The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kolln, J.
Right arrow Articles by Qin, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kolln, J.
Right arrow Articles by Qin, Y.
The Journal of Immunology, 2006, 177: 5652-5658.
Copyright © 2006 by The American Association of Immunologists, Inc.

Triosephosphate Isomerase- and Glyceraldehyde-3-Phosphate Dehydrogenase-Reactive Autoantibodies in the Cerebrospinal Fluid of Patients with Multiple Sclerosis1

Johanna Kolln2,*, Hui-Min Ren2,*, Reng-Rong Da*, Yiping Zhang*, Edzard Spillner{ddagger}, Michael Olek*, Neal Hermanowicz*, Lutz G. Hilgenberg{dagger}, Martin A. Smith{dagger}, Stanley van den Noort* and Yufen Qin3,*

* Department of Neurology and {dagger} Department of Anatomy and Neurobiology, University of California, Irvine, CA 92697; and {ddagger} Department of Biochemistry and Molecular Biology, University of Hamburg, Hamburg, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Our previous results revealed that Igs in lesions and single chain variable fragment Abs (scFv-Abs) generated from clonal B cells in the cerebrospinal fluid (CSF) from patients with multiple sclerosis (MS) bind to axons in MS brains. To study the axonal Ags involved in MS, we identified the glycolytic enzymes, triosephosphate isomerase (TPI) and GAPDH, using Igs from the CSF and scFv-Abs generated from clonal B cells in the CSF and in lesions from MS patients. Elevated levels of CSF-Abs to TPI were observed in patients with MS (46%), clinically isolated syndrome (CIS) suggestive of MS (40%), other inflammatory neurological diseases (OIND; 29%), and other noninflammatory neurological diseases (ONIND; 31%). Levels of GAPDH-reactive Abs were elevated in MS patients (60%), in patients with CIS (10%), OIND (14%), and ONIND (8%). The coexistence of both autoantibodies was detected in 10 MS patients (29%), and 1 CIS patient (3%), but not in patients with OIND/ONIND. Two scFv-Abs generated from the CSF and from lesions of a MS brain showed immunoreactivity to TPI and GAPDH, respectively. The findings suggest that TPI and GAPDH may be candidate Ags for an autoimmune response to neurons and axons in MS.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Multiple sclerosis (MS),4 is a chronic disorder of the CNS that causes damage to myelin sheath and axons. The first clinical manifestation for most patients is a clinically isolated syndrome (CIS), involving the optic nerve, brainstem, or spinal cord (1, 2, 3). Eighty-five percent of CIS patients later develop relapsing-remitting MS and often change to secondary progressive MS. In the majority of MS patients, clonal expansion of B cells and oligoclonal Igs are present in the cerebrospinal fluid (CSF) (2, 3, 4, 5, 6, 7, 8, 9). Infiltration of T and B lymphocytes, monocytes, and deposition of Abs and complement are the hallmarks of immune pathology in MS lesions (10, 11, 12).

Although early studies demonstrated axonal degeneration in MS, it was believed that axonal loss was a secondary or bystander event of inflammatory demyelination in chronic MS lesions. Recently, we showed specific binding of the single chain variable fragment Abs (scFv-Abs) from clonally expanded CSF B cells to axons in active MS lesions. The scFv-positive axons showed pathological changes, including axonal swelling, ovoid formations in adjacent normal appearing white matter (NAWM), and Wallerian degeneration in active lesions (13). Furthermore, we confirmed these findings by showing that Igs in MS brains attach to axons in active lesions and in adjacent NAWM using double immunofluorescence staining (14). However, the Ags underlying axon reactive autoimmune responses remain unknown.

In this study, we identified two Ags, triosephosphate isomerase (TPI) and GAPDH, from brain protein extracts using Igs from the CSF of MS patients. TPI- and GAPDH-reactive Abs in the CNS of MS patients were examined by Igs in the CSF of patients with MS, CIS, OIND or ONIND and of scFvs generated from clonally expanded B cells in the CSF and in MS lesions to these Ags. Our results suggest that TPI and GAPDH, both glycolytic enzymes, may contribute to the pathogenesis of MS.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Patients

CSF and serum samples were obtained from 35 clinically confirmed MS, 30 patients with CIS suggestive of MS, 21 patients with other inflammatory neurological diseases (OIND), and 49 patients with other noninflammatory neurological diseases (ONIND). MS patients included 24 females and 11 males with clinically or laboratory-supported definite MS diagnosis (1) with a mean age of 42 ± 11 years. CIS patients consisted of 20 females and 10 males with a mean age of 34 ± 10 years, OIND patients included 11 females and 10 males with a mean age of 48 ± 15 years with diagnosis of Guillain-Barré syndrome (4), meningitis (3), vasculitis (2), encephalitis (1), or strong evidence of inflammation in patients with pseudotumor cerebri (4), migraine (2), normal pressure hydrocephalus (2), neuropathy (2), or headache (1), such as presence of oligoclonal bands or elevated IgG index or elevated cell numbers. ONIND patients included 29 females and 10 males with a mean age of 41 ± 14 years with diagnosis of noninflammatory neuropathy (9), amyotrophic lateral sclerosis (4), pseudotumor cerebri (9), myelopathy (4), migraine (4), and headache (9) and no evidence of inflammatory disease. Healthy patients included 3 females and 7 males with a mean age of 39 ± 8 years. Laboratory data of CSF analysis (oligoclonal band and IgG index) of the patients are listed in Table I. Frozen specimens from postmortem brains were obtained from the Neurospecimen Bank at the Neurology Service, Veterans Affairs Greater and Los Angeles Healthcare System, University of California (Los Angeles, CA). The study was approved by the institutional review boards of School of Medicine, University of California (Irvine, CA).


View this table:
[in this window]
[in a new window]
  		Table I. Summary of clinical and laboratory information

 
Proteins

GAPDH from human erythrocytes was purchased from Sigma-Aldrich. The human TPI-1 gene was amplified from the American Type Culture Collection clone MGC-16683 via PCR using the primers STPI (CCGGCCATGGCCGCGCCCTCCAGGAAGTTCTTC) and ASTPI (GATGTGCGGCCGCTTGTTT GGCATTGATGATGTCCAC) at 50°C. The fragment was inserted into the vector pET20b(+) and expressed as described for the scFv-Abs.

Extraction of cerebral protein

Postmortem brain tissue specimens from normal human brain and from a patient with MS used for protein extraction were obtained from the Neurospecimen Bank as described. The MS patient is a 49-year-old female with definite MS. The normal human brain derived from a 50-year-old female without neuropathological findings. The tissue samples were homogenized with PBS containing protease inhibitors (Complete Protease Inhibitors; Boehringer Mannheim), and the homogenates were centrifuged at 2000 x g for 5 min at 4°C. The supernatants were centrifuged again at 14,000 x g for 10 min at 4°C, and the protein concentration in the supernatants was determined using protein assay reagent (Bio-Rad).

Purification and biotinylation of Igs from CSF

Igs were concentrated by CBind L matrix (Sigma-Aldrich) and concentrated Igs were biotinylated with biotinamidocaproate N-hydroxysuccinimide ester (Sigma-Aldrich) as recommended by the manufacturer.

Western blots using CSF

Human brain protein extracts (15–20 µg per lane) or purified TPI and GAPDH (1–2 µg per lane) was separated on a 10–15% SDS-PAGE, and then transferred to nitrocellulose membrane. After blocking (10% milk powder in PBS), the membrane strips were incubated with biotinylated IgG purified from CSF (1:1 in 1.5% BSA/PBS) or CSF, for 3 h. For detection using biotinylated Abs, the strips were washed with PBS, incubated with streptavidin-HRP for 1 h at room temperature (RT), washed again, and finally developed with Opti-4CN (Bio-Rad). For detection using CSF, the strips were washed with PBS, incubated with goat anti-human IgG-, IgM-, and IgA-HRP (Sigma-Aldrich) for 1.5 h at RT, washed again, and developed.

Purification and sequencing of 27/37-kDa proteins

Protein extract from brain (40 µg per lane) was separated on a 10% native PAGE, stained with imidazole-ZnSO4 as described (15) or transferred to nitrocellulose membrane, and candidate Ags were detected using biotinylated Igs. Subsequently, the candidate Ags were cut out of the gel and reduced using pestle and mortar. Recovered proteins were subjected to a second round of purification by separation on a 10% SDS-PAGE and detected with Coomassie or transferred to nitrocellulose and detected by biotinylated Igs from CSF. The candidate Ags were cut out of the gel and subjected to liquid chromatography/mass spectrometry with tandem mass spectrometry by Proteomics Core Facility, University of Southern California, School of Pharmacy (Los Angeles, CA).

ELISA

F-Plates (Nunc) were coated with 500 ng of purified TPI or GAPDH in PBS overnight at 4°C. After coating, wells were washed with PBS containing 0.05% Tween 20 and blocked with 3% BSA in PBS for 2 h at RT. After incubation of 35 µl of CSF or serum (1:200 in PBS) at RT for 180 min, bound Abs were detected with goat anti-human IgG-, IgM-, and IgA-HRP for 1.5 h at RT (1:1000 in 1.5% BSA in PBS). After addition of ABTS substrate solution (Bio-Rad) and development for 10 min, the absorbance for each well was determined at 450 nm. The isotype of the Abs were determined using the identical conditions, except the incubation with HRP-conjugated goat anti-human IgG, IgA, or IgM (Sigma-Aldrich) for 1.5 h at RT. Student’s t test was used to analyze the obtained data. Significance was assigned at p < 0.05. Values >2 SD above the controls without Ag or without CSF were considered to be positive.

PCR amplification of Ig-VH genes from the MS plaques

Total RNA was extracted from frozen postmortem brain specimens (average size, 100 x 100 x 2 mm) and CSF mononuclear cells from a patient with pseudotumor cerebri served as controls for polyclonal B cells (16) using an RNeasy kit (Qiagen). First-strand cDNA was synthesized using oligo-dT as primer and avian myeloblastosis virus reverse transcriptase in a total value of 40 µl. VH of IgA genes were amplified via PCR in a final volume of 50 µl of reaction buffer (50 mM Tris-HCl (pH 9.0) at 25°C: 20 mM (NH4)2SO4; 3.0 mM MgCl2) containing 10 µl of cDNA from each sample, 2 U of recombinant Taq Polymerase, and 50 pmol of primers. PCR was conducted for 40 cycles with a mixture of six 5' VH family-specific leader primers plus IgA C{alpha}-specific primers (14) or VL and JL primers for VL gene (13). PCR was conducted for 35 cycles under standard conditions (denature, 1 min at 94°C; annealing, 2 min at 52–56°C; extension, 1 min at 72°C). A nested PCR was performed with six 5' VH or VL family-specific leader primers and 3' JH or JL primers (14, 17) in the condition as above described. Aliquots of the PCR product were analyzed by electrophoresis in a 2% agarose gel.

Sequencing Ig VH and VL genes

PCR products were recovered and ligated into the pGEM T vector (Promega) and used to transform Escherichia coli DH5a. Power sample size estimation with nQuery software showed that if identical B cell clones are considered to be 80% random selected sequences and the negative control is 0%, i.e., no identical clones detected, seven sequences of each plaque would provide 85% power by the Fisher exact test of equal portions with a value of p of 0.05, two-sided significance. Therefore, we randomly sequenced 8–18 colonies to determine the clonality of IgA+ B cell of each sample. These colonies were picked at random and grown overnight in 3 ml of Luria-Bertani medium. The dsDNA template from the colonies containing VH and VL gene inserts were sequenced using a DNA sequencer (ABI-Prism).

ScFv construction and expression

To generate the scFv, the dominant clonally expanded VH and VL genes from IgA-positive cells from MS plaques were amplified by PCR to generate a glycin-serin linker between the variable chains using the primers SvH1 (CTCGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCT), ASvH2 (CGATCCGCCGCCACCCGACCCACCACCGCCCGAGCCACCGCCACCTGAGCAGACGGTGACCAGGGTCCCTTGGCCCCAG), and SvL3 (GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCGGAAATTGTGTTGACACAGTCT), ASvL4 (GATGTGCGGCCGCACGTTTGATCTCCACCTTGGT). After joining the fragments, the resulting continuous cDNA fragments were inserted into the vector pET20b(+) (Novagen) via the restriction sites NotI and NcoI and verified by sequencing. The CSF-scFv gene was amplified using the primers SvH1, ASvL5 (GATGTGCGGCCGCACGTTTGATCTCCAGTTTGGT), and inserted into the pET20b(+) vector in identical manner. As a control, a described scFv directed to human complement 3 (hC3–22) was selected (18). Periplasmic expression in BL21DE3 cells and purification was performed as described (18). The scFvs were biotinylated with biotinamidocaproate N-hydroxysuccinimide ester (Sigma-Aldrich) as recommended by the manufacturer. Western blots using biotinylated scFv (1:5 in 1.5% BSA/PBS) were performed as described above for Western blots using biotinylated CSF-Abs.

Other methods

SDS-PAGE as well as standard procedures in molecular biology were performed according to established protocols (19).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Identification of MS candidate Ags

To identify Ags recognized by Abs in the CSF of MS, immunoblots of normal and MS brain extracts were probed with CSF Igs from patients with MS. The result revealed CSF Igs from MS patients bound specifically to different proteins, including 27-kDa and 37-kDa proteins from normal and MS brain extracts. A representative pattern of the reactivity of MS patients is shown (Fig. 1A). In this study, the 27- and 37-kDa proteins were isolated by separation on a native PAGE and a second round of purification by separation on a SDS-PAGE and stained with Coomassie (Fig. 1B). The immunoreactivity of these two proteins was confirmed by Western blot using purified biotinylated Igs from the CSF of MS patient (Fig. 1B). Using liquid chromatography mass spectrometry-mass spectrometry, these 27- and 37-kDa proteins were identified as TPI (27 kDa) and GAPDH (37 kDa), respectively.


Figure 1
View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 1. Identification of MS candidate Ags. A, Protein extract from normal brain (N, lanes 1, 3, and 5) and MS brain (MS, lanes 2, 4, and 6) were separated by 10% SDS-PAGE and stained with Ponceau S (lanes 1 and 2) and analyzed by Western blot (WB) using biotinylated Igs from CSF of representative MS patient (lanes 3 and 4), and without CSF Igs (lanes 5 and 6). B, Protein extract from normal brain was separated by 10% PAGE. Candidate Ags were cut out and separated by 10% SDS-PAGE and stained with Coomassie blue (CB) (lanes 1 and 2). The 27-kDa and 37-kDa proteins were probed with biotinylated Igs from CSF of a MS patient (lanes 3 and 4).

 
Detection of TPI- and GAPDH-reactive Abs in the CSF of patients with MS, CIS, OIND, and ONIND

To investigate TPI- and GAPDH-reactive Abs in the CSF of patients with MS, TPI protein was expressed using DNA recombination technique (Fig. 2A). The presence of TPI- and GAPDH-reactive Abs in the CSF was investigated in 15 MS patients using Western blot. Three patterns of immunoreactivity were observed, including GAPDH immunoreactivity alone (Fig. 2B, lanes 3 and 4), coimmunoreactivity of TPI and GAPDH (Fig. 2B, lanes 5 and 6), and TPI immunoreactivity alone (Fig. 2B, lanes 7 and 8).


Figure 2
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 2. TPI- and GAPDH-reactive Abs in the CSF of MS patients. A, Purified recombinant TPI was separated by 15% SDS-PAGE, stained with Coomassie blue (CB) (lane 1) or analyzed by Western blot (WB) using anti-His-tag Ab (lane 2). B, Purified recombinant TPI (lanes 1, 3, 5, 7, and 9) and GAPDH (lanes 2, 4, 6, 8, and 10) were separated by 17% SDS-PAGE, stained with Coomassie blue (lanes 1 and 2) or analyzed by Western blot using CSF samples from MS patients (lanes 3 and 4 (case 1); lanes 5 and 6 (case 2); lanes 7 and 8 (case 3)) and a negative control without CSF (lanes 9 and 10). Anti-human IgG-, IgA-, and IgM-HRP conjugates were used for detection.

 
To investigate whether TPI and GAPDH immunoreactivity is MS specific, TPI- and GAPDH-reactive Abs in the CSF of 125 patients were examined by ELISA. Values >2SD above the paired control without Ag or without CSF were considered to be elevated levels of CSF Abs to TPI or GAPDH. Elevated levels of CSF Abs to TPI were found in 12 of 30 CIS patients (40%), in 16 of 35 MS patients (46%), in 6 of 21 OIND patients (29%), and in 12 of 39 ONIND patients (31%) (Fig. 3). Student’s t test showed no significant difference in TPI immunoreactivity between MS and CIS (p = 0.19) or MS and OIND/ONIND (p = 0.09/0.07). Elevated levels of CSF Abs to GADPH were detected in 21 of 35 MS patients (60%), but only in 3 of 30 CIS patients (10%), 3 of 21 OIND patients (14%), and 3 of 39 ONIND patients (8%). The difference in GAPDH-reactive Abs in the CSF of MS patients compared with CIS, OIND, and ONIND patients is statistically significant with p values of 1 x 10–6, 6 x 10–6, and 2 x 10–6.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 3. TPI and GAPDH immunoreactivity in the CSF of patients with MS, CIS, OIND, and ONIND. The immunoreactivity in 30 CSF samples of CIS patients, 35 CSF samples of MS patients, 21 samples of OIND patients, and 39 samples of ONIND patients to TPI or GAPDH was analyzed by ELISA. Detection was performed using anti-human IgG-, IgA-, and IgM-HRP conjugates. Data represent the mean values obtained from three independent determinations. Mean values for each group are shown as lines. The line represents the cut-off level at the mean + 2 SD of the controls.

 
Coexistence of TPI- and GAPDH-reactive Abs in the CSF was analyzed. Elevated levels of CSF Abs to TPI and to GAPDH were observed primarily in the CSF of MS patients (29%) and in one CIS patient (3%), but not in the CSF of patients with OIND or ONIND, suggesting the coexistence of CSF Abs to TPI and GAPDH is MS specific (Table II).


View this table:
[in this window]
[in a new window]
  		Table II. Clinical data between anti-GAPDH- and anti-TPI-positive patients with CIS, MS, OIND, and ONIND

 
Ig isotype of TPI- and GAPDH-reactive Abs was analyzed by ELISA using HRP-conjugated IgG, IgA, and IgM. IgG isotype of TPI-reactive Abs were detected in the CSF of CIS patients (33%), MS patients (38%), OIND patients (29%), and ONIND patients (31%; Table III). IgA isotype of TPI-reactive Abs was detected in the CSF of MS patients (6%), OIND patients (14%), and ONIND patients (10%). IgM isotype of TPI-reactive Abs was detected in the CSF of MS patients (14%) and OIND patients (5%). IgG isotype of GAPDH-reactive Abs was detected in the CSF of CIS patients (13%), MS patients (60%), OIND patients (14%), and ONIND patients (10%). IgA isotype of GAPDH-reactive Abs was detected in the CSF of MS patients (20%) and OIND/ONIND patients (5/3%), whereas no IgM isotype was observed within GAPDH-reactive Abs. The results showed that most TPI- and GAPDH-reactive Abs are IgG isotype. However, there is an increase in IgA isotype of GAPDH Abs in MS patients.


View this table:
[in this window]
[in a new window]
  		Table III. Immunoreactivity of Ig isotypes of CSF samples to TPI and GAPDH

 
Detection of TPI- and GAPDH-reactive Abs in sera

TPI- and GAPDH-reactive Abs in serum and in the CSF from individual patients were analyzed. Elevated levels of TPI-reactive Abs were detected in sera (50%) and in CSF (40%) from CIS patients, in sera (70%) and in CSF (40%) of MS patients, and in sera (70%) and in CSF (30%) of OIND/ONIND patients, as well as in the sera (50%) of healthy control patients (Table IV). Elevated levels of GAPDH-reactive Abs were detected in sera (70%) and in CSF (60%) from MS patients and in sera (50%) and in CSF (10%) of patients with CIS or OIND/ONIND, respectively. GAPDH-reactive Abs were detected in sera (40%) of healthy control patients. The results showed elevated levels of TPI- or GAPDH-reactive Abs in the serum of a majority of patients including patients with MS, CIS, OIND/ONIND, and healthy controls, suggesting that elevated levels of TPI- and GAPDH-reactive Abs in serum are not MS specific. To investigate whether the autoantibodies are intrathecally produced, CSF and sera of MS and OIND/ONIND patients were adjusted to the same IgG concentrations, and the TPI- and GAPDH-Ab titers were determined by ELISA. Ab indices were calculated according to the Reiber’s formula (ODCSF/ODserum). Intrathecal synthesis was assumed with an Ab index >1.4 (20, 21, 22). In most MS patients, higher Ab indices (>1.4) against TPI and GAPDH were detected, both with a mean of 1.6. In one OIND patient, the Ab index was 1.41 for TPI-specific Abs, but none of the OIND/ONIND patients showed Ab indices >1.4 for GAPDH-specific Abs. The GAPDH Ab indices in MS patients are significantly higher than in OIND/ONIND patients with p = 0.02, whereas there is no significance for TPI-specific Ab indices in MS patients (p = 0.3). These data suggest intrathecally synthesized GAPDH-reactive Abs in MS.


View this table:
[in this window]
[in a new window]
  		Table IV. Comparison of elevated levels of TPI- and GAPDH-reactive Abs in CSF and serum in CIS, MS, and OIND/ONIND patients, and healthy controls

 
Clonal expansion of TPI- and GAPDH-reactive B cells in the CSF and in lesion of MS

To study whether TPI and GAPDH drive clonal expansion of B cells in the CNS of MS patients, we generated axonal reactive scFv-Abs by assembling Ig-VH-VL genes from clonal B cells in a CSF of patients with CIS (13) and from IgA-positive B cells in MS plaques from an MS brain (14). The Ig VH and VL genes of plaques from this MS brain were analyzed by RT-PCR and sequenced. The dominant clonally expanded genes of clonal Ig-VH-VL were assembled to form a scFv gene. Fig. 4 shows the deduced amino acid sequences of the CSF-scFv (13, case 1) and lesion-scFv (GenBank accession no. DQ826419). ScFv genes were ligated into pET20b(+) vector and expressed in BL21DE3 cells. As a control, an scFv against human C3 was expressed in BL21DE3 cells (15). All scFv fragments were purified using Talon matrices (Fig. 5). The recombinant biotinylated CSF-scFv, lesion-scFv, and the control scFv were used to detect TPI and GAPDH by Western blot (Fig. 6). The immunoreactivity of TPI and GAPDH was demonstrated by probing with CSF scFv-Ab and lesion scFv-Ab, respectively. Western blot with the control scFv was negative. The result suggests that TPI and GAPDH may drive B cell clonal expansion in the CNS of MS patients.


Figure 4
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 4. Sequence analysis of scFv. VH-linker-VL gene-encoded amino acid sequences of the CSF-scFv and the lesion-scFv. FR, Framework region.

 

Figure 5
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 5. Purification of recombinant scFv. Purified recombinant CSF-scFv (lane 1), lesion-scFv (lane 2), and control scFv (lane 3) were separated by 12% SDS-PAGE and stained with Coomassie. CB, Coomassie blue.

 

Figure 6
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 6. Immunoreactivity of the scFv to TPI and GAPDH. GAPDH (lanes 1, 3, 5, and 7) and TPI (lanes 2, 4, 6, and 8) were separated by 15% SDS-PAGE and stained with Coomassie blue (CB) (lanes 1 and 2). Western blot (WB) was performed using biotinylated CSF-scFv (lanes 3 and 4), biotinylated lesion-scFv (lanes 5 and 6), and biotinylated control scFv (lanes 7 and 8). Streptavidin-HRP conjugate was used for detection.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Using native PAGE followed by separation on a SDS-PAGE, and liquid chromatography/mass spectrometry, we have identified TPI and GAPDH as potential Ags in MS. TPI and GAPDH, as glycolytic enzymes, are involved in energy production in the cytoplasm of neurons and considered to be associated with microtubules in the neurons (23, 24). Direct binding of Abs and scFv-Abs from the CSF and lesions of MS brain to TPI and GAPDH suggests that these Abs may play a role in the pathogenesis of neuronal and axonal damage in MS. Our findings provide a new opportunity to study the role of autoimmune response toward glycolytic enzymes, TPI and GAPDH, in the pathogenesis of neuronal and axonal damage in MS.

Although early findings showed neuronal degeneration in MS (25, 26), MS has been considered as a chronic demyelinating disease of the CNS that predominantly affects myelin sheath. Recently, immunocytochemical staining for amyloid precursor protein (beta-APP) and nonphosphorylated neurofilament (SMI-32) as well as imaging studies have provided support for axonal damage in the CNS of MS and its correlation with functional consequences (27, 28, 29). Our previous reports have shown that scFv-Abs generated from Ig-VH-VL genes expressed by clonal CSF B cells bind to axons in MS lesions (13). Using double immunofluorescence staining, we have demonstrated that lesion-derived Igs localized on axons. Ig-positive axons in both active MS lesion and adjacent NAWM demonstrated pathological changes (14). However, the Ags underlying axon loss and demyelination remain unknown.

In this study, we show that there are elevated levels of TPI- and GAPDH-reactive Abs in the CSF of patients with MS and CIS. Particularly, GAPDH-reactive Abs or the coexistence of TPI- and GAPDH-reactive Abs was primarily found in the CSF of patients with MS. When we compared TPI- and GAPDH-reactive Abs in the CSF and in serum, we find the presence of Abs to TPI and GAPDH in serum of a majority of patients in all four studied groups. In contrast, the increase of elevated anti-GAPDH Ig levels was 3- to 6-fold higher in the CSF of patients with MS (60%) compared with either CIS (10%) or OIND/ONIND (14/8%) patients. To investigate intrathecal synthesis of TPI- and GAPDH-reactive Abs, we compared the IgG reactivity to GAPDH in paired CSF and serum samples. We found significantly higher Ab titers in CSF of MS patients than of OIND/ONIND patients, suggesting intrathecal synthesis of GAPDH-specific Abs in MS. Additionally, the CSF-scFv and lesion-scFv Abs showed immunoreactivity to TPI and GAPDH, respectively, implicating an immune process that TPI or GAPDH drive B cell clonal expansion in the CNS of MS. Our previous findings have demonstrated specific binding of CSF-scFv to axons in lesions and in adjacent NAWM (13). Meanwhile, double immunofluorescence staining reveals that Igs in MS brain localize to the cytoplasm of axons in lesions and adjacent NAWM. Both CSF-scFv-Ab-positive and lesion Ab-positive axons demonstrated pathological changes, including axon swellings, fragmentation, Wallerian degeneration, neuronal destruction and loss. These exposed cytoplasmic proteins, including TPI and GAPDH, may recruit infiltration of B cells and plasma cells. The Abs secreted by these plasma cells can attack these proteins through damaged axon terminals. Together, these findings suggest that TPI and GAPDH may be important Ags in MS, which may induce axonal immune responses in the CNS and contribute to progressive axon loss in MS.

TPI and GAPDH are glycolytic enzymes essential for efficient energy production (30, 31, 32, 33) and are expressed in all prokaryotic and eukaryotic organisms. In addition to its glycolytic functions, GAPDH is a multifunctional protein endowed with diverse activities, including phosphorylating transverse-tubule proteins (34), stimulating RNA transcription (35), and influencing DNA replication and DNA repair (36). TPI and GAPDH have been considered to associate with brain microtubules (23, 24). The role of the anti-TPI and anti-GAPDH Abs in axonal and neuronal disorders remains elusive. However, if TPI and GAPDH Abs in the CSF and in lesions correlate with axonal damage in MS, we suggest two mechanisms for the pathogenesis of anti-TPI and anti-GAPDH Abs. First, anti-TPI or anti-GAPDH Abs may induce an immune hypersensitivity reaction, through activation of complements and macrophages, leading to neuronal and axonal degeneration in MS. Alternatively, a direct role of Ab binding to protein(s) in the neurons may result in apoptosis. Abs binding to TPI and GAPDH in neurons and axons may block membrane translocation and may also inhibit enzymes that serve to preserve neuronal integrity and neuronal glycolytic activity (37). Recent studies have shown that binding of inhibitors like the natural beta-carbolines or {alpha}-monochlorohydrin to TPI and GAPDH causes decreased neuronal ATP production followed by progressive neuronal degeneration and death (38, 39). Inhibition of TPI activity by Abs has been reported in hepatitis A virus infections (40). Moreover, patients with TPI deficiency develop progressive neurological disorders (30).

GAPDH has been considered to play an important role in apoptotic cell death by a signaling pathway resulting in production of NO (37). Recently, it has been shown that NO elicits S-nitrosylation of GAPDH and subsequently translocation of GAPDH protein into the nucleus, which results in DNA fragmentation and apoptosis of cerebral granular cells (41). NO-S-nitrosylation-GAPDH cascade has been shown to play an important role in cytotoxicity in neuronal death (38). NO is synthesized by activation of different isoforms of NO synthases, including inducible NO synthase, that have been found to be a marker of brain inflammation in MS (42, 43, 44). A number of studies have shown that GAPDH plays an active role in various forms of apoptosis and may participate in neuronal death in Huntington’s disease, Parkinson’s disease, and Alzheimer’s disease (45, 46, 47).

Any type of trauma to the CNS has the potential to produce the "domino effect" type of degeneration, in which additional systems are progressively recruited into a degenerative chain reaction of axonal and transaxonal degeneration. The findings of anti-TPI and -GAPDH Abs in the CSF and in lesions of patients with MS suggest that TPI and GAPDH Ag-induced immune response may be recruited into the immune cascade at different stages of disease. Furthermore, evidence of the correlation of anti-GAPDH Igs with disease course, revealed by significantly lower percentage of CIS patients (10%) with elevated levels of GAPDH-reactive Abs compared with MS patients (60%), raises the question of whether GAPDH-induced immune responses produce neuronal and axon degeneration and contribute to clinical progression.

Recently, autoantibodies to GAPDH were described in CSF of patients with lupus, a rheumatic disorder with associated neurological abnormalities (48). These authors postulated that the autoimmune response to GAPDH might be primarily initiated by T and B cells reacting to foreign GAPDH, present on the surfaces of parasites, bacteria, and fungi (49, 50, 51, 52, 53), and subsequently the human GAPDH is inducing the Ab production (48). Previous reports also demonstrated that inhibition of GAPDH enzyme activity induces GAPDH nuclear accumulation and apoptotic death in neurons (54).

It might be interesting to analyze the interaction of anti-GAPDH CSF Abs with the GAPDH enzyme activity and its role in neuron apoptosis. Furthermore, development of an animal model to study the role of anti-GAPDH immune response in neuronal and axonal degeneration and passive transfer experiments using purified patient GAPDH-specific IgGs may contribute to the better understanding of GAPDH autoimmunity in MS.


   Acknowledgments
 
We thank Dr. Tourtellotte and Dr. Nagra, Diane Guntrip, and James S. Riehl for the brain tissue preparation.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Multiple Sclerosis Society Grant RG 3156A1/1 and National Institutes of Health Grant RO1 NS40534-01A1. Back

2 J.K. and H.-M.R. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Yufen Qin, Department of Neurology, University of California, 100 Irvine Hall, Irvine, CA 92697. E-mail address: qiny{at}uci.edu Back

4 Abbreviations used in this paper: MS, multiple sclerosis; CIS, clinically isolated syndrome; CSF, cerebrospinal fluid; scFv, single chain variable fragment; NAWM, normal appearing white matter; TPI, triosephosphate isomerase; OIND, other inflammatory neurological disease; ONIND, other noninflammatory neurological disease; RT, room temperature. Back

Received for publication April 5, 2006. Accepted for publication July 28, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Poser, C. M., D. W. Paty, L. Scheinberg, W. I. McDonald, F. A. Davis, G. C. Ebers, K. P. Johnson, W. A. Sibley, D. H. Silberberg, W. W. Tourtellotte. 1983. New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann. Neurol. 13: 227-231. [Medline]
  2. Qin, Y., P. Duquette, Y. Zhang, P. Talbot, R. Poole, J. Antel. 1998. Clonal expansion and somatic hypermutation of V-H genes of B cells from cerebrospinal fluid in multiple sclerosis. J. Clin. Invest. 102: 1045-1050. [Medline]
  3. Colombo, M., M. Dono, P. Gazzola, S. Roncella, A. Valetto, N. Chiorazzi, G. L. Mancardi, M. Ferrarini. 2000. Accumulation of clonally related B lymphocytes in the cerebrospinal fluid of multiple sclerosis patients. J. Immunol. 164: 2782-2789. [Abstract/Free Full Text]
  4. Owens, G. P., H. Kraus, M. P. Burgoon, T. Smith-Jensen, M. E. Devlin, D. H. Gilden. 1998. Restricted use of VH4 germline segments in an acute multiple sclerosis brain. Ann. Neurol. 43: 236-243. [Medline]
  5. Baranzini, S. E., M. C. Jeong, C. Butunoi, R. S. Murray, C. C. A. Bernard, J. R. Oksenberg. 1999. B cell repertoire diversity and clonal expansion in multiple sclerosis brain lesions. J. Immunol. 163: 5133-5144. [Abstract/Free Full Text]
  6. Owens, G. P., A. M. Ritchie, M. P. Burgoon, R. A. Williamson, J. R. Corboy, D. H. Gilden. 2003. Single-cell repertoire analysis demonstrates that clonal expansion is a prominent feature of the B cell response in multiple sclerosis cerebrospinal fluid. J. Immunol. 171: 2725-2733. [Abstract/Free Full Text]
  7. Qin, Y., P. Duquette, Y. Zhang, M. Olek, R. R. Da, J. Richardson, J. P. Antel, P. Talbot, N. R. Cashman, W. W. Tourtellotte, et al 2003. Intrathecal B-cell clonal expansion, an early sign of humoral immunity, in the cerebrospinal fluid of patients with clinically isolated syndrome suggestive of multiple sclerosis. Lab. Invest. 83: 1081-1088. [Medline]
  8. Haubold, K., G. P. Owens, P. Kaur, A. M. Ritchie, D. H. Gilden, J. L. Bennett. 2004. B-lymphocyte and plasma cell clonal expansion in monosymptomatic optic neuritis cerebrospinal fluid. Ann. Neurol. 56: 97-107. [Medline]
  9. Tourtellotte, W. W., R. W. Baumhefner, K. Syndulko, P. Shapshak, M. Osborne, G. Rubinshtein, L. Newton, G. Ellison, L. Myers, I. Rusarro. 1988. The long march of the cerebrospinal fluid profile indicative of clinical definite multiple sclerosis; and still marching. J. Neuroimmunol. 20: 217-227. [Medline]
  10. Lucchinetti, C., W. Bruck, J. Parisi, B. Scheithauer, M. Rodriguez, H. Lassmann. 2000. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann. Neurol. 47: 707-717. [Medline]
  11. Hafler, D. A., H. L. Weiner. 1987. In vivo labeling of blood T cells: rapid traffic into cerebrospinal fluid in multiple sclerosis. Ann. Neurol. 22: 89-93. [Medline]
  12. Gay, F. W., T. J. Drye, G. W. Dick, M. M. Esiri. 1997. The application of multifactorial cluster analysis in the staging of plaques in early multiple sclerosis: identification and characterization of the primary demyelinating lesion. Brain 120: 1461-1483. [Abstract/Free Full Text]
  13. Zhang, Y., R. R. Da, W. Guo, H. M. Ren, L. G. Hilgenberg, R. A. Sobel, W. W. Tourtellotte, M. A. Smith, M. Olek, S. Gupta, et al 2005. Axon reactive B cells clonally expanded in the cerebrospinal fluid of patients with multiple sclerosis. J. Clin. Immunol. 25: 254-264. [Medline]
  14. Zhang, Y., R. R. Da., L. G. Hilgenberg, W. W. Tourtellotte, R. A. Sobel, M. A. Smith, M. Olek, R. Nagra, S. Gupta, S. Van den Noort, Y. Qin. 2005. Clonal expansion of IgA-positive plasma cells and axon-reactive antibodies in MS lesions. J. Neuroimmunol. 167: 120-130. [Medline]
  15. Fernandez-Patron, C., L. Castellanos-Serra, P. Rodriguez. 1992. Reverse staining of sodium dodecyl sulfate polyacrylamide gels by imidazole-zinc salts: sensitive detection of unmodified proteins. BioTechniques 12: 564-573. [Medline]
  16. Da, R. R., G. Kao, W. Z. Guo, M. Olek, S. Gupta, Y. Zhang, S. Van Den Noort, Y. Qin. 2004. Polyclonal B-cell expansion in the cerebrospinal fluid of patients with pseudotumor cerebri. J. Clin. Immunol. 24: 674-682. [Medline]
  17. Colombo, M., M. Dono, P. Gazzola, S. Roncella, A. Valetto, N. Chiorazzi, G. L. Mancardi, M. Ferrarini. 2000. Accumulation of clonally related B lymphocytes in the cerebrospinal fluid of multiple sclerosis patients. J. Immunol. 164: 2782-2789. [Abstract/Free Full Text]
  18. Kölln, J., M. Matzas, N. Jänner, T. Mix, K. Klensang, R. Bredehorst, E. Spillner. 2004. Functional analysis of Cobra Venom Factor/human C3 chimeras transiently expressed in mammalian cells. Mol. Immunol. 41: 19-28. [Medline]
  19. Ausubel, F. M.. 1996. Current Protocols in Molecular Biology Wiley Interscience, New York.
  20. Reiber, H.. 1995. External quality assessment in clinical neurochemistry: survey of analysis for cerebrospinal fluid (CSF) proteins based on CSF/serum quotients. Clin. Chem. 41: 256-263. [Abstract/Free Full Text]
  21. Hela-Felicitas, P., D. Reske. 2005. Expansion of antibody reactivity in the cerebrospinal fluid of multiple sclerosis patients—follow-up and clinical implications. Cerebrospinal Fluid Res. 2: 3-10. [Medline]
  22. Bednarova, J., P. Stourac, L. Krbkova. 2005. The diagnostic significance of intrathecal occurrence of selected antiviral antibodies in multiple sclerosis. Scripta Medica 78: 249-254.
  23. Orosz, F., G. Wágner, K. Liliom, J. Kovács, K. Baróti, M. Horányi, T. Farkas, S. Hollán, J. Ovádi. 2000. Enhanced association of mutant triosephosphate isomerase to red cell membranes and to brain microtubules. Proc. Natl. Acad. Sci. USA 97: 1026-1031. [Abstract/Free Full Text]
  24. Huitorel, P., D. Pantaloni. 1985. Bundling of microtubules by glyceraldehyde-3-phosphate dehydrogenase and its modulation by ATP. Eur. J. Biochem. 150: 265-269. [Medline]
  25. Putnam, T.. 1936. Studies in multiple sclerosis. Arch. Neurol. Psychiatry 35: 1289-1308. [Abstract/Free Full Text]
  26. Greenfield, J., L. King. 1936. Observations on the histopathology of the cerebral lesions in disseminated sclerosis. Brain 59: 445-458. [Free Full Text]
  27. Ferguson, B., M. K. Matyszak, M. M. Esiri, V. H. Perry. 1997. Axonal damage in acute multiple sclerosis lesions. Brain 120: 393-399. [Abstract/Free Full Text]
  28. Trapp, B. D., J. Peterson, R. M. Ransohoff, R. Rudick, S. Mork, L. Bo. 1998. Axonal transection in the lesions of multiple sclerosis. N. Engl. J. Med. 338: 278-285. [Abstract/Free Full Text]
  29. Losseff, N. A., S. L. Webb, J. I. O’Riordan, R. Page, L. Wang, G. J. Barker, P. S. Tofts, W. I. McDonald, D. H. Miller, A. J. Thompson. 1996. Spinal cord atrophy and disability in multiple sclerosis: a new reproducible and sensitive MRI method with potential to monitor disease progression. Brain 119: 701-708. [Abstract/Free Full Text]
  30. Valentin, C., M. Cohen-Solal, L. Maquat, M. Horányi, M. Inselt-Kovács, S. Hollán. 2000. Identical germ-line mutations in the triosephosphate isomerase alleles of two brothers are associated with distinct clinical phenotypes. C. R. Acad. Sci. III 323: 245-250. [Medline]
  31. Lu, H. S., P. M. Yuan, R. W. Gracy. 1984. Primary structure of human triosephosphate isomerase. J. Biol. Chem. 259: 11958-11968. [Abstract/Free Full Text]
  32. Brodie, A. E., D. J. Reed. 1990. Cellular recovery of glyceraldehyde-3-phosphate dehydrogenase activity and thiol status after exposure to hydroperoxides. Arch. Biochem. Biophys. 276: 212-218. [Medline]
  33. Sabri, M. I., S. Ochs. 1971. Inhibition of glyceraldehyde-3-phosphate dehydrogenase in mammalian nerve by iodoacetic acid. J. Neurochem. 18: 1509-1514. [Medline]
  34. Kawamoto, R. M., A. H. Caswell. 1986. Autophosphorylation of glyceraldehydephosphate dehydrogenase and phosphorylation of protein from skeletal muscle microsomes. Biochemistry 25: 657-661. [Medline]
  35. Morgenegg, G., G. C. Winkler, U. Hubscher, C. W. Heizmann, J. Mous, C. C. Kuenzle. 1986. Glyceraldehyde-3-phosphate dehydrogenase is a nonhistone protein and a possible activator of transcription in neurons. J. Neurochem. 47: 54-62. [Medline]
  36. Baxi, M. D., J. K. Vishwanatha. 1995. Uracil DNA-glycosylase/glyceraldehyde-3-phosphate dehydrogenase is an Ap4A binding protein. Biochemistry 34: 9700-9707. [Medline]
  37. Sirover, M. A.. 1999. New insights into an old protein: the functional diversity of mammalian glyceraldehyde-3-phosphate dehydrogenase. Biochim. Biophys. Acta 1432: 159-184. [Medline]
  38. Bonnet, R., S. Pavlovic, J. Lehmann, H. Rommelspacher. 2004. The strong inhibition of triosephosphate isomerase by the natural beta-carbolines may explain their neurotoxic actions. Neuroscience 127: 443-453. [Medline]
  39. Sheline, C. T., D. W. Choi. 1998. Neuronal death in cultured murine cortical cells is induced by inhibition of GAPDH and triosephosphate isomerase. Neurobiol. Dis. 5: 47-54. [Medline]
  40. Ritter, K., A. Uy, S. Ritter, R. Thomssen. 1994. Hemolysis and autoantibodies to triosephosphate isomerase in a patient with acute hepatitis A virus infection. Scand. J. Infect. Dis. 26: 379-382. [Medline]
  41. Nakazawa, M., T. Uehara, Y. Nomura. 1997. Koningic acid (a potent glyceraldehyde-3-phosphate dehydrogenase inhibitor)-induced fragmentation and condensation of DNA in NG108–15 Cells. J. Neurochem. 68: 2493-2499. [Medline]
  42. Smith, K. J., H. Lassmann. 2002. The role of nitric oxide in multiple sclerosis. Lancet Neurol. 1: 232-241. [Medline]
  43. Bö, L., T. M. Dawson, S. Wesselingh, S. Möurk, S. Choi, P. A. Kong, D. Hanley, B. D. Trapp. 1994. Induction of nitric oxide synthase in demyelinating regions of multiple sclerosis brains. Ann. Neurol. 36: 778-786. [Medline]
  44. Bagasra, O., F. H. Michaels, Y. M. Zheng, L. E. Bobroski, S. V. Spitsin, Z. Fang, R. Tawadros, H. Koprowski. 1995. Activation of the inducible form of nitric oxide synthase in the brains of patients with multiple sclerosis. Proc. Natl. Acad. Sci. USA 92: 12041-12045. [Abstract/Free Full Text]
  45. Senatoro, V. V., V. Charles, P. H. Reddy, D. A. Tagle, D. M. Chuang. 2003. Overexpression and nuclear accumulation of glyceraldehyde-3-phosphate dehydrogenase in a transgenic mouse model of Huntington’s disease. Mol. Cell. Neurosci. 22: 285-297. [Medline]
  46. Tsuchiya, K., H. Tajima, T. Kuwae, T. Takeshima, T. Nakano, M. Tanaka, K. Sunaga, Y. Fukuhara, K. Nakashima, E. Ohama, et al 2005. Pro-apoptotic protein glyceraldehyde-3-phosphate dehydrogenase promotes the formation of Lewy body-like inclusions. Eur. J. Neurosci. 21: 317-326. [Medline]
  47. Mazzola, J. L., M. A. Sirover. 2003. Subcellular alteration of glyceraldehyde-3-phosphate dehydrogenase in Alzheimer’s disease fibroblasts. J. Neurosci. Res. 71: 279-285. [Medline]
  48. Takasaki, Y., K. Kaneda, M. Matsushita, H. Yamada, M. Nawata, R. Matsudaira, M. Asano, R. Mineki, N. Shindo, H. Hashimoto. 2004. Glyceraldehyde 3-phosphate dehydrogenase is a novel autoantigen leading autoimmune responses to proliferating cell nuclear antigen multiprotein complexes in lupus patients. Int. Immunol. 16: 1295-1304. [Abstract/Free Full Text]
  49. Goudot-Crozel, V., D. Caillol, M. Djabali, A. J. Dessein. 1989. The major parasite surface antigen associated with human resistence to schistosomiasis is a 37-kd glyceraldehyde-3P-dehydrogenase. J. Exp. Med. 170: 2065-2080. [Abstract/Free Full Text]
  50. Pancholi, V., V. A. Fischetti. 1993. Glyceraldehyde-3-phosphate dehydrogenase on the surface of group A streptococci is also an ADP-ribosylating enzyme. Proc. Natl. Acad. Sci. USA 90: 8154-8158. [Abstract/Free Full Text]
  51. Taylor, J. M., D. E. Heinrichs. 2002. Transferrin binding in Staphylococcus aureus: involvement of a cell wall-anchored protein. Mol. Microbiol. 43: 1603-1614. [Medline]
  52. Rosinha, G. M., A. Myioshi, V. Azevedo, G. A. Splitter, S. C. Oliveira. 2002. Molecular and immunological characterization of recombinant Brucella abortus glyceraldehyde-3-phosphate-dehydrogenase, a T- and B-cell reactive protein that induces partial protection when co-administered with an interleukin-12-expressing plasmid in a DNA vaccine formulation. J. Med. Microbiol. 51: 661-671. [Abstract/Free Full Text]
  53. Gil, M. L., E. Villamon, C. Monteagudo, C. Gozalbo, J. P. Martinez. 1999. Clinical strains of Candida albicans express the surface antigen glyceraldehyde-3-phosphate dehydrogenase in vitro and in infected tissues. FEMS Immunol. Med. Microbiol. 23: 229-234. [Medline]
  54. Saunders, P. A., R. W. Chen, D. M. Chuang. 1999. Nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase isoforms during neuronal apoptosis. J. Neurochem. 72: 925-932. [Medline]



This article has been cited by other articles:


Home page
 Mol. Cell. ProteomicsHome page
N. Fissolo, S. Haag, K. L. de Graaf, O. Drews, S. Stevanovic, H. G. Rammensee, and R. Weissert
Naturally Presented Peptides on Major Histocompatibility Complex I and II Molecules Eluted from Central Nervous System of Multiple Sclerosis Patients
Mol. Cell. Proteomics, September 1, 2009; 8(9): 2090 - 2101.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
L. Lovato, R. Cianti, B. Gini, S. Marconi, L. Bianchi, A. Armini, E. Anghileri, F. Locatelli, F. Paoletti, D. Franciotta, et al.
Transketolase and 2',3'-Cyclic-nucleotide 3'-Phosphodiesterase Type I Isoforms Are Specifically Recognized by IgG Autoantibodies in Multiple Sclerosis Patients
Mol. Cell. Proteomics, December 1, 2008; 7(12): 2337 - 2349.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
H Wekerle
Lessons from multiple sclerosis: models, concepts, observations
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii56 - iii60.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
V. Somers, C. Govarts, K. Somers, R. Hupperts, R. Medaer, and P. Stinissen
Autoantibody Profiling in Multiple Sclerosis Reveals Novel Antigenic Candidates
J. Immunol., March 15, 2008; 180(6): 3957 - 3963.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
R. A. Sobel
Anti-Viral T-Cell Immunity + Anti-CNS Autoantibody = A Model for Human Acute Disseminated Encephalomyelitis or Multiple Sclerosis Relapse?
Am. J. Pathol., February 1, 2007; 170(2): 436 - 438.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kolln, J.
Right arrow Articles by Qin, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kolln, J.
Right arrow Articles by Qin, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS