The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsui, K.
Right arrow Articles by Akira, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsui, K.
Right arrow Articles by Akira, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
The Journal of Immunology, 2006, 177: 5785-5789.
Copyright © 2006 by The American Association of Immunologists, Inc.


CUTTING EDGE

Cutting Edge: Role of TANK-Binding Kinase 1 and Inducible I{kappa}B Kinase in IFN Responses against Viruses in Innate Immune Cells1

Kosuke Matsui*,{dagger}, Yutaro Kumagai*,{dagger}, Hiroki Kato*, Shintaro Sato{dagger}, Tatsukata Kawagoe*,{dagger}, Satoshi Uematsu*, Osamu Takeuchi*,{dagger} and Shizuo Akira2,*,{dagger}

* Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan; and {dagger} Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Suita, Osaka, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
TANK-binding kinase 1 (TBK1) and inducible I{kappa}B kinase (IKK-i) are involved in the activation of transcription factors inducing the production of type I IFNs. Although TBK1, but not IKK-i, is critical for LPS-induced IFN induction, the role of these kinases in the responses against viral infection is yet to be determined. In this study, we show that type I IFN production against various RNA viruses was completely abrogated in conventional dendritic cells (DCs) and macrophages induced from fetal liver cells lacking both TBK1 and IKK-i, whereas considerable amounts of IFN were produced in cells lacking either of them. Microarray analysis revealed that various IFN-inducible genes were also regulated by the kinases. In contrast, Fms-like tyrosine kinase 3 ligand-induced DCs produced IFN-{alpha} even in the absence of both TBK1 and IKK-i. Thus, these two kinases are essential and compensate each other for the regulation of IFN responses in innate immune cells except plasmacytoid DCs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Recognition of viral components, such as ds- and ssRNA, by innate immune cells leads to rapid induction of type I IFNs, which are essential mediators of initial host defense against viruses (1). The recognition of viral dsRNA is mediated by host pattern recognition receptors, including retinoic acid-inducible gene-I (RIG-I),3 melanoma differentiation-associated gene-5 (MDA5), and TLR3 (2, 3, 4). RIG-I and MDA5 are cytoplasmic proteins comprised of caspase recruitment domains (CARDs) and a helicase domain. Whereas RIG-I is responsible for the recognition of various RNA viruses including paramyxoviruses, vesicular stomatitis virus (VSV), influenza virus, and Japanese encephalitis virus, MDA5 detects viruses belonging to picornavirus family such as encephalomyocarditis virus (EMCV) (5). RIG-I and MDA5 detect dsRNAs via the helicase domain and initiate downstream signaling cascades via the CARDs by associating with a CARD-containing signaling protein, named IFN-beta promoter stimulator-1 (also known as MAVS, VISA, or CARDIF) (6, 7, 8, 9). TLR3, which localizes on the endosomal membrane, recruits a TIR-domain-containing adaptor-inducing IFN-beta (TRIF) to the receptor upon ligand stimulation (10). In addition, LPS, a TLR4 ligand, is shown to induce type I IFNs via the TRIF-dependent signaling pathway.

Downstream of the IFN-beta promoter stimulator-1 or TRIF, I{kappa}B kinase-related kinases, called TANK-binding kinase 1 (TBK1) and inducible I{kappa}B kinase (IKK-i), also known as IKK-{epsilon}, are activated in response to the stimuli (11, 12). They can phosphorylate IFN-regulatory factor (IRF)-3 and IRF-7, which in turn translocate into the nucleus and induce the expression of type I IFN as well as IFN-inducible genes. It has been shown that TBK1 plays a critical role in the induction of IFN-beta as well as IFN-inducible genes in mouse embryonic fibroblasts (13, 14). However, TBK1-deficient bone marrow macrophages showed normal IFN responses against RNA virus infection, and it was unclear whether TBK1 and IKK-i play a pivotal role in the regulation of type I IFNs in innate immune cells (15). Moreover, a recent study suggested that TBK1 and IKK-i can regulate different IFN-{alpha} genes, IFN-{alpha}11 and IFN-{alpha}4, respectively (16). Moreover, it was shown that plasmacytoid dendritic cells (pDCs) could produce IFN-{alpha} in response to TLR9 ligands independent of TBK1 via the direct association of MyD88 and IRF-7.

In this study, we investigated the role of TBK1 and IKK-i in innate immune cells by generating macrophages and DCs from fatal liver cells under TNF–/– background. Our results clearly demonstrate that both TBK1 and IKK-i are key players for the expression of type I IFNs and IFN-inducible genes in response to exposure to various RNA viruses in conventional DCs (cDCs), but not in pDCs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Mice, cells, reagents, and viruses

TBK1–/–, IKK-i–/–, and TNF-{alpha}–/– mice have been described previously. LPS was purchased from Sigma-Aldrich. Poly(I:C) was purchased from Amersham Biosciences. Newcastle disease virus (NDV), VSV, influenza virus lacking NS1 protein ({Delta}NS1), and EMCV have been described previously (5). The Ab against phosphor-IKK{alpha} (Ser180)/IKKbeta (Ser181) was obtained from Cell Signaling. Abs against IKK{alpha}beta and I{kappa}B-{alpha} were purchased from Santa Cruz Biotechnology.

Quantitative real-time PCR (Q-PCR)

RNA was prepared from cDCs stimulated with 100 ng/ml LPS or infected with NDV, and cDNA was synthesized using Superscript II (Invitrogen Life Technologies). Q-PCR analysis was performed using the 7700 Sequence Detector (Applied Biosystems). The primers and probes for and IFN-beta, Cxcl10, Cxcl1, IFN-a2, -a4, -a5, and -a11 were purchased from Applied Biosystems. Primers for 18s rRNA were used as an internal control. To detect the expression of a gene encoding NDV nucleocapsid protein, the following primers and probes were used: forward primer TTCCGTATTCGACGAGTACGAA, reverse primer CAAGGGCAACATGGTTCCTC, and the TaqMan probe TCAGGCAAGGTGCTC.

Measurement of IFN-beta and IFN-{alpha} production

Culture supernatants were collected and analyzed for production of IFN-beta and IFN-{alpha} (PBL Biomedical Laboratories) by ELISA.

Native PAGE and Western blot analysis

cDCs (1 x 106) were infected with NDV for the indicated periods, and then lysed. The cell lysates were separated on a native-PAGE, and then immunoblotted with anti-IRF-3 Ab as described previously (13).

Microarray analysis

cDCs were exposed to NDV for 8 h. Then, total RNA was extracted with TRIzol (Invitrogen Life Technologies) and further purified with a RNeasy kit (Qiagen). Biotin-labeled cDNA was synthesized from 100 ng of total RNA using Ovation Biotin RNA Amplification and Labeling System (Nugen) according to the manufacturer’s protocol. Hybridization, staining, washing, and scanning of Affymetrix mouse Genome 430 2.0 microarray chips were conducted according to the manufacturer’s instruction. Data analysis was performed using MicroArray Suite software (Affymetrix) and ArrayAssist software (Stratagene).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Generation of cDCs lacking TBK1 and/or IKK-i

TBK1–/– mice are embryonic lethal because of liver degeneration at e14.0–15.0, and this phenotype has been shown to be rescued in the absence of TNF receptor signaling. TBK1–/–IKK-i–/– mice are also embryonic lethal at around e12.0, and it was difficult to prepare fetal liver cells from them. To investigate the role of TBK1 and IKK-i in immune cells, we tried to generate mice lacking TBK1 and/or IKK-i under TNF–/– background. First, we could obtain adult mice lacking TNF and TBK1 (TNF–/–TBK1–/–) as reported previously. Nevertheless, TNF–/–TBK1–/–IKK-i–/– mice were embryonic lethal at e14.0 and the mice were not born alive. Nevertheless, fetal liver cells could be prepared from TNF–/–TBK1–/–IKK-i–/– e13.5 embryos, and the cells were cultured in the presence of GM-CSF. The surface expression of CD11c and CD11b was not altered in the GM-CSF-induced cells obtained from TBK1+/–IKK-i+/–, TBK1–/–IKK-i+/–, TBK1+/–IKK-i–/–, and TBK1–/–IKK-i–/– embryos under TNF–/– background (data not shown), and we used the cells as cDCs for further investigation.

The expression of IFN-inducible genes in response to LPS and NDV in cDCs

We first examined the role of TBK1 and IKK-i in the expression of IFN-inducible genes in response to LPS and NDV in cDCs. cDCs derived from fetal livers were stimulated with 100 ng/ml LPS for the indicated periods, and the expression of mRNAs for Ifnb, Cxcl10 (IP-10), and Cxcl1 (KC) were quantified by Q-PCR. As shown in Fig. 1A, LPS-induced expression of IFN-beta and IP-10 genes was not impaired in IKK-i–/– cDCs, and was severely impaired in either TBK1–/– or TBK1–/–IKK-i–/– cDCs in accordance with a previous report. In contrast, induction of Cxcl1 was not impaired even in the absence of both TBK1 and IKK-i. These results indicate that the TLR4-induced IFN-production predominantly depends on TBK1, whereas Cxcl1 is induced independent of TBK1 and IKK-i in cDCs. When the cells were exposed to NDV, the induction of Ifnb gene was not impaired in IKK-i–/– and was only partially impaired in TBK1–/– cDCs (Fig. 1B). Nevertheless, TBK1–/–IKK-i–/– cDCs failed to induce Ifnb and Cxcl10, genes in response to NDV. The Cxcl1 gene was normally induced even in the absence of both TBK1 and IKK-i. The expression of the gene encoding NDV nucleoprotein was comparable between the cells examined, indicating the proper infection of NDV regardless of the absence of TBK1 and/or IKK-i (Fig. 1B and data not shown).


Figure 1
View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 1. Induction of IFN-inducible genes in cDCs lacking TBK1 and IKK-i in response to LPS and NDV. A, cDCs induced from TBK1+/–IKK-i+/–, TBK1–/–IKK-i+/–, TBK1+/–IKK-i–/–, and TBK1–/–IKK-i–/– embryos under TNF–/– background were stimulated with 100 ng/ml LPS for 2 or 4 h. B, cDCs described in A were exposed to NDV for 4 h. Total RNA was extracted, and mRNA levels for IFN-beta (Ifnb), IP-10 (Cxcl10), KC (Cxcl1), and NDV nucleoprotein were determined by Q-PCR.

 
Therefore, we further used DNA microarrays for analyzing gene expression profile after NDV stimulation comprehensively. NDV stimulation resulted in the up-regulation of 455 genes in TBK1+/–IKK-i+/– cDCs (Supplementary Table I).4 Hierarchical clustering revealed that NDV-inducible genes were divided into two clusters based on the dependence on TBK1 and IKK-i for their expression (Fig. 2A). Deficiency in IKK-i alone did not affect the induction of genes compared with control cDCs. Genes annotated as IFN-inducible appeared in the cluster containing genes that were not induced in the absence of TBK1 and IKK-i (cluster I). Nevertheless, a set of NDV-inducible genes were up-regulated even in TBK1–/–IKK-i–/– cDCs (cluster II). These genes include Cxcl1, Nfkbiz, Socs3, Tnfsf9, all of which are known to be activated by the transcription factor, NF-{kappa}B.


Figure 2
View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 2. The cluster images of NDV-inducible genes in cDCs lacking TBK1 and/or IKK-i. cDCs from embryos in indicated genotypes were infected with NDV for 8 h, and total RNA was prepared. The microarray analysis was performed as described in Materials and Methods, and 455 genes were selected as NDV-inducible genes based on the following definition: the MAS5.0 detection call was "Present" in at least one condition, and the robust multichip average expression value in TBK1+/–IKK-i+/– cDCs after NDV infection was higher than 5-fold compared with that in unstimulated cells. The genes were hierarchically clustered by Pearson correlation. The resulted heatmap and dendrogram are shown in A. A heatmap representation of change in expression of type I IFN genes in response to NDV stimulation is shown in B. C, mRNA levels for IFN-a2, -a5, and -a11 were determined by Q-PCR for the total RNA prepared in A.

 
It has been suggested by in vitro studies that TBK1 and IKK-i regulate different subtypes of IFN-{alpha} genes. Therefore, we investigated the expression of various IFN-{alpha} genes in response to NDV infection. As shown in Fig. 2B, there was no difference in the induction of various IFN-{alpha} genes between TBK1+/–IKK-i+/– and TBK1+/–IKK-i–/– cells. In contrast, TBK1–/–IKK-i+/– cells showed modest reduction in all IFN-{alpha} genes examined. Q-PCR analysis of IFN-a2, IFN-a5, and IFN-a11 genes further confirmed the result obtained by microarray analysis (Fig. 2C). This result indicates that both IKK-i and TBK1 control expression of various IFN-{alpha} genes, and there seems to be no specific regulation of IFN-{alpha} subtypes by either IKK-i or TBK1 in cDCs. Genes regulated by NF-{kappa}B are significantly up-regulated in response to NDV infection even in TBK1–/–IKK-i–/– cDCs.

Abrogated type I IFN production in TBK1–/–IKK-i–/– cDCs in response to various RNA viruses

We have recently shown that RIG-I and MDA5 are responsible for the recognition of different viruses; RIG-I detects various RNA viruses including paramyxoviruses, VSV, and Japanese encephalitis virus, whereas MDA5 specifically detects picornaviruses such as EMCV. To examine whether both RIG-I and MDA5 signal through TBK1 and IKK-i, we infected cDCs with increasing multiplicity of infection (moi) of RNA viruses, including NDV, influenza virus, VSV, and EMCV, and measured type I IFN production. As shown in Fig. 3A, TBK1+/–IKK-i+/– and TBK1+/–IKK-i–/– cDCs produced comparable amounts of IFN-{alpha} in response to various RNA viruses. In accordance with a previous report, infection of DCs with viruses induced production of IFN-{alpha} even in the absence of TBK1, although the production was significantly impaired (15). However, cDCs lacking both TBK1 and IKK-i did not produce any detectable amounts of IFN-beta or IFN-{alpha} in response to all viruses tested. Production of IFN-beta in response to the viruses was similarly regulated by TBK1 and IKK-i (Fig. 3B). Moreover, macrophages induced from fetal liver in the presence of M-CSF also produced type I IFNs in response to EMCV and VSV in a TBK1/IKK-i-dependent manner (Fig. 3C). These results indicate that TBK1 and IKK-i are essential for the IFN responses against viruses recognized by both RIG-I and MDA5.


Figure 3
View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 3. Production of type I IFNs RNA virus infection in cells lacking TBK1 and/or IKK-i. A and B, cDCs from embryos with indicated genotypes were infected with the indicated moi of NDV, VSV, influenza virus, or EMCV, or transfected with indicated concentrations of poly(I:C). IFN-{alpha} (A) or IFN-beta (B) production in the culture supernatants was measured by ELISA. C, M-CSF-induced fetal liver macrophages were infected with EMCV or VSV, and IFN-beta production was measured by ELISA. Error bars, ±SD between triplicates. The data shown are representative of three independent experiments.

 
TBK1 and IKK-i are critical for the activation of IRF-3 in cDCs in response to NDV

Next, we examined the activation of intracellular signaling pathways triggered in response to viral infection in cDCs. It has been shown that IRF-3 is phosphorylated, homodimerizes, and translocates into the nucleus in response to viral infection. Although NDV-induced dimerization of IRF-3 was induced in cDCs lacking either IKK-i or TBK1 as well as in control cells, the activation was abrogated in TBK1–/–IKK-i–/– cells (Fig. 4A). In contrast, degradation of I{kappa}B-{alpha} as well as I{kappa}B kinases in response to NDV infection was induced even in TBK1–/–IKK-i–/– cDCs, indicating that TBK1 and IKK-i are not requisite for NF-{kappa}B activation in accordance with previous reports (Fig. 4B).


Figure 4
View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 4. Activation of intracellular signaling molecules in cDCs lacking TBK1 and IKK-i. A, cDCs were exposed with NDV for the indicated periods. Cell lysates were prepared and subjected to native-PAGE. Monomeric and dimeric forms of IRF-3 were detected by Western blotting. B, cDCs were exposed with NDV for the indicated periods. Then cell lysates were prepared, and subjected to Western blotting using Abs against phospho-IKK{alpha}beta, IKKbeta, and I{kappa}B-{alpha}.

 
TBK1/IKK-i-independent IFN-{alpha} production in response to NDV in pDCs

Stimulation with TLR7 and TLR9 ligands recruits a complex composed of MyD88, IL-1R-associated kinase (IRAK)1, IRAK4, TRAF6, and IRF-7 to the receptor in pDCs. IRAK1 and IKK{alpha} have been implicated in the phosphorylation of IRF-7 in these cells. It has also been shown that recognition of RNA viruses has been shown to be mediated in a MyD88-dependent manner in pDCs. However, the contribution of TBK1 and IKK-i in the IFN response in pDCs is yet to be clarified. Therefore, we induced DCs from fetal livers in the presence of Fms-like tyrosine kinase 3 ligand (Flt3L). In fetal liver cell culture, Flt3L induced a similar population of B220+CD11c+ cells in all genotypes tested (data not shown), although the frequency of B220+CD11c+ cells was lower compared with those induced from bone marrow cells. When Flt3L-cultivated fetal liver cells were stimulated with A/D-type CpG-DNA, the production of IFN-{alpha} was comparable between cells from TBK1+/–IKK-i+/–, TBK1+/–IKK-i–/–, TBK1–/–IKK-i+/–, and TBK1–/–IKK-i–/– embryos (Fig. 5B). In addition, NDV-induced IFN-{alpha} production was also induced even in the absence of both TBK1 and IKK-i (Fig. 5A). TLR9-induced induction of IFN-a2, IFN-a4, IFN-a5, and IFN-a6 genes was also not altered between cells from control and TBK1–/–IKK-i–/– embryos (Fig. 5B). Of note, the amounts of IFN-{alpha} produced in Flt3L-induced fetal liver cells were lower than those produced from Flt3L-cultured bone marrow cells, implying that cells induced from fetal liver in the presence of Flt3L are less potent in producing IFN-{alpha}. Further studies are required to further confirm the role of TBK1 and IKK-i in pDCs in adult mice. Nevertheless, it is obvious that Flt3L-induced cells could produce IFN-{alpha} in a mechanism independent of TBK1 and IKK-i in response to a TLR9 ligand and to NDV exposure.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 5. TBK1/IKK-i-independent production of IFN-{alpha} in response to CpG-DNA and NDV in pDCs. A, Flt3L-induced DCs from embryos in indicated genotypes were stimulated with an A/D-type CpG oligonucleotide (D35) or exposed to indicated moi of NDV for 24 h. IFN-{alpha} production in the culture supernatants was measured by ELISA. Error bars, ±SD between triplicates. B, Flt3L-induced DCs were stimulated with a D35 for 4 h. mRNA levels for IFN-a2, IFN-a4, IFN-a5, and IFN-a6 were determined by Q-PCR.

 
In this study, we examined the responses of type I IFNs to viral infection in innate immune cells including cDCs, pDCs, and macrophages. Although cDCs lacking either TBK1 or IKK-i showed normal IFN responses against RNA virus infection, absence of both TBK1 and IKK-i disrupted production of type I IFNs. It has been shown that cytoplasmic viral detectors, RIG-I and MDA5, are responsible for the recognition of RNA viruses in most cells. Our results shown in this study indicate that TBK1 and IKK-i are prerequisite for the signaling of RIG-I/MDA5-dependent IFN-induction in addition to their role in the TLR signaling. In contrast, LPS exclusively signals through TBK1, but not IKK-i. LPS-induced TBK1 activation results in the up-regulation of IFN-beta, but not IFN-{alpha}, in cDCs and macrophages (Fig. 3 and data not shown). TLR4 was shown to signal through TRIF as an adaptor to activate IFN responses. It was also shown that IFN responses induced by LPS, but not by viruses, were diminished in IRF-3–/– mice (17). These observations suggest that TRIF-induced TBK1 activation leads to the activation of IRF-3-IFN-beta, but not the IRF-7-IFN-{alpha} pathway. However, RNA viruses, which activate cells via RIG-I/MDA5-dependent signaling, induced IFN-{alpha} and -beta production even in the absence of IKK-i, implying that TBK1 can phosphorylate IRF-7 when it is activated via RIG-I/MDA5 pathway. Further investigation will be required for disclosing the precise molecular mechanisms of TLR- or RIG-I/MDA5-dependent up-regulation of type I IFNs.

Recent in vitro studies suggested that IKK-i and TBK1 are differentially involved in the regulation of different IFN-{alpha} genes. For instance, it is shown that overexpression of IKK-i preferentially activated the IFN-{alpha}4 gene compared with the IFN-{alpha}11 gene (16). However, our study demonstrates that IKK-i and TBK1 do not regulate different genes, but redundantly control optimal IFN responses in response to RNA viruses.

TLR9-induced IFN-{alpha} production was observed even in the absence of both TBK1 and IKK-i, further supporting our previous observation that the activation of IRF-7 is mediated by phosphorylation probably through IRAK1 in pDCs (18). Therefore, deletion of both TBK1 and IKK-i clarified the cell type-specific involvement of these kinases in the regulation of type I IFNs and IFN-inducible genes. These kinases are prerequisite for RIG-I/MDA5- and TRIF-dependent pathways in cDCs, but not for the MyD88-dependent pathway in pDCs. Targeting these kinases will lead to the selective modulation of type I IFN pathways in various cells without affecting pDCs.


    Acknowledgments
 
We thank all colleagues in our laboratory, Drs. T. Abe, Y. Matsuura, and T. Fujita for viruses, M. Hashimoto for secretarial assistance, and Y. Fujiwara, M. Shiokawa, and N. Kitagaki for technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported, in part, by grants from the Ministry of Education, Culture, Sports, Science, and Technology in Japan, and from the 21st Century Center of Excellence Program of Japan. Back

2 Address correspondence and reprint requests to Dr. Shizuo Akira, Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail address: sakira{at}biken.osaka-u.ac.jp Back

3 Abbreviations used in this paper: RIG-I, retinoic acid-inducible protein-I; MDA5, melanoma differentiation-associated gene-5; CARD, comprised of caspase recruitment domain; VSV, vesicular stomatitis virus; EMCV, encephalomyocarditis virus; TRIF, TIR-domain-containing adaptor-inducing IFN-beta; TBK1, TANK-binding kinase 1; IKK-i, inducible I{kappa}B kinase; IRF, IFN-regulatory factor; pDC, plasmacytoid dendritic cell; cDC, conventional DC; NDV, Newcastle disease virus; Q-PCR, quantitative real-time PCR; moi, multiplicity of infection; IRAK, IL-1R-associated kinase; Flt3L, Fms-like tyrosine kinase 3 ligand. Back

4 The online version of this article contains supplemental material. Back

Received for publication May 22, 2006. Accepted for publication August 25, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Akira, S., S. Uematsu, O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783-801. [Medline]
  2. Alexopoulou, L., A. C. Holt, R. Medzhitov, R. A. Flavell. 2001. Recognition of double-stranded RNA and activation of NF-{kappa}B by Toll-like receptor 3. Nature 413: 732-738. [Medline]
  3. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5: 730-737. [Medline]
  4. Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Imaizumi, M. Miyagishi, K. Taira, E. Foy, Y. M. Loo, M. Gale, Jr, S. Akira, et al 2005. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J. Immunol. 175: 2851-2858. [Abstract/Free Full Text]
  5. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, et al 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441: 101-105. [Medline]
  6. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, O. Takeuchi, S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 6: 981-988. [Medline]
  7. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Bartenschlager, J. Tschopp. 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437: 1167-1172. [Medline]
  8. Seth, R. B., L. Sun, C. K. Ea, Z. J. Chen. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-{kappa}B and IRF 3. Cell 122: 669-682. [Medline]
  9. Xu, L. G., Y. Y. Wang, K. J. Han, L. Y. Li, Z. Zhai, H. B. Shu. 2005. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 19: 727-740. [Medline]
  10. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway. Science 301: 640-643. [Abstract/Free Full Text]
  11. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, T. Maniatis. 2003. IKK{epsilon} and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4: 491-496. [Medline]
  12. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, J. Hiscott. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300: 1148-1151. [Abstract/Free Full Text]
  13. Hemmi, H., O. Takeuchi, S. Sato, M. Yamamoto, T. Kaisho, H. Sanjo, T. Kawai, K. Hoshino, K. Takeda, S. Akira. 2004. The roles of two I{kappa}B kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection. J. Exp. Med. 199: 1641-1650. [Abstract/Free Full Text]
  14. McWhirter, S. M., K. A. Fitzgerald, J. Rosains, D. C. Rowe, D. T. Golenbock, T. Maniatis. 2004. IFN-regulatory factor 3-dependent gene expression is defective in Tbk1-deficient mouse embryonic fibroblasts. Proc. Natl. Acad. Sci. USA 101: 233-238. [Abstract/Free Full Text]
  15. Perry, A. K., E. K. Chow, J. B. Goodnough, W. C. Yeh, G. Cheng. 2004. Differential requirement for TANK-binding kinase-1 in type I interferon responses to Toll-like receptor activation and viral infection. J. Exp. Med. 199: 1651-1658. [Abstract/Free Full Text]
  16. Civas, A., P. Genin, P. Morin, R. Lin, J. Hiscott. 2006. Promoter organization of the interferon-A genes differentially affects virus-induced expression and responsiveness to TBK1 and IKK{epsilon}. J. Biol. Chem. 281: 4856-4866. [Abstract/Free Full Text]
  17. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida, T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434: 772-777. [Medline]
  18. Uematsu, S., S. Sato, M. Yamamoto, T. Hirotani, H. Kato, F. Takeshita, M. Matsuda, C. Coban, K. J. Ishii, T. Kawai, et al 2005. Interleukin-1 receptor-associated kinase-1 plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated interferon-{alpha} induction. J. Exp. Med. 201: 915-923. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
S. Paz, M. Vilasco, M. Arguello, Q. Sun, J. Lacoste, T. L.-A. Nguyen, T. Zhao, E. A. Shestakova, S. Zaari, A. Bibeau-Poirier, et al.
Ubiquitin-Regulated Recruitment of I{kappa}B Kinase {varepsilon} to the MAVS Interferon Signaling Adapter
Mol. Cell. Biol., June 15, 2009; 29(12): 3401 - 3412.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Kumagai, H. Kumar, S. Koyama, T. Kawai, O. Takeuchi, and S. Akira
Cutting Edge: TLR-Dependent Viral Recognition Along with Type I IFN Positive Feedback Signaling Masks the Requirement of Viral Replication for IFN-{alpha} Production in Plasmacytoid Dendritic Cells
J. Immunol., April 1, 2009; 182(7): 3960 - 3964.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. K. Miyahira, A. Shahangian, S. Hwang, R. Sun, and G. Cheng
TANK-Binding Kinase-1 Plays an Important Role during In Vitro and In Vivo Type I IFN Responses to DNA Virus Infections
J. Immunol., February 15, 2009; 182(4): 2248 - 2257.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. Y. Lee, Y. Kumagai, Y. Li, O. Takeuchi, H. Yoshida, J. Weinstein, E. S. Kellner, D. Nacionales, T. Barker, K. Kelly-Scumpia, et al.
TLR7-dependent and Fc{gamma}R-independent production of type I interferon in experimental mouse lupus
J. Exp. Med., December 22, 2008; 205(13): 2995 - 3006.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Deng, M. Shi, M. Han, J. Zhong, Z. Li, W. Li, Y. Hu, L. Yan, J. Wang, Y. He, et al.
Negative Regulation of Virus-triggered IFN-{beta} Signaling Pathway by Alternative Splicing of TBK1
J. Biol. Chem., December 19, 2008; 283(51): 35590 - 35597.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Sarkar, R. DeSalle, and P. B. Fisher
Evolution of MDA-5/RIG-I-dependent innate immunity: Independent evolution by domain grafting
PNAS, November 4, 2008; 105(44): 17040 - 17045.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. N. Kalali, G. Kollisch, J. Mages, T. Muller, S. Bauer, H. Wagner, J. Ring, R. Lang, M. Mempel, and M. Ollert
Double-Stranded RNA Induces an Antiviral Defense Status in Epidermal Keratinocytes through TLR3-, PKR-, and MDA5/RIG-I-Mediated Differential Signaling
J. Immunol., August 15, 2008; 181(4): 2694 - 2704.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhang, X. Wu, A. J. Lee, W. Jin, M. Chang, A. Wright, T. Imaizumi, and S.-C. Sun
Regulation of I{kappa}B Kinase-related Kinases and Antiviral Responses by Tumor Suppressor CYLD
J. Biol. Chem., July 4, 2008; 283(27): 18621 - 18626.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
S. L. Johnston
Innate Immunity in the Pathogenesis of Virus-induced Asthma Exacerbations
Proceedings of the ATS, July 1, 2007; 4(3): 267 - 270.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Uematsu and S. Akira
Toll-like Receptors and Type I Interferons
J. Biol. Chem., May 25, 2007; 282(21): 15319 - 15323.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsui, K.
Right arrow Articles by Akira, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsui, K.
Right arrow Articles by Akira, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS