The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aranami, T.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aranami, T.
Right arrow Articles by Yamamura, T.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Multiple Sclerosis
The Journal of Immunology, 2006, 177: 5659-5667.
Copyright © 2006 by The American Association of Immunologists, Inc.

Differential Expression of CD11c by Peripheral Blood NK Cells Reflects Temporal Activity of Multiple Sclerosis1

Toshimasa Aranami, Sachiko Miyake and Takashi Yamamura2

Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Multiple sclerosis (MS) is an autoimmune disease, showing a great degree of variance in temporal disease activity. We have recently demonstrated that peripheral blood NK cells biased for secreting IL-5 (NK2 bias) are associated with the remission state of MS. In this study, we report that MS patients in remission differentially express CD11c on NK cell surface (operationally defined as CD11chigh or CD11clow). When we compared CD11chigh or CD11clow patients, the expression of IL-5 and GATA-3 in NK cells supposed to endow a disease-protective NK2 phenotype was observed in CD11clow but not in CD11chigh patients. In contrast, the CD11chigh group showed a higher expression of HLA-DR on NK cells. In vitro studies demonstrated that NK cell stimulatory cytokines such as IL-15 would up-regulate CD11c expression on NK cells. Given previous evidence showing an association between an increased level of proinflammatory cytokines and temporal disease activity in MS, we postulate that inflammatory signals may play a role in inducing the CD11chigh NK cell phenotype. Follow-up of a new cohort of patients showed that 6 of 10 CD11chigh MS patients developed a clinical relapse within 120 days after evaluation, whereas only 2 of 13 CD11clow developed exacerbated disease (p = 0.003). As such, a higher expression of CD11c on NK cells may reflect the temporal activity of MS as well as a loss of regulatory NK2 phenotype, which may allow us to use it as a potential biomarker to monitor the immunological status of MS patients.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Multiple sclerosis (MS)3 is a chronic inflammatory disease of the CNS, in which autoreactive T cells targeting CNS Ags are presumed to play a pathogenic role (1). A large majority of the patients with MS (~70%), known as relapsing-remitting MS, would develop acute exacerbations of disease between intervals of remission. It is currently believed that relapses are caused by T cell- and Ab-mediated inflammatory reactions to the self-CNS components, and could be controlled at least to some degree by anti-inflammatory therapeutics, immunosuppressants, or plasma exchange.

The clinical course of MS varies greatly among individuals, implicating difficulties to predict the future of each patient. For example, patients who had been clinically inactive in the early stage of illness could abruptly change into active MS accompanying frequent relapses and progressive worsening of neurological conditions. There are a number of unpredictable matters in MS, including an interval between relapses, responsiveness to remedy and the prognosis in terms of neurological disability. To provide better quality of management of the patients, searches of appropriate biomarkers are currently being warranted (2).

We have recently shown that surface phenotype and cytokine secretion pattern of peripheral blood NK cells may reflect the disease activity of MS (3, 4). A combination of quantitative PCR and flow cytometry analysis has revealed that NK cells in clinical remission of MS are characterized by a higher frequency of CD95+ cells as well as a higher expression level of IL-5 than those of healthy subjects (HS) (3). As IL-5-producing NK cells, referred to as NK2 cells (5), could prohibit Th1 cell activation in vitro (3), we interpreted that the NK2 bias in MS may contribute to maintaining the remission state of MS. More recently, we have found that MS patients in remission can be further divided into CD95high and CD95low, according to the frequency of CD95+ cells among NK cells (4). Notably, memory T cells reactive to myelin basic protein, a major target Ag in MS, were increased in CD95high patients, compared with CD95low. Of note, CD95high NK cells exhibited an ability to actively suppress the autoimmune T cells, whereas those from CD95low patients did not. These results suggest that NK cells may accommodate their function and phenotype to properly counterregulate autoimmune T cells in the remission state of MS.

Recently, a distinct population of NK cells that express CD11c, a prototypical dendritic cell (DC) marker, was identified in mice (6, 7). As the CD11c+ NK cells exhibited both NK and DC functions, they are called as "bitypic NK/DC cells." CD11c associates with integrin CD18 to form CD11c/CD18 complex and is expressed on monocytes, granulocytes, DCs, and a subset of NK cells. Although precise functions are unclear, it has been reported that CD11c is involved in binding of iC3b (8), adhesion to stimulated endothelium (9) or phagocytosis of apoptotic cells (10). The initial purpose of this study was to evaluate CD11c expression and function of CD11c+ NK cells in MS in the line of our research to characterize NK cells in MS. On initiating study, we noticed that there was no significant difference between MS and HS in the frequency of CD11c+ NK cells. However, expression levels of CD11c were significantly higher in MS. We further noticed that up-regulation of CD11c is seen in some, but not all, patients with MS. So we have operationally classified MS into CD11clow and CD11chigh.

In this study, we demonstrate that IL-5, characteristic of NK2 cells (5), were significantly down-regulated in CD11chigh than CD11clow NK cells. In contrast, expression of HLA-DR class II molecule was up-regulated in CD11chigh NK cells. Notably, both CD11c and HLA-DR on NK cells were reproducibly induced in vitro in the presence of IL-15 (11) or combination of inflammatory cytokines, known to be increased in the blood of MS (12, 13, 14). Furthermore, we found that the remission state of CD11chigh is unstable in comparison to CD11clow, as judged by an increased number of the patients who exacerbated during the 120 days after examining NK cell phenotypes. These results suggest that the CD11chigh group of patients may be in more unstable condition than CD11clow, presenting with reduced regulatory functions of NK cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Subjects

Twenty-five patients with relapsing-remitting MS (15) (male (M)/female (F) = 8/17; age = 37.7 ± 11.1 (year old)) and 10 sex- and age-matched HS (M/F = 3/7; age = 39.9 ± 12.2 (year old)) were enrolled for studying NK cell phenotypes. All the patients were in the state of remission at examination as judged by magnetic resonance imaging scanning and clinical assessment. They had not been given immunosuppressive medications, or corticosteroid for at least 1 mo before examination. They had relatively mild neurological disability (expanded disability status scale <4) and could walk to the hospital without any assistance during remission. The same neurologist followed up the patients regularly (every 3–4 wk) and judged the occurrence of relapse by using magnetic resonance imaging and clinical examinations. Information on NK cell phenotype or other immunological parameters was never given to either the neurologist or the patients at the time of evaluation. To precisely determine the onset of relapse, patients were allowed to take examination within a few days after a new symptom appeared. Written informed consent was obtained from all the patients and the Ethics Committee of the National Center of Neuroscience (NCNP) approved the study.

Reagents

Mouse IgG1 isotype control-PE, anti-CD3-energy-coupled dye (ECD), anti-CD4-PE, anti-CD8-PC5, anti-CD56-PC5, anti-CD69-PE, and anti-HLA-DR-FITC mAbs were purchased from Immunotech. Anti-CD11c-PE and anti-CD95-FITC were purchased from BD Pharmingen. Recombinant human cytokines were purchased from PeproTech. AIM-V (Invitrogen Life Technologies) was used for cell culture after supplementing 2 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen Life Technologies).

Cell preparation and NK cell purification

PBMC were separated by density gradient centrifugation with Ficoll-Hypaque PLUS (Amersham Biosciences). To purify NK cells, PBMC were treated with NK isolation kit II (Miltenyi Biotec) twice, according to the manufacturer’s protocol. Briefly, PBMC were labeled with a mixture of biotin-conjugated mAbs reactive to non-NK cells and magnetic microbead-conjugated anti-biotin mAbs. The magnetically labeled non-NK cells were depleted with auto-MACS (Miltenyi Biotec) and this procedure always yielded >95% purity of NK cells when assessed by the proportions of CD3CD56+ cells with flow cytometry.

Flow cytometry

To evaluate the expression of CD11c, CD95, or other surface molecules on NK cells, PBMC were stained with anti-CD3-ECD, anti-CD56-PC5, and FITC- or PE-conjugated mAbs against molecules of our interest and were analyzed with EPICS flow cytometry (Beckman Coulter). Mean fluorescence intensity (MFI) of CD11c was measured on gated CD11c+ fraction or whole NK cells.

Stimulation of purified NK cells with proinflammatory cytokines

Purified NK cells (1 x 105/well) were stimulated in the presence or absence of IL-4, IL-8, IL-12, IL-15, IL-18, IL-23, TNF-{alpha}, and GM-CSF or combination of IL-12, IL-15, and IL-18 for 3 days. We analyzed CD11c expression after staining the cells with anti-CD11c-PE, anti-CD3-ECD, and anti-CD56-PC5. The concentration of IL-12 was at 10 ng/ml, and those of the other cytokines were at 100 ng/ml.

RT-PCR

Total RNA were extracted with a RNeasy Mini kit (Qiagen) from purified NK cells, and the cDNA were synthesized with Super Script III first strand systems (Invitrogen Life Technologies) according to the manufacturer’s protocol. For quantitative analysis of IL-5, IFN-{gamma}, GATA-3, and T-bet, the LightCycler quantitative PCR system (Roche Diagnostics) was used. Relative quantities of mRNA were evaluated after normalizing each expression levels with beta-actin expression. PCR primers used were as follows: beta-actin-sense, AGAGATGGCCACGGCTGCTT, and -antisense, ATTTGCGGTGGACGATGGAG; IFN-{gamma}-sense, CAGGTCATTCAGATGTAGCG, and -antisense, GCTTTTCGAAGTCATCTCG; IL-5-sense, GCACACTGGAGAGTCAAACT, and -antisense, CACTCGGTGTTCATTACACC; GATA-3-sense, CTACGGAAACTCGGTCAGG, and -antisense, CTGGTACTTGAGGCACTCTT; T-bet-sense, GGAGGACACCGACTAATTTGGGA, and -antisense, AAGCAAGACGCAGCACCAGGTAA.

Statistical analysis of remission rate

We set the first episode of relapse after blood sampling as an end point, although we followed clinical course of each patient for up to 120 days, regardless of whether they developed relapses. No patients developed second relapse during the 120 days. When the neurologist prescribed corticosteroids without knowing any information on the NK cell phenotype, the patient was considered as the dropout at that time point. Remission rate was calculated as Kaplan-Meier survival rate, and statistical difference between CD11clow and CD11chigh MS was evaluated with the log-rank test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
CD11c on NK cells is up-regulated in MS remission

First, we confirmed that PBMC from healthy individuals and MS contain CD11c+ NK cells (Fig. 1), which constitute a major population of whole NK cells. We then noticed that proportion of CD11c+ NK cells as well as its levels of expression greatly varied among individuals, particularly in MS. To examine this issue further, we systemically examined 25 MS patients in remission and 10 HS for NK cell expression of CD11c. Whereas 20–80% of NK cells are CD11c+ in HS (Fig. 1c), almost all NK cells were CD11c+ in some MS patients (Fig. 1, c and e). However, reflecting a great degree of variance, comparison between HS and MS did not reveal a significant difference (Fig. 1c). In contrast, when we measured the MFI of CD11c expression on CD11c+ NK cells, it was significantly higher in MS as compared with HS (Fig. 1a). This difference was also noticed when MFI of CD11c was measured for all the NK cell populations (Fig. 1b). It was interesting to know whether the levels of CD11c expression may correlate with NK cell functions. Therefore, we operationally divided the MS patients into CD11clow and CD11chigh subgroups (Fig. 1a), by setting the border as (the average + 2 x SD) of the values for HS.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. CD11c on NK cells is up-regulated in MS in remission. a, PBMC from HS (n = 10) and MS patients in remission (n = 25) were stained with anti-CD11c-PE, -CD3-ECD, and -CD56-PC5 mAb, and CD11c expression was measured on the CD11c+ fraction gated within whole NK cells (CD11c+CD3CD56+ cells) as mean fluorescence intensity (MFI). Each dot represents the data from individual patients. CD11chigh and CD11clow groups of patients are encircled as described in the text. b, In parallel, CD11c expression (MFI) was measured for the whole NK cells (CD3CD56+ cells), which yielded a similar result. c, The proportions of CD11c+ cells among whole NK cells are plotted. No significant difference was noted between HS and MS remission. d and e, Representative histogram patterns of CD11c on NK cells (closed histogram) from a single healthy subject (HS) (d) and a patient corresponding to CD11chigh MS (e). Open histograms represent isotype control staining. Values represent proportions of CD11c+ fraction (%) and MFI for CD11c+ cells. Mann-Whitney U test was used for statistical analysis. Horizontal bars indicate the mean values. *, p < 0.05; **, p < 0.01.

 
CD11chigh NK cells express HLA-DR more brightly than CD11clow NK cells

It was previously reported that infection with certain viruses would accompany up-regulation of CD11c on NK cells (16). This raises a possibility that the increased expression of CD11c in CD11chigh MS may reflect an activation state of NK cells caused by some sort of stimuli. To verify this hypothesis, we examined surface expression of cell activation markers (CD69 and HLA-DR). Although CD69, an early activation marker, was not detectable on NK cells (Fig. 2a), NK cells from MS, particularly CD11chigh MS, significantly overexpressed HLA-DR on surface (Fig. 2). Interestingly, HLA-DR expression was also up-regulated on CD4+ T cells from CD11chigh MS compared with those from HS (data not shown). These results indicate that NK cells and T cells are differentially activated in CD11chigh MS, CD11clow MS, and HS.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Proportions of HLA-DR+ NK cells increase in CD11chigh MS. a, CD69 and HLA-DR expression on NK cells (CD3 CD56+ cells). Data are expressed as proportions (percent) of CD69+ cells (7 HS and 16 MS patients in remission) or HLA-DR+ cells (10 HS and 25 MS patients) within whole NK cells. The Student t test was used for statistical analysis. Horizontal bars indicate the mean values. *, p < 0.05. b, Representative expression patterns of HLA-DR vs CD11c on NK cells from a healthy subject (left), CD11clow MS (middle), and CD11chigh MS (right).

 
Absence of NK2 bias in CD11chigh MS

We have previously reported that a higher level of IL-5 expression (NK2 bias) is one of the characteristics of NK cells of MS in remission (3). Although the mechanism for NK2 bias in MS remains to be further studied, up-regulation of GATA-3 has recently been reported in the induction of NK2 cells in mice (17). To explore the possible difference in the functions of CD11chigh and CD11clow NK cells, we isolated NK cells from CD11chigh or CD11clow group of patients and measured the mRNA levels of representative cytokines IFN-{gamma} and IL-5 as well as corresponding transcription factors T-bet and GATA-3. As shown in Fig. 3, mRNA expression of both IL-5 and GATA-3 was significantly higher in CD11clow MS compared with HS or CD11chigh MS, indicating that NK2 bias thought to be characteristic of MS remission is restricted to CD11clow MS. In contrast, there were no differences in mRNA expression of IFN-{gamma} and T-bet among these three groups. Because NK cells from CD11chigh patients expressed HLA-DR most brightly, we speculate that NK2 bias associated with CD11clow MS would attenuate when NK cells are further activated or differentiated.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. IL-5 and GATA-3 mRNA are increased in CD11clow but not in CD11chigh MS. Total RNAs were extracted from purified NK cells of HS (n = 8), CD11clow (n = 9), or CD11chigh MS (n = 8). mRNA expression of IL-5 (a), GATA-3 (b), IFN-{gamma} (c), and T-bet (d) was evaluated by quantitative PCR. The data are normalized to endogenous beta-actin expressions in the same samples. ANOVA was used for statistical analysis. Horizontal bars indicate the mean values. *, p < 0.05; **, p < 0.01.

 
NK cell stimulatory proinflammatory cytokines induce up-regulation of CD11c

We next attempted to explore the mechanism(s) for up-regulation of CD11c on NK cells in CD11chigh MS. Because both NK cells and CD4+ T cells overexpressed HLA-DR in CD11chigh, is it probable that immune signals influencing both innate and acquired immunity are operative. So we hypothesized that cytokine signals that have been implicated in the pathogenesis of MS may play a role. We cultured NK cells from HS in the presence or absence of cytokine(s) for 3 days, and evaluated the CD11c expression (MFI). We focused our attention to IL-12, IL-15, and IL-18, which are known to stimulate NK cells with or without help of other cytokines. Notably, they are reportedly elevated in the serum or blood lymphocytes of MS patients as compared with HS (11, 12, 13, 14, 18, 19), and prior studies suggest that they may play an important role in autoimmune diseases (20, 21, 22, 23, 24). As shown in Fig. 4, although IL-12 and IL-18 showed only a marginal effect on purified NK cells, IL-15 consistently induced 2- to 3-fold up-regulation of CD11c compared with control culture without addition of cytokines. As IL-12 and IL-18 were reported to synergistically work in various settings (25, 26), we then examined whether combinations of these cytokines may induce CD11c. Combination of IL-15 and IL-12 or of IL-15 and IL-18 did not augment the CD11c expression to the level higher than that could be induced by IL-15 alone. However, the combination of IL-12 and IL-18 did up-regulate CD11c on NK cells, which was comparable to the effect of IL-15 alone (Table I). Additionally, we tested the effects of several cytokines involved in differentiation of DC (TNF-{alpha}, GM-CSF, IL-4) (27), or known to up-regulate CD11c in granulocytes (IL-8) as controls (28) in the same assay. These cytokines showed no significant effect (Table I).


Figure 4
View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 4. CD11c expression on NK cells is up-regulated with addition of IL-15. a, Purified NK cells were cultured in the absence or presence of IL-12, IL-18, or IL-15. Three days later, the cells were stained with anti-CD11c-PE, -CD3-ECD, and -CD56-PC5 mAb. CD11c expression on NK cells (CD3CD56+ cells) is demonstrated as single histogram. Values indicate CD11c MFI of CD11c+ fractions. A representative of three independent experiments is shown. b, Data are expressed as mean fold increase of CD11c MFI (the MFI in the presence of cytokine/the MFI in the absence of cytokine) + SD from three independent experiments. ANOVA was used for statistical analysis. **, p < 0.01.

 

View this table:
[in this window]
[in a new window]
 
Table I. Effect of several cytokines on CD11c expression on NK cells

 
CD11chigh MS relapsed earlier

Given the significant difference in activation status and cytokine phenotype of NK cells as well as HLA-DR expression by CD4+ T cells, it was particularly interesting to know whether CD11clow and CD11chigh MS may follow a different clinical course. A new cohort of 13 CD11clow and 10 CD11chigh MS patients listed in Table II were followed for up to 120 days. In this preliminary exploration, we set the first episode of relapse after blood sampling as an end point. When the neurologist prescribed corticosteroids without knowing any information on the NK cell phenotype, the patient was considered as the dropout at that time point. Remission rate was calculated as Kaplan-Meier survival rate, and statistical difference between CD11clow and CD11chigh MS was evaluated with the log-rank test (Fig. 5a). At entry, there was no significant difference in the age and disease duration between CD11clow and CD11chigh MS (Table II). On analyzing the collected data after completing the study, we found that 8 patients developed a single relapse during the observation period and that the proportion of patients who have had relapse during the follow-up period was greatly higher in CD11chigh MS (6 of 10, 60%) than in CD11clow MS (2 of 13, 15.3%). Furthermore, the log-rank test revealed that CD11chigh MS relapsed significantly earlier than CD11clow MS (p = 0.003), suggesting a possible role of CD11c as a temporal marker for predicting relapse within months after examination. We also explored whether the difference between CD11chigh and CD11clow could be influenced by age or sex. When we selected a group of patients younger than 38.5 years old (the mean age of all the patients), a significantly earlier relapse in CD11chigh than CD11clow MS was confirmed in this group of patients (p = 0.0067, Fig. 5b). In the rest of the patients (<38.5 years old), the difference was less clear and not significant (p = 0.095). In female patients, CD11chigh MS relapsed significantly earlier than CD11clow MS (p = 0.035, Fig. 5c), whereas this tendency was not statistically significant in male patients (p = 0.083). By examining the patients’ medical records, we also found that the duration from the last relapse tended to be shorter in CD11chigh than CD11clow MS (14.7 ± 12 mo in CD11chigh vs 26.7 ± 24.3 mo in CD11clow) and that the mean number of relapses per year was higher in CD11chigh MS (0.9 ± 0.6 in CD11chigh vs 0.5 ± 0.5 in CD11clow). These are consistent with the postulate that CD11chigh MS might be immunologically more active than CD11clow MS (Table II).


View this table:
[in this window]
[in a new window]
 
Table II. Information on the patients whose clinical courses were followed for up to 120 days

 

Figure 5
View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 5. Rate of remission is lower in CD11chigh MS. The first episode of relapse after blood sampling was set as an end point and clinical course of each patient was followed for up to 120 days. The remission rate was calculated in all (a), the younger (b), or female (c) patients as Kaplan-Meier survival rate, and statistical difference between CD11clow and CD11chigh MS was evaluated with log-rank test at day 120. *, p < 0.05; **, p < 0.01.

 
Alteration of CD11c expression in the course of MS

We previously described that NK cells may lose NK2 phenotype during relapse (3). It is interesting to know whether the CD11c phenotype also changes in the course of MS. During the follow-up period of 120 days, 8 patients developed a relapse. We were able to take blood samples at relapse before treatment with corticosteroid and then compared the relapse samples with the samples obtained during remission at initiation of the study. As shown in Fig. 6, we saw an obvious tendency that the levels of CD11c expression would decline during relapse (p < 0.05). HLA-DR expression on NK cells was also reduced in some patients during relapse, but the difference between remission and relapse samples was not statistically significant.


Figure 6
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 6. Down-regulation of CD11c expression during relapse. a, Representative CD11c histograms from the same patient in remission (closed) and relapse (open). Values indicate CD11c MFI of CD11c+ fractions. b, Comparison of NK cells from remission and relapse from the same patients (n = 6). The data obtained from the same patients are connected with lines. Wilcoxon signed-ranks test was used for statistical analysis. *, p < 0.05.

 
Expression pattern of CD95 vs CD11c on NK cells in MS

In a previous study, we showed that MS patients could be divided into CD95high and CD95low according to the frequency of CD95+ cells among NK cells (4). Additionally, we examined whether expression of CD11c and CD95 may independently reflect the status of MS. We found no significant correlation between CD95 (%) and CD11c (MFI) on NK cells in MS (r = 0.29, p = 0.16 with Spearman’s correlation coefficient by rank test), indicating that expression of CD95 and CD11c on NK cells may be regulated independently. By setting the upper limits of CD95+ (%) and CD11c MFI as (the average + 2 x SD) of HS (CD95: 44.6%, CD11c: 5.04), we then examined whether there is a correlation between CD11c CD95 phenotype and clinical conditions (Fig. 7). Naturally, all the healthy subjects were plotted in the left lower quadrant (CD95lowCD11clow). In contrast, MS patients were plotted in all the four quadrants with differential proportions of patients who have no relapse during 120 days: CD95lowCD11clow; 3/3 (100%), CD95lowCD11chigh; 1/2 (50%), CD95highCD11clow; 8/10 (80%), CD95highCD11chigh; 2/7 (28.6%). Although the data for CD95low subjects (lower left and lower right) need to be omitted due to the limited sample size, we found that the difference between CD95highCD11clow and CD95highCD11chigh in remission rate was significant with log-rank test (p = 0.028). Provided that CD95high patients possessed an increased frequency of memory autoreactive T cells (4), this result is consistent with the idea that when comparable numbers of autoimmune T cells are present in the peripheral circulation, remission of MS is more stable in patients with CD11clow NK cells.


Figure 7
View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 7. Expression pattern of CD95 vs CD11c on NK cells from MS. PBMC from MS or HS were stained with CD95-FITC, CD11c-PE, CD3-ECD, and CD56-PC5. After determining the proportion of CD95+ cells among NK cells and CD11c expression (MFI) of CD11c, we plotted each patient according to the obtained values. Dotted lines represent the upper limits of CD95+ cell (percent) and CD11c MFI for HS as (the average + two times SD) of HS. •, HS; {diamond}, MS; {diamondsuit}, MS patients who relapsed during the 120 days follow-up period.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Blood examination of systemic autoimmune diseases such as systemic lupus erythematosus usually exhibits measurable abnormalities such as elevation of autoantibodies, which is useful for evaluating activity of disease. In contrast, patients with MS do not accompany such systemic abnormalities in laboratory tests except in unusual cases. It is currently recognized that autoreactive T cells might be activated and expanded to various degrees in the peripheral blood and peripheral lymphoid organs of MS even during remission (1, 2, 3, 4). In fact, our previous work suggests that a higher number of memory autoreactive T cells is linked with unstable disease course (4). If we are able to accurately evaluate the immune status of each patient with a relatively simple test, it should be most helpful in treatment and management of MS. In this line, it is currently of particular importance to identify measurable indicators which would serve as clinically appropriate biomarkers in MS (2).

This study has clarified for the first time to our knowledge that CD11c expression on peripheral NK cells is significantly up-regulated in a major proportion of patients with MS in remission. To obtain insights into the mechanism and the biological meaning of the NK cell expression of CD11c in autoimmune disease MS, we have attempted to clarify the difference between CD11chigh and CD11clow patients regarding phenotypes of NK cells, cytokine profile, and temporal clinical activity. We also explored which inflammatory cytokines might induce CD11c on NK cells. According to the NK cell expression of CD11c, we have classified the patients with MS in remission into CD11chigh and CD11clow. Most notably, NK2 phenotype characterized by predominant IL-5 production was seen in CD11clow patients, but not in CD11chigh. Consistently, the CD11chigh patients were found to be clinically more active than CD11clow as judged by the remission rate during the 120 days after examination. These results indicate that up-regulation of CD11c on NK cells would reflect the temporal disease activity and therefore could be used to identify patients who are likely to exacerbate within months. It has been reported that CD11c+ NK cells in mice could serve as APCs (6, 7). However, we could not reveal Ag presenting capacity of human CD11c+ NK cells (data not shown).

Regarding the mechanism of CD11c induction on NK cells, we have found that in CD11chigh patients, HLA-DR is concomitantly up-regulated with CD11c on NK cells (Fig. 2), which suggests that up-regulation of CD11c may represent an activation-induced change. After exploring the culture condition that may induce CD11c on NK cells, we have found that the addition of IL-15 or combination of IL-12 and IL-18 would increase the expression levels of CD11c on NK cells from healthy individuals. Because increased levels of these proinflammatory cytokines are detected in the blood samples of MS (11, 12, 13, 18, 19, 23), it is possible that in vitro CD11c induction on NK cells may recapitulate the phenotypic alteration of NK cells in CD11chigh patients. Interestingly, IL-18 is not only a cytokine able to facilitate IFN-{gamma} production by NK cells in cooperation with IL-12 (25, 26) but is crucial in inducing pathogenic autoimmune responses (21). Furthermore, autoimmune encephalitogenic T cells can induce more serious disease upon adoptive transfer when they are preactivated in the presence of IL-12 and IL-18 (20). Taken together, these results allow us to speculate that the proinflammatory cytokines may be involved in the up-regulation of CD11c on NK cells. Although the relationship between serum cytokine concentration and levels of CD11c expression on NK cells should be estimated in future studies, a previous work (11, 29, 30) showing that a probable link between IL-15 and temporal disease activity, indicates that NK cell expression of CD11c is likely to correlate with the levels of cytokines.

In the Th cell differentiation, specific transcription factors have been identified that play a crucial role in inducing Th1 or Th2 cells. Namely, Th1 differentiation characterized by IFN-{gamma} induction requires a transcription factor T-bet, whereas GATA-3 and c-maf act to promote Th2 cytokine production (31, 32, 33). Human NK cells cultured in the presence of IL-12 or IL-4 differentiate into NK1 or NK2 populations, reminiscent of Th1 and Th2 cells (5). Whereas NK1 cells produce IL-10 and IFN-{gamma}, NK2 cells would serve as immune regulators by producing IL-5 and IL-13. Notably, up-regulation of GATA-3 has been reported in mouse NK2 cells (17), raising a possibility that Th cells and NK cells might share the same transcription factor for inducing the key cytokine. We have previously reported that IL-5 expression is one of the characteristics of NK cells in the remission state of MS (3). However, it was not excluded that overexpression of IL-5 could be restricted to a proportion of the patients. Here, we have addressed whether NK cells from CD11chigh and CD11clow may differ with regard to expression levels of IFN-{gamma} and IL-5 and of their transcription factors T-bet and GATA-3. By measuring the mRNAs, we found that expression levels of IL-5 and GATA-3 are elevated in CD11clow MS but not in CD11chigh (Fig. 3). Furthermore, we showed that neither IFN-{gamma} nor T-bet was increased in CD11chigh MS. This suggests that NK cells from CD11clow are NK2-biased but those from CD11chigh are not, although MS in remission as a whole is NK2-biased as compared with control subjects. More recently, we have observed that stimulation with IL-15 or IL-12 plus IL-18 would decrease IL-5 and GATA-3 mRNA in purified NK cells with reciprocal up-regulation of CD11c (data not shown). This further supports a model that proinflammatory cytokines may play a crucial role in the absence of NK2 bias in CD11chigh MS.

To clarify the clinical differences between CD11chigh and CD11clow, we followed up the clinical course of the patients after blood sampling. Although there was no significant difference in clinical parameters at examination of NK cells, we have found that CD11chigh MS showed a significantly earlier relapse than CD11clow MS. This is consistent with our assumption that the absence of NK2 bias in CD11chigh MS should imply that regulatory NK cell functions are defective in this group of patients. When we reanalyzed the data regarding various clinical parameters, we found that an earlier relapse in CD11chigh than CD11clow MS is more remarkable in the younger group (<38.5 years old) or in female patients. Furthermore, the duration from the last relapse tended to be shorter and the mean number of relapses per year higher in CD11chigh MS, supporting that CD11chigh MS is more active than CD11clow MS.

When we analyzed expression of CD95 and CD11c on NK cells simultaneously, we found that MS patients in remission could be divided into four subgroups (Fig. 7). When we compared clinical course after examination of NK cell phenotypes, we found that CD95highCD11chigh MS relapsed significantly earlier than CD95highCD11clow MS (p = 0.028 with log-rank test). This result indicates that CD95highCD11chigh MS may be most unstable subgroup of MS, among the patients whose clinical state could be judged as being in clinical remission.

In this study, we have demonstrated that MS patients differentially express CD11c on peripheral blood NK cells and a higher expression of CD11c on NK cells may reflect the temporal disease activity as well as functional alteration of regulatory NK cells. Our results have a clinical implication because of a lack of appropriate biomarker to monitor the immunological status in MS at present. To verify the reliability of this marker, longitudinal examination of CD11c expression on NK cells in the same patients should be performed in the future study.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the Ministry of Health, Labor and Welfare of Japan and the Program for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation. Back

2 Address correspondence and reprint requests to Dr. Takashi Yamamura, Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan. E-mail address: yamamura{at}ncnp.go.jp Back

3 Abbreviations used in this paper: MS, multiple sclerosis; HS, healthy subject; DC, dendritic cell; MFI, mean fluorescence intensity; ECD, energy-coupled dye. Back

Received for publication May 3, 2006. Accepted for publication July 28, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Sospedra, M., R. Martin. 2005. Immunology of multiple sclerosis. Annu. Rev. Immunol. 23: 683-747. [Medline]
  2. Bielekova, B., R. Martin. 2004. Development of biomarkers in multiple sclerosis. Brain 127: 1463-1478. [Abstract/Free Full Text]
  3. Takahashi, K., S. Miyake, T. Kondo, K. Terao, M. Hatakenaka, S. Hashimoto, T. Yamamura. 2001. Natural killer type 2 bias in remission of multiple sclerosis. J. Clin. Invest. 107: R23-R29. [Medline]
  4. Takahashi, K., T. Aranami, M. Endoh, S. Miyake, T. Yamamura. 2004. The regulatory role of natural killer cells in multiple sclerosis. Brain 127: 1917-1927. [Abstract/Free Full Text]
  5. Peritt, D., S. Robertson, G. Gri, L. Showe, M. Aste-Amezaga, G. Trinchieri. 1998. Differentiation of human NK cells into NK1 and NK2 subsets. J. Immunol. 161: 5821-5824. [Abstract/Free Full Text]
  6. Homann, D., A. Jahreis, T. Wolfe, A. Hughes, B. Coon, M. J. van Stipdonk, K. R. Prilliman, S. P. Schoenberger, M. G. von Herrath. 2002. CD40L blockade prevents autoimmune diabetes by induction of bitypic NK/DC regulatory cells. Immunity 16: 403-415. [Medline]
  7. Pillarisetty, V. G., S. C. Katz, J. I. Bleier, A. B. Shah, R. P. Dematteo. 2005. Natural killer dendritic cells have both antigen presenting and lytic function and in response to CpG produce IFN-{gamma} via autocrine IL-12. J. Immunol. 174: 2612-2618. [Abstract/Free Full Text]
  8. Bilsland, C. A., M. S. Diamond, T. A. Springer. 1994. The leukocyte integrin p150,95 (CD11c/CD18) as a receptor for iC3b: activation by a heterologous beta subunit and localization of a ligand recognition site to the I domain. J. Immunol. 152: 4582-4589. [Abstract]
  9. Stacker, S. A., T. A. Springer. 1991. Leukocyte integrin P150,95 (CD11c/CD18) functions as an adhesion molecule binding to a counter-receptor on stimulated endothelium. J. Immunol. 146: 648-655. [Abstract]
  10. Morelli, A. E., A. T. Larregina, W. J. Shufesky, A. F. Zahorchak, A. J. Logar, G. D. Papworth, Z. Wang, S. C. Watkins, L. D. Falo, Jr, A. W. Thomson. 2003. Internalization of circulating apoptotic cells by splenic marginal zone dendritic cells: dependence on complement receptors and effect on cytokine production. Blood 101: 611-620. [Abstract/Free Full Text]
  11. Blanco-Jerez, C., J. F. Plaza, J. Masjuan, L. M. Orensanz, J. C. Alvarez-Cermeno. 2002. Increased levels of IL-15 mRNA in relapsing–remitting multiple sclerosis attacks. J. Neuroimmunol. 128: 90-94. [Medline]
  12. Huang, W. X., P. Huang, J. Hillert. 2004. Increased expression of caspase-1 and interleukin-18 in peripheral blood mononuclear cells in patients with multiple sclerosis. Mult. Scler. 10: 482-487. [Abstract/Free Full Text]
  13. Balashov, K. E., D. R. Smith, S. J. Khoury, D. A. Hafler, H. L. Weiner. 1997. Increased interleukin 12 production in progressive multiple sclerosis: induction by activated CD4+ T cells via CD40 ligand. Proc. Natl. Acad. Sci. USA 94: 599-603. [Abstract/Free Full Text]
  14. Karni, A., D. N. Koldzic, P. Bharanidharan, S. J. Khoury, H. L. Weiner. 2002. IL-18 is linked to raised IFN-{gamma} in multiple sclerosis and is induced by activated CD4+ T cells via CD40-CD40 ligand interactions. J. Neuroimmunol. 125: 134-140. [Medline]
  15. McDonald, W. I., A. Compston, G. Edan, D. Goodkin, H. P. Hartung, F. D. Lublin, H. F. McFarland, D. W. Paty, C. H. Polman, S. C. Reingold, et al 2001. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann. Neurol. 50: 121-127. [Medline]
  16. Lima, M., J. Almeida, M. dos Anjos Teixeira, M. L. Queiros, B. Justica, A. Orfao. 2002. The "ex vivo" patterns of CD2/CD7, CD57/CD11c, CD38/CD11b, CD45RA/CD45RO, and CD11a/HLA-DR expression identify acute/early and chronic/late NK-cell activation states. Blood Cells Mol. Dis. 28: 181-190. [Medline]
  17. Katsumoto, T., M. Kimura, M. Yamashita, H. Hosokawa, K. Hashimoto, A. Hasegawa, M. Omori, T. Miyamoto, M. Taniguchi, T. Nakayama. 2004. STAT6-dependent differentiation and production of IL-5 and IL-13 in murine NK2 cells. J. Immunol. 173: 4967-4975. [Abstract/Free Full Text]
  18. Nicoletti, F., R. Di Marco, K. Mangano, F. Patti, E. Reggio, A. Nicoletti, K. Bendtzen, A. Reggio. 2001. Increased serum levels of interleukin-18 in patients with multiple sclerosis. Neurology 57: 342-344. [Abstract/Free Full Text]
  19. Fassbender, K., A. Ragoschke, S. Rossol, A. Schwartz, O. Mielke, A. Paulig, M. Hennerici. 1998. Increased release of interleukin-12p40 in MS: association with intracerebral inflammation. Neurology 51: 753-758. [Abstract/Free Full Text]
  20. Ito, A., A. Matejuk, C. Hopke, H. Drought, J. Dwyer, A. Zamora, S. Subramanian, A. A. Vandenbark, H. Offner. 2003. Transfer of severe experimental autoimmune encephalomyelitis by IL-12- and IL-18-potentiated T cells is estrogen sensitive. J. Immunol. 170: 4802-4809. [Abstract/Free Full Text]
  21. Shi, F. D., K. Takeda, S. Akira, N. Sarvetnick, H. G. Ljunggren. 2000. IL-18 directs autoreactive T cells and promotes autodestruction in the central nervous system via induction of IFN-{gamma} by NK cells. J. Immunol. 165: 3099-3104. [Abstract/Free Full Text]
  22. Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, H. Okamura, K. Nakanishi, S. Akira. 1998. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8: 383-390. [Medline]
  23. Makhlouf, K., H. L. Weiner, S. J. Khoury. 2001. Increased percentage of IL-12+ monocytes in the blood correlates with the presence of active MRI lesions in MS. J. Neuroimmunol. 119: 145-149. [Medline]
  24. Waldmann, T. A.. 2004. Targeting the interleukin-15/interleukin-15 receptor system in inflammatory autoimmune diseases. Arthritis Res. Ther. 6: 174-177. [Medline]
  25. Fehniger, T. A., M. H. Shah, M. J. Turner, J. B. VanDeusen, S. P. Whitman, M. A. Cooper, K. Suzuki, M. Wechser, F. Goodsaid, M. A. Caligiuri. 1999. Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J. Immunol. 162: 4511-4520. [Abstract/Free Full Text]
  26. Okamura, H., S. Kashiwamura, H. Tsutsui, T. Yoshimoto, K. Nakanishi. 1998. Regulation of interferon-{gamma} production by IL-12 and IL-18. Curr. Opin. Immunol. 10: 259-264. [Medline]
  27. Young, J. W., P. Szabolcs, M. A. Moore. 1995. Identification of dendritic cell colony-forming units among normal human CD34+ bone marrow progenitors that are expanded by c-kit-ligand and yield pure dendritic cell colonies in the presence of granulocyte/macrophage colony-stimulating factor and tumor necrosis factor {alpha}. J. Exp. Med. 182: 1111-1119. [Abstract/Free Full Text]
  28. Detmers, P. A., S. K. Lo, E. Olsen-Egbert, A. Walz, M. Baggiolini, Z. A. Cohn. 1990. Neutrophil-activating protein 1/interleukin 8 stimulates the binding activity of the leukocyte adhesion receptor CD11b/CD18 on human neutrophils. J. Exp. Med. 171: 1155-1162. [Abstract/Free Full Text]
  29. Kivisakk, P., D. Matusevicius, B. He, M. Soderstrom, S. Fredrikson, H. Link. 1998. IL-15 mRNA expression is up-regulated in blood and cerebrospinal fluid mononuclear cells in multiple sclerosis (MS). Clin. Exp. Immunol. 111: 193-197. [Medline]
  30. Pashenkov, M., M. Mustafa, P. Kivisakk, H. Link. 1999. Levels of interleukin-15-expressing blood mononuclear cells are elevated in multiple sclerosis. Scand. J. Immunol. 50: 302-308. [Medline]
  31. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. 100: 655-669. [Medline]
  32. Szabo, S. J., B. M. Sullivan, C. Stemmann, A. R. Satoskar, B. P. Sleckman, L. H. Glimcher. 2002. Distinct effects of T-bet in TH1 lineage commitment and IFN-{gamma} production in CD4 and CD8 T cells. Science 295: 338-342. [Abstract/Free Full Text]
  33. Zheng, W., R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89: 587-596. [Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aranami, T.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aranami, T.
Right arrow Articles by Yamamura, T.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Multiple Sclerosis


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS