms are associated with the risk of HIV infection. In 13th Conference on Retroviruses and Opportunistic Infections, February 58, Denver, CO.
production by primary human macrophages is mediated by phosphatidylinositol-3 (PI-3) kinase and mitogen-activated protein (MAP) kinase pathways. J. Leukocyte Biol. 78: 1016-1023.
inhibits entry of human immunodeficiency virus type 1 into primary human macrophages: a selective role for a 75-kilodalton receptor. [Published erratum appears in 1997 J. Virol. 71: 1581.]. J. Virol. 70: 7388-7397. [Abstract]
, -
, and -
in primary human macrophages. Virology 193: 138-148. [Medline]This article has been cited by other articles:
![]() |
A. Bergamaschi, D. Ayinde, A. David, E. Le Rouzic, M. Morel, G. Collin, D. Descamps, F. Damond, F. Brun-Vezinet, S. Nisole, et al. The Human Immunodeficiency Virus Type 2 Vpx Protein Usurps the CUL4A-DDB1DCAF1 Ubiquitin Ligase To Overcome a Postentry Block in Macrophage Infection J. Virol., May 15, 2009; 83(10): 4854 - 4860. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |